ID: 1181845044

View in Genome Browser
Species Human (GRCh38)
Location 22:25700040-25700062
Sequence GTGTTTCAGCAGAAGCAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 307}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181845044_1181845049 27 Left 1181845044 22:25700040-25700062 CCCCCTTGCTTCTGCTGAAACAC 0: 1
1: 0
2: 3
3: 28
4: 307
Right 1181845049 22:25700090-25700112 TCCCCTACAAGAATACTGCAAGG 0: 1
1: 0
2: 0
3: 14
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181845044 Original CRISPR GTGTTTCAGCAGAAGCAAGG GGG (reversed) Intronic
901007175 1:6177815-6177837 GTGTTCCAGAAGCAGCAAGGAGG + Intronic
902667020 1:17946651-17946673 GTGTTCCAGGAACAGCAAGGAGG + Intergenic
904610723 1:31724890-31724912 GTGTTTGAGCAGAATCAACAAGG + Intergenic
906117460 1:43366202-43366224 GTGTCCCAGCACAGGCAAGGAGG - Intronic
907004321 1:50894859-50894881 GGGTTACAGCAAAAGCAAGAGGG + Intronic
907785515 1:57608423-57608445 GTGATGAAGCACAAGCAAGGGGG - Intronic
908067270 1:60420461-60420483 GTGTCTCAGCAGCAGGAAGGTGG + Intergenic
908880992 1:68733128-68733150 GTGTTGCATTAGAAGCAAAGTGG - Intergenic
909093111 1:71252284-71252306 GTTTTTCAGCACCAGCAAAGAGG - Intergenic
909646837 1:77926864-77926886 GTGCTTTTGAAGAAGCAAGGCGG + Exonic
910626852 1:89316477-89316499 GAGGGTGAGCAGAAGCAAGGTGG + Intergenic
911692222 1:100846976-100846998 GTGATTCAGCAGCAGAAAGAAGG - Intergenic
914323149 1:146584706-146584728 GTGTTTCTGCAAAAGCACGGTGG - Intergenic
914686442 1:149984084-149984106 GTGTTTCAATAAAAGCAAGGTGG - Intronic
914908728 1:151767977-151767999 GTGTGTCCGTTGAAGCAAGGTGG - Intronic
914923726 1:151865372-151865394 GAGTTGCAGCAGGAGGAAGGAGG - Intergenic
915214429 1:154330387-154330409 TTGTTGCAGAAGAAGAAAGGAGG + Exonic
916361990 1:163980642-163980664 ATGTTTCATCAGCAGCAAGATGG + Intergenic
917444229 1:175093209-175093231 GTGTTCAAGCAACAGCAAGGAGG - Intronic
917695728 1:177521238-177521260 GTGTTGGAGGAGCAGCAAGGAGG - Intergenic
917994125 1:180417281-180417303 GTGTTTGAGCAGAGGGAATGTGG - Intronic
919278451 1:195452039-195452061 GTGTTTCAGCAGTAGCAGGAGGG + Intergenic
919322511 1:196061110-196061132 GTGTTTTTGAAGAAGCAAAGTGG - Intergenic
919493747 1:198238167-198238189 GTGTTCCAACTGAAGCAAGGAGG - Intronic
919793470 1:201307295-201307317 GTGTTCCAGGAAAAGAAAGGAGG + Intronic
920882667 1:209895044-209895066 GTTTTGCAGCAAAAGAAAGGAGG + Intergenic
921333291 1:214062037-214062059 GTGTTTCAGCAACAGTAAGGAGG - Intergenic
923622958 1:235592864-235592886 GTGTTGCAGTGGAAGAAAGGAGG - Intronic
924783764 1:247175502-247175524 GTGTTCCAGCAGCAGACAGGAGG + Intergenic
924827959 1:247561914-247561936 GGGTTGCAGCAGGACCAAGGAGG + Intronic
924886938 1:248229066-248229088 GGATATCAGCAGAAGCAGGGTGG + Intergenic
1064218822 10:13422057-13422079 TTGGTTCTGCAGAAGCCAGGAGG - Intergenic
1065646934 10:27844881-27844903 TTGACTTAGCAGAAGCAAGGTGG + Intronic
1069802799 10:71092678-71092700 GTTTTTCAGCATAAGGAAGTGGG + Intergenic
1070897826 10:80000205-80000227 ATGTTTAAGAAAAAGCAAGGAGG - Intergenic
1071638420 10:87280004-87280026 TTGTTTCAGGGGAAGGAAGGAGG + Intergenic
1071656822 10:87457948-87457970 TTGTTTCAGGGGAAGGAAGGAGG - Intergenic
1075177751 10:120181621-120181643 CTGTTTCAGCACAAGAAAGCAGG + Intergenic
1077753270 11:4997730-4997752 CTGGTTCAGCACAGGCAAGGAGG + Intergenic
1078811986 11:14777291-14777313 GTGTTTGAGAAGGAGAAAGGGGG + Intronic
1078818888 11:14855919-14855941 GTATTTCAGCAGAAGAAGGGTGG + Intronic
1080239028 11:30105196-30105218 GTGTTTCAGGAATGGCAAGGAGG + Intergenic
1080763670 11:35276472-35276494 GTGTGTCAGCAGAAGGGAGTTGG - Intronic
1081595699 11:44457982-44458004 GTCTTTCAACAGAAGGATGGGGG - Intergenic
1082670624 11:56032970-56032992 GTGGGTGAGCAGAAGCAGGGTGG + Intergenic
1082872225 11:57953829-57953851 GAGGTTGAGCAGAAGCAGGGTGG - Intergenic
1083553250 11:63606722-63606744 GTGTCTGAGCAACAGCAAGGAGG + Intronic
1086426294 11:86686791-86686813 CTGCTTAAGCAAAAGCAAGGAGG - Intergenic
1088975839 11:114815838-114815860 GAGTTTCAGCAGAACAGAGGTGG - Intergenic
1089227085 11:116933902-116933924 GTGTTTGAGAAATAGCAAGGTGG - Intronic
1090960163 11:131549200-131549222 GTTTGACAGCAGAAGCATGGAGG + Intronic
1091127482 11:133114020-133114042 CTGTTTCTGAAGAAGCAGGGAGG - Intronic
1091213989 11:133888658-133888680 ATGTTTCACCACACGCAAGGTGG + Intergenic
1092059792 12:5539110-5539132 GTGATGCAGGAGAAGCGAGGTGG + Intronic
1095664232 12:44776731-44776753 GTTTTTCATTACAAGCAAGGAGG - Intronic
1096403044 12:51323481-51323503 GTGTTTCAGCTGACGTAAGCAGG - Intronic
1098420572 12:70292560-70292582 GTGTTTGAGGAATAGCAAGGAGG + Intronic
1098706810 12:73702165-73702187 GAGTGTGAGCAGAAGCAGGGTGG + Intergenic
1098974772 12:76890988-76891010 GTGATTCTGCAGGAGCAAAGGGG - Intergenic
1101460301 12:104884313-104884335 GTGTGTGAGCCGAAGCAGGGTGG - Intronic
1102783233 12:115583674-115583696 GTGTTTCAGCAGAAGGAAAGTGG - Intergenic
1103180917 12:118910607-118910629 GTTTTTCAGCAGAAGGCAGGTGG + Intergenic
1104068749 12:125327168-125327190 GGGTGTCAGCAGAAGAGAGGTGG - Intronic
1106552545 13:30784698-30784720 GTGTTTGAGAAGCAGAAAGGGGG + Intergenic
1110187307 13:72690495-72690517 GTGTTTAGGCAGAAAAAAGGGGG + Intergenic
1110291560 13:73813622-73813644 CTCTGGCAGCAGAAGCAAGGAGG - Intronic
1110394242 13:75011506-75011528 CTGTTTCACCAGAGGCATGGGGG + Intergenic
1110636188 13:77769132-77769154 GTGTTTGAGGAAGAGCAAGGAGG + Intergenic
1111554895 13:89867892-89867914 GTGTTCAAGCAAAAGCTAGGGGG - Intergenic
1111948679 13:94692319-94692341 GTGTTTGAGCAGCAGCAAGAAGG + Intergenic
1112405686 13:99118228-99118250 GTGTTTTAGCAGATTAAAGGTGG + Intergenic
1113226212 13:108162559-108162581 GTGCTTCAGTGGAAGTAAGGGGG + Intergenic
1115465906 14:33713904-33713926 GTGTTTGAGGAATAGCAAGGAGG - Intronic
1115604929 14:34991671-34991693 GTGTAGCAGCAATAGCAAGGAGG + Intronic
1116659110 14:47685068-47685090 GTGTGTCAGCAGCAGGTAGGGGG - Intergenic
1117532707 14:56675007-56675029 GTGTTTGGGCAGTAGCAAGTAGG + Intronic
1118182861 14:63510647-63510669 GTGTTTGAGAAACAGCAAGGAGG + Intronic
1118235943 14:64005063-64005085 GTGTTTGAGGAAAGGCAAGGAGG + Intronic
1119424052 14:74524514-74524536 TTGGTGCAGGAGAAGCAAGGCGG - Intronic
1121439418 14:93939426-93939448 GTGTTGCAGCAGCAGCTCGGTGG + Exonic
1121464993 14:94110083-94110105 GTGTGGCAGGAGCAGCAAGGGGG - Intronic
1121927709 14:97944063-97944085 GTGTTTCACCAGAAGCCAGTTGG - Intronic
1122566527 14:102661570-102661592 GTGCTTCAGGAAAAGCAATGGGG + Intronic
1123459772 15:20459359-20459381 GTGTTTCAGAAGAACGAATGTGG - Intergenic
1123472268 15:20564251-20564273 GTGTTCCAGCAGGAGCCAAGAGG + Intergenic
1123645735 15:22436102-22436124 GTGTTCCAGCAGGAGCCAAGAGG - Intergenic
1123658290 15:22541061-22541083 GTGTTTCAGAAGAACGAATGTGG + Intergenic
1123732573 15:23159242-23159264 GTGTTCCAGCAGGAGCCAAGAGG + Intergenic
1123750706 15:23356622-23356644 GTGTTCCAGCAGGAGCCAAGAGG + Exonic
1124266002 15:28235196-28235218 GTGTTTCAGAAGAACGAATGTGG - Intronic
1124283077 15:28380538-28380560 GTGTTCCAGCAGGAGCCAAGAGG + Exonic
1124299622 15:28531075-28531097 GTGTTCCAGCAGGAGCCAAGAGG - Exonic
1124312155 15:28635553-28635575 GTGTTTCAGAAGAACGAATGTGG + Intergenic
1124960178 15:34387899-34387921 GTGTTCCAGCAGCAGCGAAGAGG - Exonic
1124976807 15:34534120-34534142 GTGTTCCAGCAGCAGCGAAGAGG - Exonic
1126158525 15:45587384-45587406 GTGGCTCGTCAGAAGCAAGGCGG - Exonic
1127294819 15:57599878-57599900 CTGCTTCAGGAGCAGCAAGGGGG - Intronic
1127901999 15:63347851-63347873 GTATTTCAACACAAGGAAGGTGG + Intronic
1128911440 15:71519202-71519224 GTCTTTCAGGAGCAGCAAGAAGG + Intronic
1129284580 15:74514234-74514256 GGACTTCAGCAGAAGGAAGGTGG + Intergenic
1129284640 15:74514661-74514683 GGACTTCAGCAGAAGGAAGGTGG + Intergenic
1129819428 15:78587490-78587512 GTGTTTAAGCAGTTGCAAGGAGG + Intronic
1130296387 15:82649186-82649208 GTGTTTCAGAAGGATTAAGGGGG + Intergenic
1130771785 15:86931409-86931431 GTTTTGCAGCAGGAGAAAGGTGG - Intronic
1130958764 15:88645809-88645831 GTGCATCAGCAACAGCAAGGAGG - Intronic
1132433722 15:101780063-101780085 GTGTTCCAGCAGGAGCAGAGAGG - Intergenic
1133105893 16:3509275-3509297 GTGTTTGAGGAAAAGCAAGGAGG + Intronic
1133253550 16:4501769-4501791 ATGTTTCTGCAGTTGCAAGGTGG + Intronic
1133867980 16:9661559-9661581 GTTTGTCTGCAGAAGCAAAGAGG + Intergenic
1134297712 16:12961604-12961626 GTTTTTCAGCTGAAGAAAGAAGG + Intronic
1135236688 16:20763429-20763451 GTGTTTGAGAAAAAGCAAGGAGG + Intronic
1136704187 16:32172616-32172638 GTGTTTCAGAAGAACGAATGTGG - Intergenic
1136763722 16:32756790-32756812 GTGTTTCAGAAGAACGAATGTGG + Intergenic
1136804377 16:33113596-33113618 GTGTTTCAGAAGAACGAATGTGG - Intergenic
1138150173 16:54649647-54649669 ATGTTTGAGGAGCAGCAAGGTGG + Intergenic
1138470794 16:57234151-57234173 GTGTTTCAGGAGCAGCAAGGAGG - Intronic
1138733999 16:59229813-59229835 GAGTGTGAGCCGAAGCAAGGCGG + Intergenic
1139738112 16:69010553-69010575 CTGTGACAGCAGAGGCAAGGTGG - Intronic
1139777626 16:69326490-69326512 GTGTTTAAGCAGTAGGAATGAGG - Exonic
1140010411 16:71126144-71126166 GTGTTTCTGCAAAAGCATGGTGG + Intronic
1140376989 16:74452545-74452567 CTGTCTCAGCAGAAGAAAGCAGG + Intronic
1140551417 16:75870208-75870230 ATGTTTGAGAAAAAGCAAGGAGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141204381 16:81922215-81922237 ATGTTTCATAAGAAGCAATGTGG - Intronic
1141752505 16:85968270-85968292 CTGTTTCAGCAGAACTAGGGTGG + Intergenic
1141846094 16:86610029-86610051 GTGTTTCCTGGGAAGCAAGGAGG + Intergenic
1142253628 16:89003497-89003519 GAGCTACAGCAGGAGCAAGGTGG + Intergenic
1142305947 16:89285751-89285773 GTGTCTCTGCAGAGGCAGGGTGG - Intronic
1203065872 16_KI270728v1_random:1017111-1017133 GTGTTTCAGAAGAATGAATGTGG + Intergenic
1143589267 17:7871542-7871564 GTATTACAGCAGGAGTAAGGGGG - Intronic
1143712326 17:8743533-8743555 AGGAGTCAGCAGAAGCAAGGAGG + Intronic
1144437818 17:15257347-15257369 AAGTTTCAGCAGAAACGAGGCGG - Intronic
1144455055 17:15412085-15412107 GATTTTCAGCTGAAGCAAGAAGG - Intergenic
1144798063 17:17905947-17905969 GTGTTTGAGGAATAGCAAGGTGG - Intronic
1145944386 17:28762037-28762059 TTTTTTTAGCAGAGGCAAGGGGG + Intronic
1147403618 17:40195350-40195372 GTGCATCAGCAGTAGCAGGGAGG - Exonic
1148682736 17:49484085-49484107 GAGTTAGAGCAGAAGAAAGGAGG - Intergenic
1149313422 17:55418000-55418022 GTGTTTAAGGAGCAGAAAGGAGG - Intronic
1159581237 18:70236565-70236587 GAGGGTGAGCAGAAGCAAGGTGG + Intergenic
1159892122 18:73962965-73962987 GAGTTTCAGCAAAAGCTAAGTGG - Intergenic
1159983952 18:74820038-74820060 GTATTACAGAAGAAGAAAGGAGG + Intronic
1160338185 18:78061444-78061466 GTTTCTTAGCAGAAGCAGGGTGG - Intergenic
1161579817 19:5074713-5074735 GGGTGTCAGCAGAAGCACCGTGG + Intronic
1162463577 19:10827964-10827986 GTGTTTGAACAGAAGCCAGGTGG + Intronic
1165853866 19:38868707-38868729 GTGGTTTAGGAGCAGCAAGGAGG + Intronic
1166875577 19:45895214-45895236 GTGTTTGAGGATCAGCAAGGAGG - Intronic
1167196620 19:48033503-48033525 GTATTACTGCAGAAGCAAGCGGG + Intronic
1167447170 19:49544405-49544427 GTGTGGCAGCATCAGCAAGGAGG + Intronic
1168323978 19:55528834-55528856 GTCTGTCAGCAGACGGAAGGCGG + Intergenic
925895695 2:8470325-8470347 ATGTTTCAGAAGAAGCAGAGAGG - Intergenic
925920129 2:8632583-8632605 CTGTTTGAGCAGAAGGATGGAGG + Intergenic
926871491 2:17422911-17422933 GTGTTCCAAGAAAAGCAAGGAGG - Intergenic
927953569 2:27191215-27191237 GTGTGTCAGCAGAGGCTAGTGGG + Intergenic
928504943 2:31941223-31941245 GTGTTTGAGGAGAAGCAAGGAGG - Intronic
929627100 2:43420656-43420678 GTTTTTGAGCAGAAGGAATGAGG - Intronic
930379056 2:50604297-50604319 CTGTTGAATCAGAAGCAAGGGGG + Intronic
930540470 2:52699707-52699729 GTGTTTCAGTAAAGGCAAAGCGG + Intergenic
931451650 2:62372207-62372229 GTGTGTCAGCAGAATAAAGTAGG - Intergenic
933841857 2:86293307-86293329 GTGTATCAGAACAAGAAAGGTGG + Intronic
933947751 2:87301494-87301516 GTGTTTCAGGGGCAGAAAGGAGG + Intergenic
935287851 2:101581043-101581065 GTGTTTCAACAGAATGAGGGTGG + Intergenic
936332451 2:111560079-111560101 GTGTTTCAGGGGCAGAAAGGAGG - Intergenic
936902859 2:117503803-117503825 GTGTCTGAGCAGCAGCAAAGTGG + Intergenic
937862878 2:126724852-126724874 GTGTTTAACCAGAAGGAAGAGGG - Intergenic
937995149 2:127688669-127688691 ATGTCTCATCAGAAGCAATGGGG - Intergenic
938451868 2:131428210-131428232 GTGTTTTAGCAGAAGGAAGTTGG + Intergenic
939529279 2:143337004-143337026 GTGTTTCAGGAGGTGGAAGGGGG + Intronic
939539307 2:143474061-143474083 GTGTTTCAGCCTAAGCTAGGAGG - Intronic
940024827 2:149194807-149194829 GTGTTTCTGGAGAAGCAAAGAGG + Intronic
940400633 2:153244499-153244521 GAGTGTGAGCAGAAGCAGGGTGG + Intergenic
940823854 2:158387798-158387820 GTGTCAGAGCACAAGCAAGGTGG - Intronic
942571830 2:177322902-177322924 CTGCTTCAGCAGGAGGAAGGAGG + Intronic
944169695 2:196760958-196760980 GGTTTTCAGCAGGAGAAAGGGGG - Intronic
944509102 2:200446666-200446688 GTGCTCCAGCAGAACCGAGGTGG - Intronic
945175149 2:207036598-207036620 ATGTTTCTGCAGTAGCAAGTAGG + Intergenic
945201805 2:207289312-207289334 GTCATTCAGCAGGAGCAAGAGGG + Intergenic
945224845 2:207523107-207523129 GTGTTTGAGAAACAGCAAGGAGG + Intergenic
946385710 2:219383247-219383269 GAGTTCCAGCAGAAGCAGGTTGG - Intronic
946447560 2:219752475-219752497 GTGTTTGTGCAGTAGCAAGTGGG - Intergenic
947194414 2:227546456-227546478 GAGTGTGAGCCGAAGCAAGGCGG - Intronic
947924943 2:233913126-233913148 CTGGTTCAGCAGATACAAGGTGG - Intergenic
948149581 2:235734370-235734392 TTCTTTCAGCAGATGCAAGCTGG - Intronic
948619736 2:239226937-239226959 CTGTTTCAGCAGAATCTTGGAGG - Intronic
948714231 2:239849300-239849322 GTGTTCTTGCAGAAGTAAGGTGG - Intergenic
1168797712 20:622563-622585 GTGTTCAAGGAGTAGCAAGGAGG - Intergenic
1168800277 20:640246-640268 GTGTTCAAGAAGCAGCAAGGAGG - Intergenic
1168980425 20:1998871-1998893 GTGTTTGAGGAGCAGCAGGGAGG - Intergenic
1169865431 20:10194976-10194998 CTATTTCAGGAGAAGCAAGAGGG - Intergenic
1170094449 20:12630417-12630439 GTGCTTCTGCTGTAGCAAGGAGG - Intergenic
1170953021 20:20953759-20953781 GTCTCCCAGCAGAAGCAATGAGG + Intergenic
1171956542 20:31468211-31468233 GGGTTTGAACAGCAGCAAGGAGG - Intronic
1172099554 20:32476965-32476987 GGGTTTGAGGAGAGGCAAGGAGG + Intronic
1173621163 20:44437047-44437069 GTTTTTCAGCTGCAGCCAGGTGG + Intergenic
1173747081 20:45445947-45445969 GTGTTTGAGCAGCAGCGATGAGG + Intergenic
1173922316 20:46755557-46755579 GTGTTTAAGGAACAGCAAGGAGG - Intergenic
1174056268 20:47800483-47800505 GTGTTCCAGCAGAGAGAAGGAGG + Intergenic
1174568796 20:51486328-51486350 TTGTTCCAGGAGCAGCAAGGAGG - Intronic
1175045396 20:56100172-56100194 TTGTTCAAGAAGAAGCAAGGAGG + Intergenic
1175314583 20:58038565-58038587 GTGTTTGAGGATCAGCAAGGGGG - Intergenic
1175418788 20:58818288-58818310 GGTCTTCAGCAGAAGCAGGGAGG - Intergenic
1177042787 21:16133485-16133507 GTGGGTGAGCAGAAGCAGGGTGG - Intergenic
1177421883 21:20870094-20870116 CTGTTCAAACAGAAGCAAGGAGG - Intergenic
1177759419 21:25386425-25386447 GTGTTGCAGGAGAATCAGGGAGG - Intergenic
1180671195 22:17554873-17554895 GTGTTTGTGCAGAAGCAGGGAGG + Intronic
1181845044 22:25700040-25700062 GTGTTTCAGCAGAAGCAAGGGGG - Intronic
1183255768 22:36760925-36760947 GTGTTTAGGCAGAAGAGAGGAGG + Intronic
1185388951 22:50548716-50548738 GTGTTTCTGCAGAGGCCCGGGGG + Exonic
949249370 3:1964289-1964311 ATGTGCCTGCAGAAGCAAGGTGG - Intergenic
950058585 3:10049922-10049944 GAGTTTGAGCAGAAGCAAACTGG + Intronic
950300345 3:11871845-11871867 GAGTTTGAGCAGAAGCAAACTGG + Intergenic
950972313 3:17201590-17201612 GTGTTACAGCAGAGGCAGGATGG + Intronic
951688196 3:25367871-25367893 GAATTTCAGAAGAATCAAGGGGG + Intronic
953263150 3:41359463-41359485 GTGTGTCGGGAGAAGCAAGAGGG + Intronic
954871713 3:53772353-53772375 ATACTTCAGCAGAAGCAAGGTGG + Intronic
956225020 3:66947673-66947695 GTGTTTCAGGAGCTGCAAGGAGG - Intergenic
956239133 3:67109394-67109416 GTGTTTCTGCAGAAGCAACAAGG + Intergenic
958040044 3:88216381-88216403 ATGTTTCAGCAGAGTCAAGATGG - Intergenic
960051434 3:113242441-113242463 GTGTTTTAGCAGAAGCTCTGTGG + Intronic
962642438 3:137401115-137401137 GAGGGTGAGCAGAAGCAAGGTGG - Intergenic
964276151 3:155010950-155010972 GTGTGTAAGCAGATGGAAGGAGG - Intergenic
964701875 3:159576741-159576763 GTGTTTCAACAGATGCATGCAGG - Intronic
965065696 3:163845477-163845499 GTGTGTGAGAAAAAGCAAGGTGG - Intergenic
965727481 3:171734071-171734093 GTGATTCAGCAAAAGCATGCTGG - Intronic
965895444 3:173570289-173570311 ATGTTTCAGAAAGAGCAAGGTGG + Intronic
966832390 3:184020880-184020902 GTGTTTCATCTGAAGGAAGTAGG + Intergenic
967537933 3:190628379-190628401 ACGTTTCAACAGCAGCAAGGTGG - Intronic
968266236 3:197365547-197365569 GTATTTCAGTAGAAGTAAAGGGG - Intergenic
968495551 4:913458-913480 GAGATTCAGCAGAAGCAAAAGGG + Intronic
968764277 4:2459917-2459939 GTGTTGAAGCAGAGGGAAGGTGG + Intronic
969305913 4:6326247-6326269 GTGTGTAAGAAGAAGCAGGGAGG + Intronic
970077976 4:12246520-12246542 GTGTTACAGCAGAAGAAATTAGG - Intergenic
971270680 4:25141857-25141879 GTATTTGAGAAGCAGCAAGGAGG - Intronic
972401068 4:38704388-38704410 GTTTTGCAGCAGGAGAAAGGAGG + Intergenic
972503646 4:39700322-39700344 GTGTTTCAGAAGAAGAAAACAGG + Intronic
972628174 4:40820811-40820833 GTGTTCCAGCAGCAGCAGGTTGG - Intronic
973261605 4:48170642-48170664 GTTCTTCAGGAGAAGCAATGAGG + Intronic
974578689 4:63765492-63765514 GTGTTTCAGAAGAATGTAGGTGG + Intergenic
975359416 4:73450539-73450561 GTCTGTGAGAAGAAGCAAGGCGG + Intronic
976142251 4:82004335-82004357 GAGTATCAGAAGAAGCAAGAAGG - Intronic
976152655 4:82107652-82107674 GTGTTTAACCAGAAGTAGGGCGG - Intergenic
976217536 4:82729274-82729296 GGGTTTCCCCAGAAGGAAGGAGG + Intronic
977298814 4:95243148-95243170 AGGTTTCAGCAGAATCAAGCAGG - Intronic
978086030 4:104656603-104656625 GTGTTTCAGTAGAAGAAGTGTGG + Intergenic
980974751 4:139599748-139599770 GTGTTTAAGGAAAAGCAAAGGGG - Intronic
981111392 4:140938472-140938494 GAGTTTAGGGAGAAGCAAGGAGG + Intronic
984344403 4:178504161-178504183 GTGTTTCAGTAGCAACAAGCAGG + Intergenic
984797570 4:183677800-183677822 GTTTTTCAGTGGGAGCAAGGAGG + Intronic
986057396 5:4152253-4152275 GTGTCTCACCTGAATCAAGGTGG - Intergenic
986364616 5:7018228-7018250 GTGTTTCAAAAGAGACAAGGGGG - Intergenic
987057251 5:14205654-14205676 GTGTTTCAGAAGATGCCAGTTGG + Intronic
990322059 5:54639861-54639883 ATGTATCAGCAAAAGCCAGGTGG + Intergenic
992141609 5:73802766-73802788 GTGTTTCAACACAAGAAAAGGGG - Intronic
993541543 5:89159022-89159044 GAGGTCGAGCAGAAGCAAGGTGG + Intergenic
993658620 5:90602830-90602852 GTGGCTCAGCAGAAGCTGGGTGG + Intronic
995058453 5:107788283-107788305 GTTTTTCATCAAAAGAAAGGTGG + Intergenic
995387292 5:111602027-111602049 GTGTTCAAGGAGCAGCAAGGAGG - Intergenic
997021339 5:130006173-130006195 TTGTTTCAACAAAAACAAGGAGG + Intronic
997649116 5:135502439-135502461 ATTTTTCTGCAGAAGCAAGGGGG + Intergenic
997824486 5:137094018-137094040 GTGTTTAAGGAGTAGCAATGGGG + Intronic
999139476 5:149348672-149348694 ATGTTTCAGCAGATTAAAGGAGG + Intronic
1001422770 5:171599948-171599970 CAGTTTCTGCAGCAGCAAGGGGG + Intergenic
1001600555 5:172925604-172925626 GTGTTTGAATAGAAGGAAGGAGG - Intronic
1001694960 5:173663192-173663214 CTTTTTCAGGAGAAGGAAGGGGG + Intergenic
1001920428 5:175595568-175595590 ATGGTTCAGCAGAGGCAATGAGG - Intergenic
1001960127 5:175874998-175875020 GTGATTCAGCAGAGGGATGGAGG + Intronic
1005049663 6:21673244-21673266 ATGTTTCAGAGAAAGCAAGGAGG + Intergenic
1005211557 6:23470762-23470784 GTGCTGGAGCAAAAGCAAGGAGG - Intergenic
1008020213 6:46567905-46567927 GAGTTTCAGCAGTTGCCAGGTGG + Intronic
1009669324 6:66726464-66726486 GTGTTTCAGCTGAGCCTAGGAGG - Intergenic
1013410237 6:109877208-109877230 GTGTTTCAGCCCCAGCAGGGAGG - Intergenic
1014441623 6:121480229-121480251 GTGTTTCCGCAGGAGGAAGTCGG - Intergenic
1014773583 6:125484190-125484212 GTGGGTCAGCAGAAGTAAGGAGG - Intergenic
1015788852 6:136946116-136946138 GTGCTTCAGAAGAATTAAGGAGG - Intergenic
1015985347 6:138879053-138879075 GTGTTTCAGCAGCAGGCAGGAGG - Intronic
1016824197 6:148373385-148373407 GTGTTGGAGGAGTAGCAAGGTGG + Intronic
1018647358 6:165960946-165960968 GTCTTTGGGCAGAAGCAAGAGGG + Intronic
1018968571 6:168508662-168508684 GAGGTTCAGCAGAAGCTGGGGGG - Intronic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1022142993 7:27509361-27509383 GTGTAGCAGCAGAAGCCATGAGG + Intergenic
1022615551 7:31926634-31926656 GTGGGCCAGCAGAAGCAGGGTGG + Intronic
1023025038 7:36042408-36042430 GTGGTTCAGCTGCAGGAAGGGGG + Intergenic
1024342417 7:48280863-48280885 GTTTGACATCAGAAGCAAGGAGG - Intronic
1025101099 7:56135907-56135929 GTTTTGCAGCAGGAGAAAGGAGG + Intergenic
1026317768 7:69241951-69241973 GTTTTGCAGCAGGAGAAAGGAGG + Intergenic
1026318250 7:69246158-69246180 GTTTTGCAGCAGGAGAAAGGAGG - Intergenic
1027160158 7:75796573-75796595 GTGTCTCATCAAAAGAAAGGTGG - Intergenic
1028384791 7:90242806-90242828 GTGGTGCAGCAGAAGCATGCTGG + Intergenic
1030439349 7:109567236-109567258 GTGTCTGAGGAGTAGCAAGGAGG - Intergenic
1030655426 7:112162339-112162361 GTGTTTCCTCTGAGGCAAGGGGG - Intronic
1031031752 7:116743080-116743102 GAGGTTGAGCTGAAGCAAGGTGG + Intronic
1032418931 7:131762192-131762214 GTGTTTGAGAAACAGCAAGGAGG + Intergenic
1032774098 7:135091744-135091766 CAGTATGAGCAGAAGCAAGGAGG - Intronic
1033845578 7:145427910-145427932 GTGTATCAGCAGAAACCAAGTGG + Intergenic
1034041684 7:147884179-147884201 GTGTTTAAGGAGCAGCAAGATGG + Intronic
1034293596 7:149951137-149951159 GTGTTTCATGAGGAGCAGGGTGG + Intergenic
1034812470 7:154145716-154145738 GTGTTTCATGAGGAGCAGGGTGG - Intronic
1035179378 7:157078158-157078180 TTGTTCCACCAGAAGAAAGGAGG - Intergenic
1035247203 7:157570870-157570892 GGGTTTAAGAACAAGCAAGGTGG + Intronic
1036038111 8:5042421-5042443 GTGTTCTAACAGAAGAAAGGAGG - Intergenic
1038223884 8:25636647-25636669 GGGTTTGAGGAGCAGCAAGGAGG - Intergenic
1038660101 8:29489913-29489935 ATGTTTGAGCAATAGCAAGGGGG - Intergenic
1039594911 8:38783328-38783350 GTCTTTCAGCAGACCCCAGGTGG + Intronic
1039647464 8:39303474-39303496 GAGTTTCAACTGAAGCCAGGAGG + Intergenic
1040772355 8:50992447-50992469 GTGTGTGAGCCGAAGCAGGGTGG - Intergenic
1044127328 8:88474432-88474454 CTGTACCAGCAGAAGCAAGGTGG + Intergenic
1044365594 8:91341801-91341823 GGGTTCAAGAAGAAGCAAGGTGG - Intronic
1044998298 8:97858056-97858078 GTGTTGCAGCAGCAGACAGGAGG - Intergenic
1045528781 8:102964397-102964419 GTGTTTAAGCAGGAACTAGGAGG + Intronic
1046731228 8:117728398-117728420 GCATGTCAGCAGAAGCATGGAGG - Intergenic
1048139309 8:131777596-131777618 ATGTGTCAGCACTAGCAAGGGGG + Intergenic
1050451685 9:5788247-5788269 GCCTTGCAGCAGAAGCAGGGTGG - Intronic
1050617678 9:7419600-7419622 GTGTTTCATAAGAAAAAAGGTGG - Intergenic
1052098020 9:24408630-24408652 GAGTGTCAGCCGAAGCAGGGTGG + Intergenic
1055769008 9:79696061-79696083 GCTTTTCAGCAGCAGCAATGTGG + Intronic
1056287939 9:85110246-85110268 GTGTTCCAGGAGCAGCCAGGAGG - Intergenic
1057217640 9:93238295-93238317 GTGTATCTGCAAAAACAAGGAGG + Exonic
1059468945 9:114488941-114488963 GTTTTATAGCAGAAGCAATGGGG - Intronic
1059938756 9:119337397-119337419 TTGTTTCAGGATAAGCCAGGAGG + Intronic
1060612851 9:124984199-124984221 ATGTTTCAGGAACAGCAAGGGGG + Intronic
1186774941 X:12855044-12855066 GAGGGTGAGCAGAAGCAAGGTGG - Intergenic
1187924741 X:24239324-24239346 GTGTTTAAGTAGAAGGAAGAAGG + Intergenic
1189047164 X:37605628-37605650 GTGTTTCAGGAACAGTAAGGAGG - Intronic
1189305862 X:39986232-39986254 GTGTTTTACCTGAAGGAAGGAGG - Intergenic
1191645004 X:63470774-63470796 GTGTTCCAGCCCCAGCAAGGAGG + Intergenic
1192523886 X:71824867-71824889 GGGTTCCAGCTGAAGGAAGGAGG - Intergenic
1194980557 X:100435854-100435876 GTCTTTCAACAGAAGCAATTTGG - Intergenic
1195005195 X:100678728-100678750 CTGCTTCAGCAGATTCAAGGAGG - Intronic
1195615069 X:106905674-106905696 GAGAATCAGCAGAAGGAAGGAGG + Intronic
1196047318 X:111269951-111269973 GTGGGTCAGCAGAAGCTAGAAGG + Intronic
1196603049 X:117623388-117623410 GAGGGTCAGCAGAAGCAGGGTGG - Intergenic
1197734166 X:129838359-129838381 GTGTTTCTGAAGAAGCCGGGGGG - Intronic
1197781237 X:130162584-130162606 TTGTCTCAGCAGAAACAACGGGG + Intronic
1198229836 X:134678329-134678351 ATGTTTGAGAAAAAGCAAGGAGG - Intronic
1198295482 X:135282783-135282805 GAGGGTGAGCAGAAGCAAGGTGG - Intronic
1199246953 X:145616325-145616347 GTATCTGAGCAAAAGCAAGGAGG + Intergenic
1200204823 X:154308340-154308362 GTGTTCAAGGAGCAGCAAGGAGG + Intronic
1201735205 Y:17252627-17252649 TTGTTTCAGCAGCACCATGGAGG + Intergenic
1202383642 Y:24301628-24301650 GTTTTTGTGCAGTAGCAAGGAGG + Intergenic
1202487141 Y:25368492-25368514 GTTTTTGTGCAGTAGCAAGGAGG - Intergenic