ID: 1181844628

View in Genome Browser
Species Human (GRCh38)
Location 22:25697221-25697243
Sequence TCCTCCCCAGCCTATATGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181844628_1181844630 17 Left 1181844628 22:25697221-25697243 CCATGCATATAGGCTGGGGAGGA 0: 1
1: 0
2: 0
3: 13
4: 123
Right 1181844630 22:25697261-25697283 TCATTTTTTAAAAGACTAGAGGG 0: 1
1: 1
2: 4
3: 68
4: 709
1181844628_1181844629 16 Left 1181844628 22:25697221-25697243 CCATGCATATAGGCTGGGGAGGA 0: 1
1: 0
2: 0
3: 13
4: 123
Right 1181844629 22:25697260-25697282 TTCATTTTTTAAAAGACTAGAGG 0: 1
1: 1
2: 7
3: 94
4: 700

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181844628 Original CRISPR TCCTCCCCAGCCTATATGCA TGG (reversed) Intronic
901786870 1:11630377-11630399 TCCACCCCAGCCTACATGGGTGG - Intergenic
902701020 1:18172062-18172084 CCCTCCTCAGCCTGTAAGCATGG - Intronic
904849296 1:33445268-33445290 TCCTCCGCAGGCTGGATGCACGG + Intergenic
907324236 1:53626442-53626464 TACTCCCCAGCCTGCATCCAGGG + Intronic
907648538 1:56269318-56269340 TCCTACCCTGCCTCTATGCTTGG + Intergenic
910332911 1:86096589-86096611 TCCTCCTCAGCCTAAATACAAGG + Intronic
912507676 1:110167247-110167269 TCATCCCCGGCCTATTTGCAGGG - Intronic
912822435 1:112878818-112878840 ACCTCCCCAGACTTTATGCCAGG + Intergenic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
914979860 1:152404534-152404556 TCCTCCCCAGCCCCTTTGGATGG + Intergenic
918512733 1:185329161-185329183 TCCTGTCCAGTCAATATGCAAGG - Intergenic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
922910504 1:229211773-229211795 TCCTCCCCAGCTTGTAGCCAAGG + Intergenic
923629422 1:235640134-235640156 TCCTCCCCAGGCTGAATGCATGG - Intronic
1062975573 10:1680049-1680071 GCCTCCCCAGCCTGTTTGCTTGG + Intronic
1063389259 10:5638594-5638616 TCCTCCCCTGCCCTTATGCAGGG - Intergenic
1064323800 10:14330247-14330269 TCCTCCCCACCCTGTGTGAAAGG - Intronic
1066266567 10:33781695-33781717 TCCACTCCAGGCTATATCCATGG - Intergenic
1066435114 10:35390647-35390669 TGCTTCCCAGCCTATGTGCAGGG + Intronic
1067381366 10:45776694-45776716 TCCTCCCCATCCTTCAAGCAGGG - Intronic
1067889067 10:50117327-50117349 TCCTCCCCATCCTTCAAGCAGGG - Intronic
1068883437 10:62074598-62074620 CCTTCCCCAGCCTTTATCCATGG - Intronic
1079367267 11:19820251-19820273 TGCTCCCAAGCCTTTCTGCAAGG + Intronic
1084572266 11:69966748-69966770 TCCTCCCCATGCTCTCTGCAGGG - Intergenic
1084964932 11:72739511-72739533 CCCTCCCCACCCAGTATGCAAGG + Intronic
1089573540 11:119425155-119425177 CCCTCCCCTGCCTAAAAGCAAGG - Intergenic
1091947672 12:4562746-4562768 TCCCACCCAGCCCATATGCCCGG + Intronic
1091969382 12:4772973-4772995 TCCTCCCCAGCTCATCTGCTTGG + Intronic
1093866185 12:24229768-24229790 TCCTGCCCAGCCTATTAGCCGGG - Intergenic
1094851002 12:34382314-34382336 TCCTCCCCACCGTGCATGCATGG - Intergenic
1094854530 12:34397063-34397085 GCCTCCCCAGCACACATGCATGG + Intergenic
1095749499 12:45695671-45695693 TCCTCCCCAGCCTGTCAGAATGG - Intergenic
1099621877 12:85012431-85012453 TCCTCCCCAGCCTCTTTACTAGG + Intergenic
1103739980 12:123084458-123084480 TCCTCCCAAGCCTGAATGCACGG - Intronic
1103949522 12:124543304-124543326 TCCTCCCCAGTCGCTATGCCCGG - Intronic
1105858424 13:24390565-24390587 TCCGCCCCAGCCAAGATGAAGGG - Intergenic
1110489093 13:76081493-76081515 TTATCCCCACCCTATATGTAGGG - Intergenic
1112497972 13:99920056-99920078 CCATGCCCAGCCTAAATGCATGG + Intergenic
1112941333 13:104866187-104866209 TCCTCCCCAGCCTATGCCCACGG + Intergenic
1113472155 13:110554859-110554881 CCCTCCCAAGCCGAAATGCAAGG - Intronic
1114256924 14:21011091-21011113 ATCTCCCCAGCCTATATGTTAGG + Intergenic
1119769591 14:77212099-77212121 TCCTCCTCAGCTTATTTGTAAGG - Intronic
1122017144 14:98805740-98805762 GCCTCCCCATCCTATCTGCAGGG - Intergenic
1124146020 15:27126317-27126339 CCCTCCCCTGCCTACATGCTGGG - Intronic
1124493624 15:30173475-30173497 TCCTCCCCAGCCTGGAGGCCCGG + Intergenic
1124749944 15:32365174-32365196 TCCTCCCCAGCCTGGAGGCCCGG - Intergenic
1126298972 15:47174219-47174241 TCCTTCCCCAGCTATATGCATGG - Intergenic
1130576491 15:85097451-85097473 TCCTCCACACCCTATATACAGGG + Intronic
1131425932 15:92345544-92345566 CCCACCCCTGCCTGTATGCAGGG + Intergenic
1131580242 15:93635893-93635915 TATTCCCCAGCCTATGTGAAAGG + Intergenic
1134387239 16:13784818-13784840 TCCTTTTCAGCTTATATGCAAGG + Intergenic
1135041607 16:19121760-19121782 TGATCCCCAGCCTTAATGCATGG - Intronic
1137640340 16:50023489-50023511 TACTTCCCAGCCTATAAGGATGG - Intergenic
1139953778 16:70684063-70684085 CCCTCTCCAGCCAATTTGCAAGG - Intronic
1140374212 16:74431786-74431808 TCTTCCACAGCCCATCTGCACGG + Intergenic
1142597286 17:1035781-1035803 CCCTCCCCAGGCTCTCTGCAAGG + Intronic
1143697668 17:8631629-8631651 TCCTGCCCAGCCTCCAGGCAAGG + Intergenic
1144620510 17:16815685-16815707 GCCTCTCCAGCCAACATGCAAGG + Intergenic
1149073417 17:52570925-52570947 TCCTCTCCAGCCTCACTGCATGG + Intergenic
1156475444 18:37402916-37402938 CCCTCCCCACCCTCCATGCATGG + Intronic
1160010706 18:75105520-75105542 TCTTCCCCAGCCTTTATCCGAGG - Intergenic
1160295419 18:77632782-77632804 TCCCACCCACCCAATATGCAGGG - Intergenic
1161663520 19:5561265-5561287 TCCTGCCCAGCCTATCGGGAGGG - Intergenic
1163642880 19:18471630-18471652 TGCACTCCAGCCTAGATGCAGGG + Intronic
925000779 2:401266-401288 TCCTCCACAGCCTGGAGGCAGGG - Intergenic
925523412 2:4773239-4773261 TTGTCACCAGCCTATGTGCATGG - Intergenic
926189505 2:10717887-10717909 TCCTCCCCAGCCTTTATTCCTGG + Intergenic
926893283 2:17657481-17657503 ACCTCACCAGCCTATAGGGAAGG - Intergenic
929996232 2:46827932-46827954 TCATCCCCAGCCTGTAGGCCTGG + Intronic
932176173 2:69604789-69604811 TGCACCCCAGCCTCTCTGCATGG + Intronic
932501086 2:72183213-72183235 TCCTACACTGCCTAGATGCAGGG + Intronic
932977729 2:76624881-76624903 TCCTCCCCAGCTCATGTGCCAGG + Intergenic
933133022 2:78697151-78697173 TCTTCCCCAGCCTCTCTGGAGGG - Intergenic
937865517 2:126748531-126748553 TCTTCCCCAGCCTTTGTGCTTGG + Intergenic
939541944 2:143504947-143504969 TCCTCCCCACCCTGCCTGCATGG + Intronic
942136935 2:172935265-172935287 TCTTCCCCAGCCTAGAAACATGG + Intronic
944078390 2:195757908-195757930 TCCTCTCCAGATTATATTCAAGG - Intronic
946097107 2:217284268-217284290 TCCCTCCCAGCCTATGGGCATGG + Intronic
946224569 2:218257195-218257217 TCCTCTACAGCCCATATCCAAGG - Intergenic
946918325 2:224550129-224550151 TACTCCTCACCCTAAATGCATGG + Intronic
947828458 2:233122432-233122454 TCCTCCCCAGCTTATTAGCCAGG + Intronic
1169189629 20:3649961-3649983 TTCTCCCCAGGCTGTGTGCAGGG - Exonic
1170542173 20:17400430-17400452 TCATCCTCATCCTATAAGCAGGG - Intronic
1172817852 20:37703653-37703675 TCCTCCCCTGCCTATCCCCATGG + Intronic
1174032007 20:47636388-47636410 TCCTCTACATCCAATATGCATGG + Exonic
1174378117 20:50139575-50139597 TCCTCCCCAGCCTGGAAACACGG + Intronic
1176422395 21:6526699-6526721 TCCAGCCCAGCCGACATGCACGG - Intergenic
1179013988 21:37578997-37579019 TACTTCCCAGTTTATATGCATGG + Intergenic
1179697886 21:43135015-43135037 TCCAGCCCAGCCGACATGCACGG - Intergenic
1180607142 22:17067294-17067316 TTCTACCCAGCCTAAATTCAAGG - Intergenic
1181844628 22:25697221-25697243 TCCTCCCCAGCCTATATGCATGG - Intronic
1182039420 22:27224839-27224861 TCCTCCCCACCCCATATCTACGG - Intergenic
1182041698 22:27243191-27243213 TCCTCCCCAGCCACTCTGCAAGG - Intergenic
1184109696 22:42387577-42387599 CCCACCCCAGCCTGTATTCAAGG + Intronic
1185277662 22:49956796-49956818 TCCTCCCCAGCCCATGGGCCTGG - Intergenic
950201684 3:11048906-11048928 TCCTCTACATCCTATATTCATGG - Intergenic
950304714 3:11909077-11909099 TCCTCTCCAATCTAAATGCAGGG - Intergenic
950305695 3:11914199-11914221 TCCTCTCCAATCTAAATGCAGGG - Intergenic
950416446 3:12871724-12871746 TCCTCTCCAATCTAAATGCAGGG - Intronic
950883959 3:16346831-16346853 TCATCCTCAGCCTGTCTGCAGGG - Intronic
951294294 3:20915120-20915142 TACTCCTCAGTCTAAATGCAGGG + Intergenic
960146784 3:114212244-114212266 TCTTCCCAAGCCTGTGTGCAGGG - Intergenic
962361858 3:134749461-134749483 TCCTCCCCACCCCATATACCTGG - Intronic
963757263 3:149248188-149248210 ACCTCCCCAAACAATATGCATGG + Intergenic
965013045 3:163121661-163121683 TACTTCCCAGACTATAAGCAAGG + Intergenic
966421381 3:179738076-179738098 TCGTCCCCAGACTATAGGCATGG + Intronic
969365919 4:6694236-6694258 GCCTCCCCTGCCTTTATGCCAGG - Intronic
971175228 4:24276242-24276264 TCCTCCCCAAGCTATAATCATGG - Intergenic
971244160 4:24913161-24913183 TCCTGCCCGGCCTCTAGGCAAGG + Intronic
972289345 4:37677147-37677169 TCCTCCTCATCCTACATCCAAGG + Intronic
972630424 4:40837164-40837186 TCCTCCCCAGCCCACATGCTCGG - Intronic
973007244 4:45028367-45028389 TCCTCCCCAAGATATTTGCATGG - Intergenic
974950278 4:68578081-68578103 TCCTGCCCAGCCTACTGGCACGG + Intronic
978009088 4:103656609-103656631 TCCTCCTCAACCTCTAGGCAAGG - Intronic
978458666 4:108925411-108925433 TCTTCCCCCTTCTATATGCATGG - Intronic
988992599 5:36686044-36686066 TCCTCCCCACCCTGCCTGCAGGG + Exonic
991428410 5:66516479-66516501 TCCTGTCCTGCCAATATGCAGGG + Intergenic
992329736 5:75703790-75703812 TCATCCCCTGCCCATATCCAGGG + Intronic
997764778 5:136490647-136490669 TACTACCCAGCATATGTGCATGG + Intergenic
1001401740 5:171450288-171450310 TCCTCCCCAGCCTCTTGGTATGG - Intronic
1004035245 6:11917175-11917197 TCCTCCCGGCCCTGTATGCATGG + Intergenic
1007079776 6:39091471-39091493 TCCATCGCAGCCTTTATGCAGGG + Intergenic
1008967064 6:57323397-57323419 TCTTATCCAGCCTATATCCAAGG - Intronic
1015455710 6:133424512-133424534 CCCCCCCCAGCCTATAAGGATGG + Intronic
1022238739 7:28488522-28488544 TCCTGCCCACCAAATATGCAGGG + Intronic
1023528703 7:41131422-41131444 TCTTCCCCAGGCTCTATGGAAGG - Intergenic
1027560620 7:79724403-79724425 TCCTCCCCTGCCCAGATGGAAGG - Intergenic
1032660397 7:133977494-133977516 TCGTCCTCAGCCTATAGGAACGG + Intronic
1034808812 7:154112044-154112066 TCCACTCCAGCCAACATGCAAGG - Intronic
1036575745 8:10026352-10026374 TGCTCCCCATCCTGTCTGCATGG - Intergenic
1044758889 8:95495779-95495801 TCCTCCACAACCTCCATGCAGGG - Intergenic
1049220350 8:141426101-141426123 CCCTCCCCAGCCTCCAGGCAGGG - Intronic
1056114003 9:83424159-83424181 TCCTCCCTAGCCTCTCAGCAAGG - Intronic
1060018678 9:120109659-120109681 TCCTCCCCTGCCTATGTTCTAGG + Intergenic
1189848452 X:45157322-45157344 TCCTTCCAAGCATAGATGCAAGG + Intronic
1192710500 X:73578999-73579021 TTCCCCCCAGCCTCTTTGCAGGG + Intronic
1199582113 X:149370745-149370767 TCTTACCCAGCCATTATGCAAGG + Intergenic