ID: 1181848207

View in Genome Browser
Species Human (GRCh38)
Location 22:25730172-25730194
Sequence GATGCTATTTCCCCTCCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181848207_1181848212 21 Left 1181848207 22:25730172-25730194 CCAGAAGGAGGGGAAATAGCATC No data
Right 1181848212 22:25730216-25730238 ATCACTTTGGACAACCTCTTTGG No data
1181848207_1181848209 8 Left 1181848207 22:25730172-25730194 CCAGAAGGAGGGGAAATAGCATC No data
Right 1181848209 22:25730203-25730225 AATTCCCAGCATCATCACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181848207 Original CRISPR GATGCTATTTCCCCTCCTTC TGG (reversed) Intergenic
No off target data available for this crispr