ID: 1181849161

View in Genome Browser
Species Human (GRCh38)
Location 22:25737453-25737475
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181849156_1181849161 20 Left 1181849156 22:25737410-25737432 CCATGTATCTGATATAGTTTTCT No data
Right 1181849161 22:25737453-25737475 CAGAAGACACAGTTGGGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181849161 Original CRISPR CAGAAGACACAGTTGGGTCA GGG Intergenic
No off target data available for this crispr