ID: 1181842215

View in Genome Browser
Species Human (GRCh38)
Location 22:25673601-25673623
Sequence GCCCAAACGCAGGTTTCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 54}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181842211_1181842215 20 Left 1181842211 22:25673558-25673580 CCTGTGTCCTTGTGGACTCTGAG 0: 1
1: 0
2: 1
3: 22
4: 191
Right 1181842215 22:25673601-25673623 GCCCAAACGCAGGTTTCTATAGG 0: 1
1: 0
2: 0
3: 1
4: 54
1181842210_1181842215 21 Left 1181842210 22:25673557-25673579 CCCTGTGTCCTTGTGGACTCTGA 0: 1
1: 0
2: 0
3: 34
4: 224
Right 1181842215 22:25673601-25673623 GCCCAAACGCAGGTTTCTATAGG 0: 1
1: 0
2: 0
3: 1
4: 54
1181842212_1181842215 13 Left 1181842212 22:25673565-25673587 CCTTGTGGACTCTGAGAATCAAA 0: 1
1: 0
2: 0
3: 20
4: 203
Right 1181842215 22:25673601-25673623 GCCCAAACGCAGGTTTCTATAGG 0: 1
1: 0
2: 0
3: 1
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181842215 Original CRISPR GCCCAAACGCAGGTTTCTAT AGG Intronic
905422705 1:37859428-37859450 GACCAAACTGAGGTCTCTATTGG + Intronic
912513864 1:110206197-110206219 GGCCAAACTCAGGTTCCTCTTGG - Intergenic
1062781231 10:210462-210484 GCCCAAAGGCAGGCTTCAGTAGG + Intronic
1070573903 10:77662488-77662510 GCCCAGAAGAAGGTTTTTATGGG - Intergenic
1072758009 10:98033349-98033371 GCCCAAACACAGCTTTCTTGAGG + Intergenic
1084461499 11:69298978-69299000 CCTCAAACTCAGGATTCTATAGG + Intronic
1093293877 12:17363994-17364016 GTCCAACCTCAGGTTTCTCTTGG + Intergenic
1117098736 14:52323685-52323707 GCCAAAATGAAGTTTTCTATGGG + Intronic
1118906217 14:70025354-70025376 TCCCAAGCCCAGGTTCCTATGGG - Intronic
1122280006 14:100616406-100616428 GCACAATCGCAGATTTCTTTGGG - Intergenic
1124193214 15:27598232-27598254 AGCCAGACGCAGGTTTCTCTTGG + Intergenic
1125444347 15:39737237-39737259 GGGCAAACGCAGGTATTTATAGG - Intronic
1127517509 15:59710532-59710554 GCCCAAACCCAGGTGATTATGGG + Intergenic
1134039660 16:11058830-11058852 GCCCAAACGCCTGTTCCTCTTGG - Intronic
1138410770 16:56838241-56838263 CCCCAAACCCAGTTTTCTCTGGG - Intronic
1138653517 16:58475696-58475718 GCTCAAAGGCAGGATTCTAAAGG - Intronic
1140943083 16:79740771-79740793 TCCCAAAGGGAGATTTCTATGGG + Intergenic
1145119896 17:20248969-20248991 ATCCAAACCCATGTTTCTATGGG - Intronic
1157793992 18:50559121-50559143 GCCAAAACGCAGGTCTCACTCGG + Intergenic
1160543057 18:79635599-79635621 GCACAAGCGCATGTTTCAATGGG + Intergenic
1167293504 19:48636759-48636781 CCCCGCACGCAGGTTTCTATGGG + Intronic
928186889 2:29118431-29118453 CCCCAAACTCTGATTTCTATAGG - Intronic
929138533 2:38647466-38647488 GCCCAACCTCAATTTTCTATAGG - Intergenic
933082566 2:78011039-78011061 GCCCAAACTCAAGCTTTTATCGG - Intergenic
936494861 2:113009677-113009699 TCCCAAACTCAGGTTTCTCCAGG + Intergenic
943566493 2:189522995-189523017 GAACAAAAGCAGGTCTCTATTGG - Intergenic
947098705 2:226595272-226595294 GACCACACTCAGGTTTCTAGTGG - Intergenic
1173323972 20:42016164-42016186 GAGCACAGGCAGGTTTCTATGGG + Intergenic
1173616922 20:44409245-44409267 TCCCAAACCCAGTTTTCAATGGG + Intronic
1181102295 22:20549602-20549624 CCCCAAAGGCAGGTTTATCTAGG - Intronic
1181842215 22:25673601-25673623 GCCCAAACGCAGGTTTCTATAGG + Intronic
952519686 3:34144216-34144238 GCCCCAAAACAGGTTTTTATTGG - Intergenic
965459957 3:168950279-168950301 GCCCAAACTCACTTTTCTTTGGG - Intergenic
968918283 4:3507774-3507796 ACCCAAAAGTAGGTTTCTTTGGG + Exonic
978394200 4:108260866-108260888 GTCCTAACCCATGTTTCTATTGG + Intergenic
987822208 5:22980297-22980319 TCCCAAAAGCTAGTTTCTATAGG - Intergenic
987877626 5:23699256-23699278 GCACAAACACAATTTTCTATTGG + Intergenic
989604837 5:43233999-43234021 GCAGAAACTCGGGTTTCTATTGG + Intronic
990493292 5:56322294-56322316 TATCAAAGGCAGGTTTCTATGGG + Intergenic
1003482596 6:6546834-6546856 GCCGAGCCGCAGGTTTCTAGAGG + Intergenic
1004537613 6:16518219-16518241 GCCCCACCCCAGCTTTCTATGGG + Intronic
1009819431 6:68781246-68781268 TGCCAAACGCAGTTTTCTCTTGG + Intronic
1011078111 6:83459674-83459696 GCCCAAGCACAAGTTTCCATGGG - Intergenic
1012145839 6:95680785-95680807 CCCCAAAAGCAGGATGCTATAGG + Intergenic
1012911202 6:105119958-105119980 GCCCAAATCCATGTTTTTATGGG - Intronic
1022242948 7:28530504-28530526 CCCCAAAGGCAGCTTTTTATGGG - Intronic
1024585689 7:50839901-50839923 TCCCAAACTCAGATGTCTATAGG - Intergenic
1026885048 7:73935963-73935985 GCCCAAATGCAGGTGTCACTAGG - Intergenic
1027776469 7:82471666-82471688 GTCAAAAGGCAGGTTTCCATAGG - Intergenic
1039520904 8:38170677-38170699 GACCCAACGCAGGTATCCATGGG + Intronic
1047144686 8:122184970-122184992 GCCCAAAACCAGCTTGCTATTGG + Intergenic
1055562202 9:77532207-77532229 GTCCAAATGCAGGTTTATGTTGG + Intronic
1060887868 9:127168298-127168320 GCCCTAAAACAGGTTTCCATTGG - Intronic
1187682562 X:21782427-21782449 GCCCAGATGCAGGTTGCTAATGG - Intergenic
1188032001 X:25274456-25274478 GGCCAAACTCAGATTTCAATGGG + Intergenic
1201636915 Y:16133439-16133461 GCCCAGAACCAGGTTTCTCTTGG - Intergenic