ID: 1181846106

View in Genome Browser
Species Human (GRCh38)
Location 22:25710068-25710090
Sequence GATGCTGGGGAGACACAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 500
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 455}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181846106 Original CRISPR GATGCTGGGGAGACACAGCC AGG (reversed) Intronic
900266203 1:1758475-1758497 GATGCTGTGGACACACTGGCCGG - Intronic
900538765 1:3192351-3192373 GATCCTGGAGAGACACTTCCAGG + Intronic
900551624 1:3259292-3259314 GGGGCTGGGGAGACATCGCCTGG + Intronic
900678998 1:3905850-3905872 GAACCTGGGAAGACACGGCCAGG - Intergenic
900944066 1:5819806-5819828 CATGTGGGGCAGACACAGCCTGG - Intergenic
901183717 1:7358854-7358876 GGGGCTGAGGAGACAAAGCCGGG - Intronic
901469986 1:9449521-9449543 AAGGCAGGGGAGACCCAGCCAGG + Intergenic
901819760 1:11820653-11820675 GATGCTGGGGAGGCTGAGGCAGG + Intronic
901842813 1:11964551-11964573 GGTGGTGGGGAGTCATAGCCTGG - Intronic
902187272 1:14734838-14734860 GATGCTTGGGACACGCAGTCTGG - Intronic
902329534 1:15724571-15724593 GGTGCTGGGGAGAAGCAGCCTGG + Intronic
902343483 1:15799596-15799618 CGTGCTGGGGAGGCACAGCCAGG + Intergenic
902536829 1:17123959-17123981 GATGATGGGGTGCCATAGCCTGG + Intergenic
902670081 1:17967072-17967094 GATGCTGGAGAGCCAGAGCTGGG - Intergenic
903135369 1:21306004-21306026 GATGCTGGGAAGACAAACCCAGG - Intronic
903279969 1:22244828-22244850 GGTGCTGGGGGGAGGCAGCCGGG + Intergenic
903376765 1:22871310-22871332 AAGGCTGGGGATACCCAGCCAGG - Intronic
904013097 1:27401324-27401346 GAGGCTGGGGAGAGACAGGTTGG - Intergenic
904397574 1:30232471-30232493 GGTGCTGGGGAGACACTGCAAGG - Intergenic
904496376 1:30889052-30889074 GAGGCCTGGGAGACACAGCAGGG + Intronic
905274312 1:36807210-36807232 TATGCTGGGGAGACGCAGAGAGG + Intronic
905347606 1:37321817-37321839 GATGGAGAGGAGACACAGGCAGG + Intergenic
905395483 1:37663837-37663859 GCTGCTGGGGTCACACTGCCTGG - Intergenic
905767370 1:40612598-40612620 CGTGCTGGGGACGCACAGCCAGG - Intergenic
906613712 1:47220949-47220971 GAGGCTGTGAAGAAACAGCCAGG + Intronic
907214001 1:52846957-52846979 GCTGCTGGGGAGACTGAGGCAGG - Intronic
908753838 1:67449341-67449363 GATTCTGGAGAAACTCAGCCAGG - Intergenic
910410194 1:86934814-86934836 GCTACTTGGGAGACAGAGCCAGG + Intronic
910506696 1:87957564-87957586 GTTGCTGGGGAGAGGCAGCGTGG - Intergenic
912655643 1:111484278-111484300 GATGCTGGGGATACAAAGATGGG - Intronic
914048260 1:144108168-144108190 GATACTCGGGAGACAGAGGCAGG + Intergenic
914130924 1:144857280-144857302 GATACTCGGGAGACAGAGGCAGG - Intergenic
915109393 1:153553439-153553461 GATATTGGGGCGACAGAGCCAGG - Intergenic
915281488 1:154825475-154825497 GCTGCTGGGGAGACTGAGGCAGG - Intronic
915397661 1:155597926-155597948 GATACTGGGGAGACTGAGGCAGG - Intergenic
915934456 1:160082598-160082620 GGTCCTGGGGAGAAACTGCCTGG - Intronic
915962523 1:160279079-160279101 GAGAATGGGGAGAAACAGCCTGG - Exonic
916267398 1:162904466-162904488 AATGCACGGCAGACACAGCCTGG + Intergenic
918761127 1:188410238-188410260 GATGCTGGGGAGACACTATCTGG + Intergenic
919764696 1:201119241-201119263 GCTGCTGGGAAGATACAGACTGG + Intronic
920035209 1:203060919-203060941 GATCCTGGGGACCCACACCCAGG + Intronic
922141827 1:222894771-222894793 GTAGCAGGGGAGGCACAGCCGGG - Intronic
922229316 1:223671966-223671988 GAGGAAGGGAAGACACAGCCAGG + Intergenic
922702324 1:227769142-227769164 GCCCCAGGGGAGACACAGCCTGG - Intronic
922822346 1:228493284-228493306 GATGGTGGGCAGACCCAGCGGGG - Intronic
924453452 1:244199296-244199318 CATGCTGGGGGGACAAAGCGGGG - Intergenic
1064199256 10:13270886-13270908 GATGATGTGAAGACACAGACAGG + Intergenic
1064850743 10:19706451-19706473 GAGGCTGGGGAGACTGAGGCAGG - Intronic
1065183350 10:23148690-23148712 GCTACTGGGGAGACAGAGGCAGG - Intergenic
1065948265 10:30626680-30626702 GTAGTTGGGGAGACACAGCAGGG + Intronic
1067142949 10:43671437-43671459 GATGCTGGAGAGACAGAGAAGGG - Intergenic
1069552744 10:69375877-69375899 GCTGCAGGGGAGAGGCAGCCAGG - Intronic
1069806417 10:71127909-71127931 GGTGCTAGGGAGCCACAGCAGGG - Intergenic
1070770576 10:79080035-79080057 GTTGGTGGGGAGAGGCAGCCTGG + Intronic
1070939776 10:80334281-80334303 CATGCTGGGGACACAGTGCCTGG + Intergenic
1071843032 10:89492810-89492832 GATGTTGGGTAGACAAAGGCAGG - Intronic
1072241521 10:93499631-93499653 GATGCTGGGGAGGCTGAGGCAGG - Intronic
1073162945 10:101416615-101416637 GATGCTGTGGAGCCAAAGACTGG - Intronic
1073190889 10:101650003-101650025 GACTCTGGGGAGCCTCAGCCTGG - Intronic
1073773593 10:106762155-106762177 GATGCTGTGGTGAAACAGCTGGG + Intronic
1074117889 10:110471284-110471306 GCTACTTGGGAGACACAGGCAGG - Intergenic
1074206418 10:111286895-111286917 GCTGCTGGGGAGACTGAGGCAGG - Intergenic
1074758010 10:116641594-116641616 GATGCTGAGGCCACACAGCATGG - Intronic
1075202629 10:120418543-120418565 GATGATGTGGAGAAACAGGCAGG - Intergenic
1075670835 10:124263116-124263138 GATTCTGGAGAGACACAGGCAGG - Intergenic
1075925022 10:126244641-126244663 GGTGCTGGGGAGACAGAGAGAGG + Intronic
1076623668 10:131808802-131808824 GAGACTGGAGAGACACAGCTGGG - Intergenic
1076641928 10:131923253-131923275 CACGCTGGGGAGAAGCAGCCGGG - Intronic
1077172652 11:1174837-1174859 GATTCTCAGGACACACAGCCCGG - Intronic
1077556943 11:3230469-3230491 GATGCTGGGGAGAGGTGGCCCGG + Intronic
1077678536 11:4219045-4219067 GGTGCTGGGGAGTCAGAGGCTGG - Intergenic
1077682094 11:4251287-4251309 GGTGCTGGGGAGTCAGAGGCTGG + Intergenic
1077687939 11:4315448-4315470 GGTGCTGGGGAGTCAGAGGCTGG - Intergenic
1078444793 11:11395992-11396014 GAGGGAGGGGGGACACAGCCAGG + Intronic
1078650232 11:13184513-13184535 GGTGCTGGGAACACACTGCCTGG - Intergenic
1078760586 11:14248221-14248243 GATGAGGGGGAAAAACAGCCCGG + Intronic
1079357051 11:19738408-19738430 GATGTGGGAGAGACACATCCAGG + Intronic
1079601379 11:22316162-22316184 GAGGCAGGGGAGACAGAGGCAGG - Intergenic
1081643019 11:44770476-44770498 GATGCTGGGGTGCTACACCCAGG + Intronic
1081718266 11:45267194-45267216 GATTCTGGGGCGAGTCAGCCTGG - Intronic
1081741637 11:45445033-45445055 GATGCTGGGCTTTCACAGCCTGG - Intergenic
1082717736 11:56635569-56635591 GCTGCTTGGGAGACAGAGGCAGG - Intergenic
1084117806 11:67052173-67052195 GTGTCTGGGGAGACACAGCTGGG + Intergenic
1085052924 11:73388980-73389002 GCTGCTGGGCAGGCAGAGCCCGG - Intronic
1085053486 11:73391395-73391417 CATGGTGGGCAGAAACAGCCAGG - Intronic
1085661421 11:78370865-78370887 GTGGCTGGGTAAACACAGCCTGG - Intronic
1086326133 11:85702006-85702028 GAGGCTGGGGAGACAAAACTTGG + Intronic
1089336960 11:117731857-117731879 GAACCTGGGCAGACACAGCTGGG + Intronic
1091149317 11:133312408-133312430 GATGCTGAGTACACACAGGCTGG - Intronic
1091205224 11:133816363-133816385 GGTGGTGAGGAGACACATCCAGG - Intergenic
1091526166 12:1303525-1303547 GCTGCTGGGGAGACTGAGGCAGG + Intronic
1091676160 12:2491680-2491702 GCTGCTGGGAAGACACAATCGGG + Intronic
1091696939 12:2633980-2634002 GGTGCAGGGGACACACCGCCCGG + Intronic
1091820606 12:3472824-3472846 GAGGCTGTGGAGCCACGGCCAGG + Intronic
1092562587 12:9632424-9632446 GATGATGGGGACACACAGATGGG + Intergenic
1094473846 12:30826369-30826391 GCTGCTGGGGAGCCTCTGCCAGG - Intergenic
1094586164 12:31779367-31779389 GATGGTGGGGAGACACTGTCTGG - Intergenic
1094657226 12:32432169-32432191 GCTGCTGGGGAGACTGAGGCAGG - Intronic
1095271169 12:40221230-40221252 GCTACTGGGGAGACCGAGCCAGG - Intronic
1096107199 12:49003287-49003309 GATTCTGGGGAGACAGAGGAAGG + Exonic
1096436532 12:51595388-51595410 GAAGTTATGGAGACACAGCCAGG + Intronic
1096631728 12:52931361-52931383 GAATCTGGGGAGACACTGGCCGG - Intronic
1096673618 12:53214770-53214792 GGGGCTGGGGAGAACCAGCCTGG - Intronic
1096998557 12:55856247-55856269 GATCCTGGGGAGGCAGAGCAGGG + Intergenic
1097990023 12:65824648-65824670 GAGGATGGGGAGACTCCGCCGGG - Exonic
1098899597 12:76099420-76099442 GCTGCTGGGGAGACTGAGGCAGG - Intergenic
1100616729 12:96236707-96236729 GAGGCAGAGGAGGCACAGCCTGG - Intronic
1101965084 12:109276907-109276929 GGTGCTGGGCAGAGAAAGCCAGG + Intergenic
1102142256 12:110624687-110624709 GCTGCTGGGGAGACTGAGGCAGG - Intronic
1102406801 12:112680562-112680584 GATGCTGGGGCCAGACTGCCTGG - Intronic
1102500484 12:113348932-113348954 GACACTGGGGAGTCACAGCTGGG - Intronic
1102868469 12:116393474-116393496 GAGACTGGGGAAACACGGCCAGG + Intergenic
1103498634 12:121382727-121382749 GCTGCTGGGGAGACTGAGGCAGG + Intronic
1103526888 12:121575164-121575186 GATGCTGGAGAGAGGCTGCCTGG + Intronic
1103631932 12:122268505-122268527 GCTGCTGGGGAGACTGAGGCAGG - Intergenic
1103853567 12:123948970-123948992 TAGGCTGAGGAGACCCAGCCGGG + Intronic
1103914088 12:124367582-124367604 GAGGGTGGGGAGAGCCAGCCAGG - Intronic
1103979550 12:124727565-124727587 GCTGCTGGGAGGACACAGGCAGG - Intergenic
1104786686 12:131454901-131454923 CATGCAGGGCATACACAGCCCGG + Intergenic
1104834807 12:131782064-131782086 GATGCTTGGGAGGCAGAGGCAGG + Intronic
1106361941 13:29039053-29039075 GATGCTGGATAGACCCAGCCAGG + Intronic
1106547442 13:30742902-30742924 GATGCCAAGGAGACACAGTCTGG - Intronic
1108296321 13:49021572-49021594 GAAGCTGGGGAGACAGAGTAGGG + Intronic
1108322840 13:49304027-49304049 GGGGCTGGGGTGACACAGCTAGG + Intergenic
1112580177 13:100671704-100671726 GAAGCAGGGGAGTCACAGCAAGG - Intronic
1113369723 13:109712575-109712597 GCTGGAGGGGAGACACTGCCTGG + Intergenic
1113381765 13:109811463-109811485 GAGGAGGGGGACACACAGCCAGG - Intergenic
1113484877 13:110646441-110646463 GAGGCTGGGGAGGCCCAGCCCGG + Intronic
1113512019 13:110863954-110863976 TATGCTTGGGAGAAACAGTCTGG - Intergenic
1115235607 14:31206972-31206994 GGTGCTGGGGAACCACAGCGCGG - Intronic
1116167147 14:41349306-41349328 GCAGCGGGGGAGGCACAGCCAGG + Intergenic
1117166508 14:53039599-53039621 GATGCTGGGCAGACAAAAACAGG + Intronic
1117283679 14:54265350-54265372 GAGCCTGTGGAGACACTGCCGGG - Intergenic
1117285616 14:54283121-54283143 GCAGCTGGGGAGGCACAGCTGGG - Intergenic
1119027439 14:71165307-71165329 GATAGTGGGGAGAGACAGGCAGG + Intergenic
1119859375 14:77925321-77925343 GAGGCTTGGGAGGCAGAGCCTGG - Intronic
1120313391 14:82860312-82860334 GATGCTGTCGAAACACAGCCAGG + Intergenic
1120848863 14:89150533-89150555 GGTGGTGGGGAGAAAAAGCCGGG + Intronic
1121764380 14:96473280-96473302 GCTGCTGGGGAGACTGAGGCAGG - Intronic
1122080401 14:99263090-99263112 GACCCTGGGAAGGCACAGCCAGG + Intronic
1122087698 14:99318868-99318890 GACCCTGGGGAGAGGCAGCCAGG - Intergenic
1122621052 14:103057736-103057758 GATGCTGGGAAGGCAGGGCCGGG + Intergenic
1122848012 14:104511249-104511271 GATGCAGGAGAGACACACACAGG - Intronic
1123103415 14:105821511-105821533 GCTGCTCGGGAGACTCAGGCAGG - Intergenic
1123831596 15:24144999-24145021 GCTGCTGGGGAGGCTGAGCCAGG - Intergenic
1124258468 15:28165116-28165138 GGGGTTGGAGAGACACAGCCAGG + Intronic
1124606054 15:31171154-31171176 TCTGCTGGGCAGACACAGGCAGG - Intergenic
1124633092 15:31348310-31348332 GAGGCTGGGCTGACAGAGCCAGG - Intronic
1124653436 15:31489023-31489045 GCTGCAGGGCAGACACACCCAGG + Intronic
1125259634 15:37808493-37808515 GTTTCTGGGGACCCACAGCCTGG + Intergenic
1126048007 15:44662554-44662576 GCTGCTGGGGAGGCTGAGCCCGG + Intronic
1126925160 15:53577084-53577106 GATGCTGTTAGGACACAGCCAGG + Intronic
1127961528 15:63894311-63894333 GAGGCTGTGGTGACTCAGCCAGG - Intergenic
1128228136 15:66017073-66017095 GCTGCTGGAGAAGCACAGCCCGG + Intronic
1128361049 15:66962022-66962044 GCTCCTGGAGAGACAAAGCCGGG - Intergenic
1128509691 15:68305807-68305829 GGCGCTGGGGAGGCAGAGCCAGG - Intronic
1130294713 15:82637492-82637514 GATGCTAGGGAAAGACAGGCTGG - Intronic
1131095167 15:89649938-89649960 GAGGCTGGGGAGACACCGCAGGG + Exonic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1133031795 16:3014533-3014555 GGGGCTGGGCAGGCACAGCCAGG + Intergenic
1133054626 16:3139407-3139429 GATGCTGAAGGGACACAGCTGGG + Intronic
1133129166 16:3665638-3665660 GGGGCTGGGGAGCCACAGACAGG - Intronic
1133131223 16:3677113-3677135 TGGGCTGGGGAGACAAAGCCAGG + Intronic
1134536306 16:15029284-15029306 GATGCTCGGCAGACTCTGCCTGG - Intronic
1135174990 16:20220042-20220064 GATGCTGGGGATTCTCAGCTAGG - Intergenic
1136041106 16:27579618-27579640 GTGCCTGGGGACACACAGCCAGG - Intronic
1136164992 16:28447879-28447901 GCTGCTGGGGAGACTGAGGCAGG - Intergenic
1136197975 16:28667101-28667123 GCTGCTGGGGAGACTGAGGCAGG + Intergenic
1136214320 16:28781278-28781300 GCTGCTGGGGAGACTGAGGCAGG + Intergenic
1136259042 16:29061123-29061145 GCTGCTGGGGAGACTGAGGCAGG + Intergenic
1137005578 16:35272140-35272162 AATCCTGGGGAGACAAAGCTGGG + Intergenic
1137573820 16:49585079-49585101 GTGGCTGGGGAGAAACAGTCAGG - Intronic
1139859762 16:70011501-70011523 GATGCTCGGCAGACTCTGCCTGG + Intergenic
1140231789 16:73123422-73123444 GATCCTGGAGACACATAGCCTGG + Intergenic
1140497451 16:75401486-75401508 GCTGCTTGGGAGACTGAGCCAGG + Intronic
1140536314 16:75713199-75713221 GCTGCTGAGGAGATACAGCTGGG + Intronic
1140640566 16:76967164-76967186 GATGCTAGGGAGAGACTGCAAGG + Intergenic
1141144239 16:81517841-81517863 GAGGCTTGGGAGATGCAGCCAGG + Intronic
1141424504 16:83936239-83936261 GGAGCTGGGGAGACAGAGCTGGG - Intronic
1142139212 16:88465210-88465232 CGGGCTGGGGAGACACAGGCAGG + Intronic
1142765294 17:2060980-2061002 GAGACTGGGGACACACACCCTGG + Exonic
1142912319 17:3104754-3104776 GATGCTTGGGAGACTGAGGCAGG + Intergenic
1143119828 17:4599737-4599759 CGTGCTGGGGAAGCACAGCCCGG - Intronic
1143506282 17:7367364-7367386 GATGTAGGGGAAGCACAGCCCGG - Intergenic
1144079228 17:11747503-11747525 GATGCAGGTGAGTCACAGGCTGG + Intronic
1144356461 17:14451421-14451443 GATGCTGGGGATAGACAGAGTGG + Intergenic
1144388775 17:14774239-14774261 GAAGCTGGGGAGACAGACACAGG + Intergenic
1146570359 17:33947230-33947252 GAGGGAGGGGAGACACAGTCTGG - Intronic
1146790608 17:35748539-35748561 GTTTCTGGTGAGGCACAGCCAGG + Intronic
1147675486 17:42202362-42202384 GAGCCTGGGGACACACAGCTGGG + Exonic
1148135549 17:45289463-45289485 GAAGCTGGGGAGAGACAGTGCGG - Intronic
1148197579 17:45725752-45725774 GAAGCTGGGGAGGGTCAGCCAGG - Intergenic
1148421364 17:47550044-47550066 GATGCTGGGGAGGCTGAGGCAGG - Intronic
1148480806 17:47958337-47958359 GAGGCAGGGGAGGGACAGCCTGG - Intergenic
1148695207 17:49554769-49554791 CATGCTGTGGAGACACAGCGGGG - Intergenic
1148958065 17:51370241-51370263 GGTTCTGGGGAGTCAGAGCCAGG + Intergenic
1151390175 17:73781549-73781571 GAGGCTGAGGAGGAACAGCCAGG + Intergenic
1151785808 17:76274365-76274387 CATGCTGGGCTGACACAGGCTGG + Intronic
1152040642 17:77900441-77900463 GCTGCTGGGGAGACTGAGGCAGG - Intergenic
1152200713 17:78944371-78944393 TCTGCTTGGGAGACACAGCCAGG + Intergenic
1152225657 17:79091480-79091502 GCTTCTGGGGAGACACTGGCTGG - Intronic
1152530734 17:80917499-80917521 GAGGGTAGGGAGACACAGACCGG - Intronic
1152609041 17:81306708-81306730 GGTGCTGGGGAGAGGCAGGCGGG - Intergenic
1152657485 17:81526801-81526823 CATCCTGGGGAGACGCAGTCTGG - Intergenic
1153959696 18:10130437-10130459 GGTGGTGGGGAGACACAGGCAGG - Intergenic
1153985874 18:10350614-10350636 ACTGCTGAGAAGACACAGCCTGG - Intergenic
1154087403 18:11320771-11320793 GACACTGGGGAAACACAGGCAGG - Intergenic
1154486384 18:14874951-14874973 GATGCTGGGAAGACTCATACAGG + Intergenic
1155393749 18:25364593-25364615 GATGCTGGGAAGAAGCAGCCAGG - Intergenic
1156178981 18:34581134-34581156 GCTGCTGGGGAGACTGAGGCAGG + Intronic
1157784452 18:50469475-50469497 GATGATGGGGAGGCAGAGCCAGG + Intergenic
1160584314 18:79904180-79904202 GATGCTGTGGAGACACAAGCAGG + Exonic
1160693566 19:471552-471574 GCTGCTGGGGAGGCCCAGGCAGG - Intronic
1160861348 19:1238301-1238323 GGTTCTGGGGCGGCACAGCCAGG + Intergenic
1160894751 19:1397182-1397204 GCTGCTGGTGACACACAGCTGGG + Intronic
1161029276 19:2050499-2050521 CTTGCAGGGGACACACAGCCTGG + Intronic
1161458392 19:4381496-4381518 GAGGCGGGGGAGACAGAGGCAGG - Intronic
1162018098 19:7856495-7856517 CATGGTGGGGAGCCACAGCCCGG + Intronic
1162341496 19:10093894-10093916 GATAGGGGGGAGGCACAGCCTGG + Intronic
1163334015 19:16660046-16660068 GAGGCTGGGAAGAGAGAGCCAGG - Intronic
1163894125 19:20042136-20042158 GCTGCTGGGGAGACTGAGGCAGG - Intergenic
1164272131 19:23682522-23682544 GAAGCTGGGGATGCACAGGCAGG - Intronic
1164829342 19:31308760-31308782 GAATCTGAGCAGACACAGCCAGG - Intronic
1165329577 19:35134208-35134230 CATGCAGGGGAGACACATCCAGG - Intronic
1165468129 19:35987142-35987164 GAGGTGGGGGAGACATAGCCAGG - Intergenic
1165797408 19:38526974-38526996 CTTTCTGGGGAGACAGAGCCAGG - Exonic
1165835087 19:38750035-38750057 GCTGCTGGGGAGACTGAGGCAGG + Intronic
1166060951 19:40325156-40325178 GATGCTTGGGAGACTGAGGCAGG + Intronic
1166147075 19:40845230-40845252 GATGCTGGGGACACAGAGAGGGG + Intronic
1166658122 19:44627149-44627171 GGTGCTGGGAAGCCACAGCAGGG + Intronic
1166696033 19:44851846-44851868 GAGGCAAGGGAGATACAGCCAGG - Intronic
1167156326 19:47741452-47741474 GGAGCTGGGGAGCCACAGCAGGG - Exonic
1167590394 19:50401709-50401731 GAGGCTGTGGAGACACACCTTGG + Intronic
1167747982 19:51364024-51364046 GGTGCTGGGGAGCCACAGGCAGG + Intronic
1168011695 19:53538366-53538388 GAGTGTGGGGTGACACAGCCGGG + Intronic
1168333831 19:55585844-55585866 GATGCTGGGGAGACCGAGGCGGG + Intergenic
1168530495 19:57124536-57124558 CCAGCTGGGGAGACACAGCAAGG - Intronic
1168586809 19:57600340-57600362 GAGGCTGGGGAGACCCAGGCCGG + Intronic
1202687712 1_KI270712v1_random:61063-61085 GATACTCGGGAGACAGAGGCAGG + Intergenic
925292269 2:2755806-2755828 AATGCAAGGGAGACAGAGCCCGG - Intergenic
925366405 2:3314949-3314971 GATGCTGTGTGGACACCGCCAGG - Intronic
925656292 2:6153040-6153062 GATGCTGGGGCAACAGAGTCTGG - Intergenic
925665216 2:6246921-6246943 GCTGCTGGGGAGGCAGAGGCAGG + Intergenic
926477657 2:13347227-13347249 GATGCTTGGGAGAAAAAGCTTGG + Intergenic
927153436 2:20208677-20208699 GATGCTGGGGAGAGCTACCCAGG - Intronic
927480375 2:23449075-23449097 GATGCTGGGAACACACAGCCTGG - Intronic
927508618 2:23630366-23630388 GAGGCTGGGGAGAGGTAGCCTGG + Intronic
929786930 2:45000209-45000231 GCTGCTGGGGAGACTGAGGCAGG + Intergenic
932492590 2:72131580-72131602 GATGCTGGGGAGACAGGGCCTGG + Exonic
932561968 2:72881193-72881215 GATGCTTGGGAGACTGAGCCAGG - Intergenic
933190698 2:79330465-79330487 GCTGCTGAGGAGACAAAGTCAGG - Intronic
933319640 2:80757538-80757560 GAGGCTGAGCAGGCACAGCCAGG + Intergenic
933958641 2:87394522-87394544 GATACTCGGGAGACAGAGGCAGG - Intergenic
934242770 2:90286528-90286550 GATACTCGGGAGACAGAGGCGGG - Intergenic
934270406 2:91530155-91530177 GATACTCGGGAGACAGAGGCGGG + Intergenic
934744856 2:96752680-96752702 GCTGCTGGGGAGGCAGAGGCAGG - Intergenic
935084194 2:99828428-99828450 GCTGCTGGAGAGAAGCAGCCTGG + Intronic
935193976 2:100800600-100800622 GATGATGAGGAGGCACAGACTGG + Intergenic
935208543 2:100919110-100919132 TATGCTGGGTAGAAGCAGCCAGG + Intronic
936780100 2:116022125-116022147 TGGGCTGGGGAGACACAGTCTGG - Intergenic
937215411 2:120309726-120309748 GCTACTCGGGAGACAGAGCCAGG - Intergenic
937263443 2:120601050-120601072 GAAACTGAGGAGACACAGCCGGG - Intergenic
939017770 2:136921137-136921159 GCAGCAGGGGAGGCACAGCCAGG - Intronic
939085082 2:137708673-137708695 GCAGCAGGGGAGGCACAGCCAGG - Intergenic
939652588 2:144783151-144783173 TATGCTAGGGAGATAGAGCCTGG - Intergenic
940169558 2:150813392-150813414 GAGGCTGAGGAGAGAAAGCCAGG + Intergenic
940228018 2:151420623-151420645 GATGCTTGGGAGACTAAGGCGGG + Intronic
941181348 2:162262856-162262878 GATGCTGGGGAGGCTGAGGCAGG + Intergenic
941998808 2:171626606-171626628 GATGCTGTCGTGACCCAGCCAGG + Intergenic
944904592 2:204250089-204250111 GAAGCTGAGGAAGCACAGCCAGG - Intergenic
946471314 2:219963828-219963850 GATGCTGGGGTGAGAAAGCATGG + Intergenic
946621998 2:221571843-221571865 GATGCACGGGAGACAACGCCGGG - Intronic
947820592 2:233066475-233066497 GATGCTGGGTTGACACAGGAAGG - Intronic
948456950 2:238109032-238109054 GAGACTGGGGAGACAGAGCTGGG - Intronic
948504266 2:238417728-238417750 CAGGCTGGGGAGACACACGCAGG - Intergenic
948504276 2:238417770-238417792 CAGGCTGGGGAGACACACACAGG - Intergenic
948504287 2:238417812-238417834 CAGGCTGGGGAGACACACACAGG - Intergenic
948504298 2:238417854-238417876 CAGGCTGGGGAGACACACACAGG - Intergenic
948504309 2:238417896-238417918 CAGGCTGGGGAGACACACACAGG - Intergenic
948504320 2:238417938-238417960 CAGGCTGGGGAGACACACACAGG - Intergenic
948504331 2:238417980-238418002 CAGGCTGGGGAGACACACACAGG - Intergenic
948504342 2:238418022-238418044 CAGGCTGGGGAGACACACACAGG - Intergenic
948504353 2:238418064-238418086 CAGGCTGGGGAGACACACACAGG - Intergenic
948504364 2:238418106-238418128 CAGGCTGGGGAGACACACACAGG - Intergenic
948504375 2:238418148-238418170 CAGGCTGGGGAGACACACACAGG - Intergenic
948504385 2:238418190-238418212 CAGGCTGGGGAGACACACACAGG - Intergenic
948504395 2:238418232-238418254 CAGGCTGGGGAGACACACACAGG - Intergenic
948504405 2:238418274-238418296 CAGGCTGGGGAGACACACACAGG - Intergenic
948612137 2:239176485-239176507 GAAGCTGGAGAGGCACCGCCAGG - Exonic
1168880813 20:1204659-1204681 CATCCTGGGGAGAGACAGACAGG + Intronic
1169069315 20:2713130-2713152 TATGCTGACGAGAAACAGCCAGG + Intronic
1169568392 20:6880684-6880706 GCTGCTGGGGAGACTGAGGCAGG + Intergenic
1170117084 20:12872189-12872211 GAAGCTGAGGACACACAGCCAGG - Intergenic
1170424296 20:16223337-16223359 GCTGCTGGGGAGGCTCAGGCAGG - Intergenic
1171359210 20:24575033-24575055 GAGGCTGGGGAAGCACATCCAGG - Intronic
1172217689 20:33247992-33248014 CAGGATGGGGACACACAGCCTGG - Intergenic
1172486629 20:35302275-35302297 GATGCTGGAGGGACTCACCCAGG + Intergenic
1172583689 20:36067292-36067314 GATACTTGGGAGACTCAGACAGG + Intergenic
1172760316 20:37316855-37316877 GCTGCTGTGTAGACAGAGCCAGG + Exonic
1173317888 20:41961399-41961421 GATCCTGTGGAGACACAGGGAGG - Intergenic
1173650811 20:44662996-44663018 GGTGCTGGGGACACACAGTGAGG + Intergenic
1175244006 20:57570462-57570484 GGTGCTGGGCCTACACAGCCTGG + Intergenic
1175282629 20:57814262-57814284 GAAGCCGGGTAAACACAGCCTGG - Intergenic
1175956092 20:62610147-62610169 GTTGCTGGCCAGCCACAGCCCGG - Intergenic
1177635038 21:23776170-23776192 GAGGCTGGGGAGTCCCAGCAAGG - Intergenic
1177843893 21:26266116-26266138 GATGATGGGGAGACACAGGGTGG + Intergenic
1178370339 21:32021820-32021842 GCTCCTGGGCAGACACAACCGGG + Intronic
1178417153 21:32413028-32413050 GGTGCCGGGGGCACACAGCCAGG - Intronic
1179207933 21:39301065-39301087 GCTGCTGGGGAGACTGAGGCAGG + Intronic
1180967587 22:19798633-19798655 GCTGGTGGGTAGGCACAGCCAGG - Intronic
1181006028 22:20013982-20014004 GCTGCTGGGGAGACTGAGGCAGG - Intronic
1181113418 22:20615778-20615800 TATGCTCAGAAGACACAGCCAGG + Intergenic
1181846106 22:25710068-25710090 GATGCTGGGGAGACACAGCCAGG - Intronic
1183043369 22:35200181-35200203 GATGCTGGGGAGGGAGAGACAGG + Intergenic
1183404405 22:37623407-37623429 GATGGTGATGAGCCACAGCCAGG + Exonic
1184119529 22:42441052-42441074 GATGCTGGGGAGAAATTCCCAGG - Intergenic
1184445043 22:44542122-44542144 GATGTGGGGGAGACACCGGCTGG + Intergenic
1184535138 22:45081627-45081649 GATGAAGTGGAGACTCAGCCAGG + Intergenic
1184596192 22:45515639-45515661 GAAATGGGGGAGACACAGCCGGG - Intronic
1184906421 22:47489542-47489564 GATTCTGGGGAGAGACAGAGAGG - Intergenic
1185236514 22:49716662-49716684 GGCGCTGGGGAGAAAGAGCCGGG - Intergenic
949194575 3:1289784-1289806 GCTGCTGGGGAGACTGAGGCAGG - Intronic
949592158 3:5505784-5505806 GGTGCTGGGGAGAGACTCCCAGG + Intergenic
949925529 3:9037984-9038006 GGGGCTGGGGAGGCACTGCCAGG - Intronic
950198872 3:11028826-11028848 GATGCTGGGCATTGACAGCCAGG + Exonic
950500040 3:13358030-13358052 TATGCAGGGGACACACAGCTTGG - Intronic
952103584 3:30043419-30043441 GCTGCTGGGGAGACACAATTAGG + Intergenic
952180333 3:30910222-30910244 ATTGGTAGGGAGACACAGCCAGG - Intergenic
952935125 3:38391610-38391632 GAATTTGGGGAGACACAGTCAGG - Intronic
953377510 3:42441061-42441083 GATGCTGGGGAGAGAAACCATGG + Intergenic
953404434 3:42653657-42653679 TCTGCTGGGGAGATGCAGCCAGG - Intergenic
953709306 3:45256730-45256752 GATGGTGGGGAAAGACAGCATGG + Intergenic
954036817 3:47855214-47855236 GTCACTGGGGAGACACAGCTGGG - Intronic
954362855 3:50131529-50131551 GATGCTTGTTAGACACACCCGGG - Intergenic
954917854 3:54164087-54164109 GATGCTGGGGAGACAGGGAGAGG + Intronic
954924976 3:54226110-54226132 GATGCTGGGGAGAAAAACACTGG - Intronic
955755702 3:62223058-62223080 GAGGCTGGGGAGAAAAAGCCTGG + Intronic
955981865 3:64535265-64535287 GATGCTCGGGAGACTGAGGCAGG + Intronic
956320689 3:67993057-67993079 GATGCTTGGTAGACACAACAGGG + Intergenic
957091913 3:75739093-75739115 AAGCCTGGGGAGACACAGTCTGG - Intronic
958979530 3:100705304-100705326 GATACTGGGGAGACTGAGACAGG - Intergenic
959003185 3:100988742-100988764 GAGGCTGGGGAGACAAAGCTTGG - Intronic
959864700 3:111252903-111252925 GTTGCTGGGCAGACTCAGCTAGG - Intronic
960968628 3:123123432-123123454 AACACTGGGGAGACACAGCACGG + Intronic
961107950 3:124258157-124258179 GGGGTTGGGGAGACAGAGCCAGG + Intronic
961456458 3:127027065-127027087 GATGGCGGGGAGACTCAGCGAGG + Intronic
961654734 3:128435091-128435113 GCTGCCAGGGAGTCACAGCCAGG - Intergenic
962030952 3:131599839-131599861 GAGTCTGTGGAGACAGAGCCTGG - Intronic
963738557 3:149051000-149051022 GATACCAGGGAGACACAGCTGGG + Intronic
963867665 3:150379708-150379730 GTTGCTGGGGAGACCGAGGCAGG - Intergenic
964451215 3:156815332-156815354 GCTGCTGGGGAGACTGAGGCAGG + Intergenic
965117990 3:164515703-164515725 GCAGCAGGGGAGGCACAGCCAGG - Intergenic
966805026 3:183800331-183800353 GCTGTTGTGGGGACACAGCCAGG - Intronic
968166206 3:196467268-196467290 GCTGCTGGGGAGGCTCAGGCCGG - Intergenic
968809108 4:2792254-2792276 GAGGCTGGGGAGACCAAGCTGGG - Intergenic
968915950 4:3497165-3497187 GAAGGTTGGGAGACACAGACTGG + Intronic
969564728 4:7971097-7971119 GAGGCAGTGGAGACTCAGCCAGG - Intronic
970385231 4:15549467-15549489 GATACTGGGGAGGCAAGGCCAGG + Intronic
973927853 4:55757863-55757885 CAAACTGGGGTGACACAGCCTGG - Intergenic
974030395 4:56771356-56771378 GCTACTGGGGAGACTGAGCCGGG + Intergenic
975331308 4:73117400-73117422 GAAACTGGGGAGACACAGAAAGG + Intronic
975563515 4:75729449-75729471 GCTGCTCGGGAGACTGAGCCAGG - Intronic
976221479 4:82759960-82759982 GATGCTGGGAAGGAACAGACTGG - Intronic
977929430 4:102735054-102735076 GCTGCTGTGTAGACAGAGCCAGG + Intronic
980271490 4:130590231-130590253 GCTGCTGGGGAGACTGAGGCGGG - Intergenic
980309854 4:131112809-131112831 GTGTCTGGGCAGACACAGCCAGG - Intergenic
982122302 4:152155062-152155084 GATGCTGGGTAGACAATGGCTGG - Intergenic
982437696 4:155397614-155397636 GATGTAGGGGAGAAACATCCTGG - Intergenic
983725474 4:170918241-170918263 GATGAAAGGGAGACACAGTCTGG + Intergenic
984915245 4:184717784-184717806 GATGATGTGGAGACACAGCTGGG + Intronic
985903494 5:2814875-2814897 GATGCGGGAGAAACACAGGCAGG + Intergenic
986285321 5:6354587-6354609 GAGGCTGGGGAGAGACAGGCTGG + Intergenic
986285335 5:6354636-6354658 GAGGCTAGGGAGAGACAGGCTGG + Intergenic
986285349 5:6354684-6354706 GAGGCTGGGGAGAGACAGGCTGG + Intergenic
986314122 5:6574752-6574774 GAAGCTGAGGACACACAGCCGGG + Intergenic
990566402 5:57033725-57033747 GATACTTGGGAGACTCAGCTGGG + Intergenic
991420773 5:66439159-66439181 GCTACTGGGGAGACAGAGGCAGG - Intergenic
992621046 5:78593420-78593442 GGTGCTCGGGAGAGACAGCTGGG - Intronic
992645668 5:78808804-78808826 GATGCTGGAGGGACACAGGATGG + Intronic
992780861 5:80125686-80125708 GATGATGGGAAGACTCAGCTGGG + Intronic
994218869 5:97171488-97171510 GCTGCTGGGGATACACAGCATGG - Intronic
994517846 5:100793728-100793750 GCAGCGGGGGAGTCACAGCCAGG + Intergenic
995684864 5:114761245-114761267 TAGGCTGTGGAGAAACAGCCTGG - Intergenic
995968913 5:117943058-117943080 GCTACTTGGGAGACATAGCCAGG - Intergenic
998092346 5:139378727-139378749 GATGATGGGGGAACACAGACTGG - Intronic
999185304 5:149703086-149703108 GGTGCTGGAGAGAGGCAGCCTGG - Intergenic
1000501911 5:162062581-162062603 GATGCTTGGGAGGCAGAGACAGG + Intergenic
1001466896 5:171975382-171975404 GCTGCTGGCCAGCCACAGCCTGG + Intronic
1001480646 5:172086874-172086896 GAGGGTGGGGAACCACAGCCAGG + Intronic
1001553299 5:172619678-172619700 GCTGCTTGGGAGACTCAGGCGGG + Intergenic
1003243152 6:4361814-4361836 GAAGCTGGCCAGCCACAGCCAGG - Intergenic
1003545067 6:7052045-7052067 GATGCTGTGGAGTCCCGGCCGGG - Intergenic
1003730548 6:8818065-8818087 AATGCTGAGGAGAAAGAGCCAGG + Intergenic
1004121725 6:12829844-12829866 GCTGCTGGGGAGGCAGAGACAGG + Intronic
1004308696 6:14524245-14524267 ACTGCTGGGGAGAAACAGCTAGG + Intergenic
1004601965 6:17158934-17158956 GATGCTTGGGAGACTGAGGCAGG - Intergenic
1004869692 6:19892392-19892414 GCTGCTGTGGTGACTCAGCCGGG - Intergenic
1005022026 6:21427438-21427460 GATTCTGGGGAAAGACAGGCTGG - Intergenic
1005152943 6:22773354-22773376 GATGCTGGAGCCACACTGCCTGG + Intergenic
1005661092 6:28000495-28000517 GATGCTGGTGAGACCCAGTAAGG + Intergenic
1006454121 6:34122324-34122346 GAAGCTGGGGATAGACAGACAGG + Intronic
1006663585 6:35671978-35672000 GATGCTGGGGAGGCTGAGGCAGG - Intronic
1006760338 6:36455063-36455085 GATGCTGGAGAGACAAAAACTGG - Intronic
1007115668 6:39341399-39341421 GATGCTGAGAAGGCACTGCCAGG - Intronic
1007315000 6:40979948-40979970 GCTGCTGACTAGACACAGCCAGG - Intergenic
1007403551 6:41618692-41618714 CATGCTGGGGAAACAAAGCAAGG - Intergenic
1007616847 6:43184899-43184921 GATGCTGGTAAGAGACAGCCAGG + Exonic
1007927803 6:45663780-45663802 GCTGCTGGGGAGGGACAGGCAGG - Intronic
1008497816 6:52151018-52151040 GGTGCTGGGGACACACTACCTGG + Intergenic
1010752470 6:79631116-79631138 GCTGGAGGGGAGCCACAGCCCGG - Intergenic
1013305777 6:108846183-108846205 GTAGCTGTGGAGAAACAGCCAGG + Intergenic
1015026214 6:128535825-128535847 AATGCTGGGGTGTCACAGCCAGG + Intergenic
1017871845 6:158493554-158493576 GATCCTGGGGAGGCAAGGCCAGG - Exonic
1017896766 6:158686823-158686845 GATGCTGGCCAGACACAGGTCGG + Intronic
1017957081 6:159187567-159187589 GCTGTTGGGTAGACACAGTCTGG - Intronic
1019188585 6:170236300-170236322 ACAGCTGGGGAGACACAGTCAGG + Intergenic
1019784491 7:2966640-2966662 CATGCTGGGGATACAAAGCAGGG - Intronic
1020049427 7:5072220-5072242 GCTGCTCGGGAGACATAGGCGGG + Intronic
1022262352 7:28718689-28718711 GACACTGGGGAGACAGGGCCAGG + Intronic
1022385617 7:29896195-29896217 GCTGCTGGGGAGGCTCAGGCAGG + Intronic
1023992755 7:45139216-45139238 GAGGCTGGGGAGACAGAGAGAGG - Intergenic
1024726881 7:52207929-52207951 GCTGCTGGGGAGGCTCAGGCAGG + Intergenic
1026175245 7:67990947-67990969 GAGGCTGGGATGACCCAGCCAGG + Intergenic
1026370303 7:69691764-69691786 GCAGCAGGGGAGGCACAGCCAGG - Intronic
1026768609 7:73177431-73177453 GCTGCTTGGGAGACTGAGCCAGG - Intergenic
1026848980 7:73713161-73713183 GGTGCAGGGGCGACAGAGCCAGG - Intronic
1027009479 7:74730816-74730838 GCTGCTTGGGAGACTGAGCCAGG - Intronic
1027078564 7:75215226-75215248 GCTGCTTGGGAGACTGAGCCAGG + Intergenic
1028748894 7:94359873-94359895 GATTCTGGGGATACACATGCAGG - Intergenic
1028853010 7:95557772-95557794 AATCCTGGGGAGAAAAAGCCAGG - Intergenic
1029703190 7:102261107-102261129 CAGACAGGGGAGACACAGCCTGG + Intronic
1029922770 7:104283273-104283295 GCTCCAGGGGAAACACAGCCTGG - Intergenic
1031484410 7:122310611-122310633 GACGCTTGGGAGCCCCAGCCCGG - Intronic
1031711530 7:125052959-125052981 GCTGCTGGGGAGGCAGAGGCAGG - Intergenic
1032203710 7:129843108-129843130 GCTGCTGGGGAGACTGAGGCAGG - Intronic
1032539411 7:132690886-132690908 AATGCTGGGGAGGCCCAGCTTGG - Intronic
1032549541 7:132771669-132771691 GTAGAGGGGGAGACACAGCCAGG - Intergenic
1032840836 7:135712304-135712326 TGTGCTCGGGAGACACGGCCTGG + Intronic
1033595717 7:142856481-142856503 AATGCTGGGGAGCAACAGGCTGG + Intronic
1034458912 7:151187337-151187359 GAGGTCGGGGAGAAACAGCCGGG + Intronic
1034483460 7:151341447-151341469 GATTCTGGAGAAACAAAGCCAGG + Intergenic
1035112166 7:156492252-156492274 TGTGCTGGGGAGAGACAGCCAGG - Intergenic
1035966321 8:4196097-4196119 GCTGCTGGGGAGACTGAGGCAGG + Intronic
1036464598 8:8984792-8984814 GCTACTGGGGAGGCACAGGCAGG + Intergenic
1036642009 8:10590557-10590579 GATGCTGGGGAGAAACTCCAGGG + Intergenic
1037566608 8:20123369-20123391 GTTGCTGGGCAGGCATAGCCAGG + Intergenic
1037571497 8:20161849-20161871 GCTGCTGGGTAGACTCAGCCCGG - Intronic
1037899124 8:22677307-22677329 GATGCTGGGGAGGGGCTGCCCGG + Intergenic
1039900393 8:41748029-41748051 GAGGCTGGGGAGACTCAGAGAGG - Intronic
1039984825 8:42438416-42438438 GATGCTTGGGAGGCTCAGGCGGG - Intronic
1040033164 8:42844065-42844087 GCTTCTGGGGAGGGACAGCCTGG - Intergenic
1043394997 8:79827475-79827497 GCGGCTGGGGAGACAGAGGCAGG - Intergenic
1044613770 8:94119536-94119558 GCAGTTGGGGAGGCACAGCCGGG + Intergenic
1044845090 8:96372535-96372557 AATGCTGGGGTGACACAGCAGGG - Intergenic
1044989146 8:97779937-97779959 GCTGCTGGGGAGGCAGAGGCAGG + Intronic
1045544011 8:103112068-103112090 GAGGCTGGGGGGACAGAGCAAGG + Intergenic
1048525859 8:135201821-135201843 GATGCTGGGGAGATACAGGATGG + Intergenic
1048967546 8:139625364-139625386 CCTGCTGGGTAGTCACAGCCTGG + Intronic
1049465478 8:142749475-142749497 GATCATGGGGAGTCTCAGCCTGG + Intergenic
1050358086 9:4802018-4802040 GATGCTCGGGAGACTGAGACAGG - Intronic
1050635606 9:7609007-7609029 GATGCTGGGCAGACACAGTTTGG + Intergenic
1050640601 9:7663288-7663310 GATGCTGCACAGATACAGCCTGG - Intergenic
1051083956 9:13325400-13325422 GATGCTGGAGAGACACTGGAAGG - Intergenic
1053062633 9:35043953-35043975 GATGCTGGTGGGACACATTCAGG - Exonic
1053272312 9:36758905-36758927 GGTGCTGTGAGGACACAGCCTGG + Intergenic
1053887307 9:42653763-42653785 GATGCTGGGAAGACTCATACAGG + Intergenic
1054226329 9:62461214-62461236 GATGCTGGGAAGACTCATACAGG + Intergenic
1055095883 9:72413914-72413936 GCTGCTGGGGAGGCTGAGCCAGG - Intergenic
1056196569 9:84234915-84234937 GCTGCTGGCCAGACACTGCCAGG - Intergenic
1056770651 9:89475671-89475693 GAGGCGGGAGAAACACAGCCTGG - Intronic
1057503742 9:95616108-95616130 GGTAGTGGGGAGACACAGCAGGG + Intergenic
1057720415 9:97527745-97527767 GATGCTGGGGACACATGGACTGG + Intronic
1057759243 9:97859494-97859516 AAAGCTGGGGTGACAGAGCCAGG + Intergenic
1057961758 9:99464103-99464125 CATGCTGGGGAATCACAACCTGG - Intergenic
1059728188 9:117029482-117029504 GATGCTGTGGAGACACCGATGGG - Intronic
1061325755 9:129863160-129863182 GGTGCAGGGGAGAGAGAGCCAGG - Intronic
1061432520 9:130540245-130540267 GCTGCTGGGGAGACTGAGGCGGG + Intergenic
1061582075 9:131544393-131544415 GAAGCTGGTGTGACCCAGCCTGG - Intergenic
1061707287 9:132462916-132462938 GGTGCTGGAGAGACAGACCCAGG - Intronic
1061727509 9:132589700-132589722 GGGGCTGGGGAGACGCAGTCCGG - Exonic
1062043266 9:134413835-134413857 GATGCTGGGGAGGGTCCGCCTGG + Intronic
1062254640 9:135615169-135615191 CCTGCTGGGGCTACACAGCCGGG + Intergenic
1062465190 9:136677753-136677775 GTTGCTGGGGAGACGGAGGCAGG - Intronic
1062589582 9:137267367-137267389 GCCGCAGGGAAGACACAGCCAGG - Intronic
1185534140 X:846269-846291 GATACTCGGGAGACAGAGGCAGG - Intergenic
1185557843 X:1035388-1035410 GAAGCTGAGGAGAAACACCCGGG + Intergenic
1185957982 X:4513232-4513254 GATGCTTGGGAGGCAGAGACGGG + Intergenic
1186194718 X:7098940-7098962 GATGCAGGGGAGAGCCGGCCAGG + Intronic
1186719291 X:12285519-12285541 TATGCTGGGGAAACTCAGGCAGG + Intronic
1187578639 X:20585082-20585104 GAGGCTGGGAAGAGACAGGCAGG + Intergenic
1187987816 X:24833643-24833665 GATGCTGGGGAAAAACAGCTAGG - Intronic
1190708307 X:53048591-53048613 GATGCTGGGGACACCCAGCCTGG - Intergenic
1190773426 X:53533805-53533827 GGGGCTGGGGAGACACTGTCAGG - Intronic
1192418924 X:71011058-71011080 TATGCTGGGGTGAAACAGCATGG - Intergenic
1194243106 X:91475877-91475899 GATGTTGGGGAGAGGGAGCCAGG + Intergenic
1195007252 X:100698212-100698234 GCTGCTGGGGAGACTGAGGCAGG - Intronic
1197213392 X:123846381-123846403 GCTGCTGGGGAGACTGAGGCAGG + Intergenic
1198434151 X:136598885-136598907 GATGCTGAGAAGGCAAAGCCAGG - Intergenic
1199987884 X:152965346-152965368 AGGGCTGGGGAGACCCAGCCTGG - Intronic
1201960205 Y:19672412-19672434 GATGCTTGGGAGACTGAGGCAGG - Intergenic