ID: 1181849820

View in Genome Browser
Species Human (GRCh38)
Location 22:25742100-25742122
Sequence ACATTGGCCCAGAAGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 223}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181849820 Original CRISPR ACATTGGCCCAGAAGGAGGG TGG Intergenic
900526524 1:3131871-3131893 ACATAGGCCCAGGAGGGAGGAGG - Intronic
900690357 1:3977113-3977135 ACCTTGGCCAAGAAGTTGGGTGG + Intergenic
900869696 1:5293198-5293220 ACAGAGGCCCAGAGGGAAGGAGG + Intergenic
901748003 1:11387431-11387453 ACATGGGGCCAGAGGGAGGCAGG - Intergenic
903000500 1:20262188-20262210 AGATTGCCCCAGCGGGAGGGTGG - Intergenic
903136082 1:21310132-21310154 ACATTGCCTCAGAGGGAGGGAGG + Intronic
903325687 1:22567392-22567414 ACATTGCCTGAGAGGGAGGGAGG + Intronic
903870002 1:26427034-26427056 ACATTGGCCCAGAATGGGGCGGG - Exonic
905271881 1:36792717-36792739 ACATGGGCCCTGAAGCTGGGGGG + Intergenic
906483727 1:46218906-46218928 AGATTGGGCCAAAAGGAGGCAGG - Intronic
906655899 1:47548205-47548227 TCCTTGGCCCAGAACGGGGGTGG + Intergenic
909973926 1:82023236-82023258 ACATTGTCCCAGAACGATGGAGG + Intergenic
911758077 1:101583541-101583563 AAAGTTGCCCAGAAGGAGAGAGG + Intergenic
912574174 1:110649709-110649731 ACAAAAGCCAAGAAGGAGGGAGG + Intergenic
912904935 1:113694437-113694459 ACAATGACCCAAAATGAGGGGGG + Intergenic
913241474 1:116834049-116834071 ACAATGGCAGAGAAGGAGGCTGG - Intergenic
913476924 1:119246527-119246549 AAATTGGACCAAAAGGAGAGAGG + Intergenic
915440311 1:155941740-155941762 GCATTGGCCCAGAAGAATGTGGG - Exonic
915786710 1:158621343-158621365 AAACTGGCCCAAATGGAGGGAGG + Intronic
918658126 1:187054226-187054248 GCTTGGGCACAGAAGGAGGGGGG - Intergenic
919020700 1:192101409-192101431 AGCTTGGCACAGAAGGAGGAGGG - Intergenic
920033818 1:203052775-203052797 ACAAAGGCCCAGAAGAGGGGAGG - Intronic
922342414 1:224668655-224668677 ACACTGGACCAGAAGAAGGAGGG + Intronic
923020550 1:230160023-230160045 ACATTGGCCTAGGAGTGGGGAGG - Intronic
923235716 1:232031099-232031121 ACACTGCCAAAGAAGGAGGGAGG + Intronic
924931235 1:248733987-248734009 ACATTAACCCAGAAGCAGGAGGG - Intronic
1065772072 10:29087011-29087033 ACATGGGCACAGAAGGAGAAAGG - Intergenic
1067067891 10:43113796-43113818 ACAGAGGCCCAGAGGGAGGGAGG - Intronic
1067684111 10:48457002-48457024 ACATTAGCGCAGGCGGAGGGTGG + Intronic
1068990330 10:63143608-63143630 AAATTAGCCCAGCAGGATGGTGG - Intronic
1071335046 10:84593728-84593750 AAAGTGGCACAGAAGGGGGGGGG - Intergenic
1072501302 10:96020593-96020615 ACAGGAGCCCAGAGGGAGGGAGG + Intronic
1074160997 10:110836275-110836297 TCCTTGGCACATAAGGAGGGAGG - Exonic
1076171506 10:128323893-128323915 TCATTGCACCAGAAGGAGCGTGG + Intergenic
1076519944 10:131075242-131075264 ACATTGGCCTGGGAGGAGTGAGG - Intergenic
1078081347 11:8206850-8206872 ACATTTGTTCAGAGGGAGGGTGG - Intergenic
1079441332 11:20517808-20517830 AGAGTGGCCAAGGAGGAGGGAGG - Intergenic
1080094922 11:28394467-28394489 ACTCTGGCTCACAAGGAGGGGGG + Intergenic
1080275517 11:30499174-30499196 ACATGTGTACAGAAGGAGGGAGG + Intronic
1080761516 11:35254582-35254604 ACAGTGCCCCAGAAGGAGTGAGG + Exonic
1083198928 11:61107902-61107924 AACTGGGGCCAGAAGGAGGGAGG - Intronic
1083921132 11:65781733-65781755 AAACAGGCCCAGGAGGAGGGCGG + Intergenic
1084775934 11:71375527-71375549 AAATTTGCCCAGAAGGAGAAAGG + Intergenic
1085529191 11:77181644-77181666 CCAAGGGCACAGAAGGAGGGAGG - Intronic
1085784887 11:79440339-79440361 CCCCTGGCCCAGGAGGAGGGAGG - Intronic
1087077726 11:94141274-94141296 ACATTGGTAAAGAAGTAGGGCGG - Intronic
1088510700 11:110571025-110571047 ACATTGTCCCAGGATGAGTGTGG - Intergenic
1089562718 11:119352956-119352978 ACGGAGGCCCAGAAAGAGGGAGG + Intergenic
1090085393 11:123645815-123645837 ACATTGGAGAAGAAGGAGGGAGG + Intronic
1090381795 11:126332549-126332571 TCCCTGGCCCAGAAGAAGGGAGG + Intronic
1091600063 12:1912628-1912650 ACAGAGGAGCAGAAGGAGGGTGG - Intronic
1092940421 12:13402620-13402642 ACAATGGCCCAGAAGCAGGGAGG + Intergenic
1097247806 12:57616179-57616201 ACATTGGCTGACAGGGAGGGAGG + Intronic
1097760254 12:63456708-63456730 ACAAGGACCCAGAAGGAGAGGGG + Intergenic
1100021047 12:90070016-90070038 ACAGTGGACCAGAATGAGTGAGG - Intergenic
1102632787 12:114296443-114296465 CCACAGGCCCAGAAGGAGGCTGG - Intergenic
1103207705 12:119143288-119143310 ATCTTGGCCCTAAAGGAGGGGGG - Intronic
1103924757 12:124417406-124417428 ACATTTGCACAGAGGGAGGTGGG - Intronic
1105209423 13:18249089-18249111 TCTGTGGCCCAGAAGGAGAGGGG + Intergenic
1106092728 13:26612066-26612088 ACAGCGGCCCAGAAGTGGGGCGG - Intronic
1108208265 13:48112932-48112954 ACAAAGGCCCCGAAGCAGGGAGG + Intergenic
1110176876 13:72567586-72567608 ACATTGGCCAAGAAATGGGGAGG - Intergenic
1112235180 13:97629563-97629585 GCATTGGCTGAGAAGCAGGGGGG - Intergenic
1112809198 13:103198029-103198051 ACATTGGCTCAGAATAAGGCAGG + Intergenic
1113635975 13:111919349-111919371 ACAGTGGCCCAGCAGGGTGGGGG + Intergenic
1113650080 13:112028395-112028417 AGGATGGCCCAGAGGGAGGGAGG + Intergenic
1114215362 14:20653910-20653932 AGATTGGCCCCGAGGGAGGAGGG - Intergenic
1117659068 14:57985505-57985527 TCCTTGGCCCAGAAGGAGCCTGG - Intergenic
1121780569 14:96619342-96619364 CCATTGGACCAGACGGAGAGGGG - Intergenic
1124366468 15:29075179-29075201 ACACTGGCCTGGGAGGAGGGAGG + Intronic
1125352793 15:38784887-38784909 ACATGGGCTCAAAAGGATGGAGG + Intergenic
1127054104 15:55114060-55114082 CCATGGGCCCAGAAGGAAGGGGG + Intergenic
1128075425 15:64822661-64822683 ACATGGGCCAAGAAGGGTGGGGG - Intronic
1129169796 15:73800666-73800688 AAAATCGCACAGAAGGAGGGAGG - Intergenic
1129478698 15:75806194-75806216 AGATTGGAGCAGAAGGATGGAGG - Intergenic
1131270810 15:90946670-90946692 ACATGGGCCCTGCAGGAGGCAGG - Exonic
1132682110 16:1146632-1146654 ACAAAGGCTCAGAAAGAGGGAGG - Intergenic
1134018314 16:10904669-10904691 TAAGTGGCCCAGAGGGAGGGGGG + Intronic
1134467978 16:14495811-14495833 ACAGAGGCACAGAAGGAGGGAGG + Intronic
1135970065 16:27066035-27066057 AAGTTGGCTCAGAAGGAGGCAGG - Intergenic
1137915875 16:52429400-52429422 TCCTTGGCCCTGGAGGAGGGAGG - Intergenic
1139327114 16:66161152-66161174 ACATTGGCCCAGATTGAGAAAGG - Intergenic
1141892579 16:86936406-86936428 ATATGGGACCAGAGGGAGGGAGG + Intergenic
1142595466 17:1027651-1027673 ACATAGGCCCAGGAAGAGGTGGG + Intronic
1143121170 17:4607928-4607950 GCAGTGGCCCAGAGGGAGGGAGG - Exonic
1143506290 17:7367387-7367409 ACCTTTGCCCATAAAGAGGGTGG - Intergenic
1144766895 17:17737977-17737999 CCCTGGCCCCAGAAGGAGGGAGG + Intronic
1146314040 17:31793340-31793362 ACAGTCCCGCAGAAGGAGGGAGG + Intergenic
1146373696 17:32280773-32280795 CCATTGCCCCAGAAGGAAGCTGG - Intronic
1147546947 17:41409053-41409075 ACAATGGCCCAAAAGGGAGGTGG + Intergenic
1148237354 17:45977743-45977765 GCATTTGCCCAGAAGTTGGGAGG + Intronic
1150374655 17:64670917-64670939 CCATTGCCCCAGAAGGAAGCTGG - Intergenic
1151362884 17:73599187-73599209 ACATTCGTACAGAAGGAGGAAGG + Intronic
1151534148 17:74729328-74729350 ACAGTGGCCGAGAAGGAGCCGGG - Intronic
1151551554 17:74825239-74825261 ACAGTGGCCCAGTTGGAGGGTGG - Intronic
1153321604 18:3779117-3779139 AGATCGGGACAGAAGGAGGGAGG - Intronic
1155333090 18:24737767-24737789 ACTTGGGCCCAGCAGGAGAGGGG - Intergenic
1156315372 18:35964264-35964286 ACAGTGGGGCAGAAGGTGGGTGG + Intergenic
1157695206 18:49716841-49716863 AGATTGGCGCAGAAGGTGGGTGG - Intergenic
1159893307 18:73973185-73973207 ACATTCGCCCAGCAGGTGGTGGG + Intergenic
1160367069 18:78335476-78335498 TTATGGGGCCAGAAGGAGGGAGG + Intergenic
1162052014 19:8040162-8040184 AAATTAGCCCAGAACAAGGGAGG + Intronic
1162822305 19:13230322-13230344 ACAGAGGCCCAGATGGAGAGAGG + Intronic
1167071036 19:47222033-47222055 ACATTAGCCCAGGCGGGGGGAGG - Intronic
1167315843 19:48762293-48762315 ACATAGGCCCAGAGAGAGGGGGG + Intergenic
1167631080 19:50626581-50626603 ACAGAGGCCCAGAAAGAGAGGGG + Intronic
1167792016 19:51689077-51689099 AGACTGGCCGAGGAGGAGGGCGG + Intergenic
1168549955 19:57284581-57284603 ACATTTACCCAGGAGGAGTGGGG + Exonic
1168554106 19:57323712-57323734 ACATTCACCCAGGAGGAGTGGGG + Exonic
1168649691 19:58085369-58085391 ACCTTGTTCCAGAAGGCGGGAGG - Exonic
925326325 2:3024580-3024602 TCCTTGGTCCAGCAGGAGGGCGG - Intergenic
929396941 2:41534097-41534119 ACATAGGCCCAGAAGGGGCAGGG + Intergenic
929655340 2:43725426-43725448 GCTTCGGCACAGAAGGAGGGGGG - Intronic
933051871 2:77611092-77611114 CAATTGGCCCAGGAGTAGGGTGG - Intergenic
933256143 2:80083066-80083088 ACATGAGAACAGAAGGAGGGAGG - Intronic
933553316 2:83802694-83802716 CCACTGGCCCAGAAGGATTGAGG - Intergenic
934717782 2:96553323-96553345 GCCTTGGCTCAGGAGGAGGGAGG + Intergenic
937256177 2:120557465-120557487 ACCCTGGACCAGGAGGAGGGTGG - Intergenic
941491565 2:166148494-166148516 ACACTAGCACTGAAGGAGGGTGG - Intergenic
942143141 2:172998223-172998245 AGAGTGGCCCTGAAGGAGGCTGG + Intronic
943081353 2:183261843-183261865 ACATTGGCCTAGAATGGGGCAGG - Intergenic
945589567 2:211713527-211713549 ACATTTGCCCAAAAGGTGAGTGG - Exonic
946271235 2:218596096-218596118 ACTTTGGCTCAGCAGGAAGGCGG - Exonic
948388051 2:237593840-237593862 ACACTGGCCAAGCAGGAGGCGGG - Intronic
1170000274 20:11607319-11607341 ACATTGGCCCAGAATGGGGTGGG + Intergenic
1171398797 20:24858315-24858337 ACAGTGCCCCACAAAGAGGGGGG + Intergenic
1173198778 20:40938458-40938480 ATGTTGGCCCAGGAGGAGTGGGG + Intergenic
1175921731 20:62453400-62453422 ACATTGGCCTGGAAGGATGATGG + Intergenic
1176886558 21:14263341-14263363 ACATTGACCAAGGAGGAGGCTGG + Intergenic
1178603453 21:34014924-34014946 CCAGTGGTTCAGAAGGAGGGAGG + Intergenic
1178946317 21:36950900-36950922 ACAAGGGCCCAGAAGGTGGAAGG - Intronic
1179001713 21:37467310-37467332 ACCTGGGCCCAGGAGGAGGAGGG - Intronic
1179585299 21:42370587-42370609 AAATTAACCCAGAAGGAGAGGGG + Intergenic
1179934478 21:44593310-44593332 AAATGGGCCCAGCAGGAGGCTGG - Intronic
1180851316 22:19023217-19023239 ACATGGGACCAGGGGGAGGGAGG - Intergenic
1181849820 22:25742100-25742122 ACATTGGCCCAGAAGGAGGGTGG + Intergenic
1182073448 22:27478906-27478928 ACAATGGACCAGGAGGAGGACGG + Intergenic
1182703010 22:32255608-32255630 AGATTTGCCCAGGTGGAGGGGGG + Intergenic
1183455819 22:37922513-37922535 ACAATGGCACAGATGGAGAGGGG - Intronic
1184149972 22:42632063-42632085 ACAGTGGCAGAGGAGGAGGGGGG + Intronic
1184486482 22:44783068-44783090 AGCCTGGCCCAGAGGGAGGGAGG - Intronic
1185374330 22:50475102-50475124 CCATTGGTCCAGAGGGTGGGAGG + Intergenic
949201906 3:1389689-1389711 ACATAGGCTCAAAAGGATGGAGG + Intronic
950181260 3:10915093-10915115 ACATTGCCACAGATGGAGCGTGG + Intronic
950831471 3:15879512-15879534 ATATTGGCCCAGATCAAGGGTGG + Intergenic
951619408 3:24584450-24584472 ACATGGGTCCAGGAGAAGGGAGG + Intergenic
952210186 3:31222472-31222494 ACTGTGGTGCAGAAGGAGGGAGG - Intergenic
953727726 3:45415167-45415189 ACTGTGGCCCAGCAGGAGTGAGG - Intronic
953831222 3:46299019-46299041 TCATTGGCCCAGATGGAGTTCGG + Intergenic
954152192 3:48663099-48663121 ACAGCGCCCTAGAAGGAGGGAGG - Intergenic
959225046 3:103569489-103569511 AAAATGGCCAAGAAGGAGGCAGG + Intergenic
960482550 3:118211479-118211501 ACGTTTGCCCAAAAGGAGGTGGG + Intergenic
961830683 3:129621568-129621590 ACAGTGGCACAGAAGGAGTGTGG - Intergenic
963246374 3:143067528-143067550 TCCTTGGCCCAGAAGGTAGGAGG - Intergenic
965360000 3:167727097-167727119 ACCATGGCCCAGAAGCAGGCTGG + Intronic
966223110 3:177570032-177570054 ACATTGACCCACAGGGAGAGGGG - Intergenic
966877075 3:184328566-184328588 ACGTTGCCCCAGAAGGAGAGTGG + Intronic
968782313 4:2592529-2592551 ACATTGGCCCACAGGCAGGCAGG + Intronic
970870638 4:20813090-20813112 TCATGTGCCCAGAAGGATGGAGG + Intronic
971298765 4:25424818-25424840 ACATTGGCCCAGAGCTAGGAAGG - Intergenic
972220222 4:36946887-36946909 ACATTGGGCAAGATGGAAGGTGG + Intergenic
975735647 4:77378428-77378450 TCAGAGCCCCAGAAGGAGGGAGG + Intronic
980257673 4:130403060-130403082 ACATTGGTACAGTAGGAGGTGGG + Intergenic
985267975 4:188167638-188167660 ACGATGGCCCAGGAGGAGAGAGG + Intergenic
985495727 5:204018-204040 CCACTTGTCCAGAAGGAGGGTGG - Exonic
985990310 5:3552364-3552386 ACATTGGGCCTGTTGGAGGGCGG + Intergenic
986495818 5:8340571-8340593 ACATTGGCAGAGAAGCATGGGGG - Intergenic
991314309 5:65282849-65282871 ACCTTGGCCAAGAAGGAAGGTGG + Intronic
991452556 5:66768371-66768393 ACATTGTCACAGGAGGAAGGAGG + Intronic
991475655 5:67016133-67016155 ACATCAGCCGAGGAGGAGGGAGG + Intronic
991515428 5:67429632-67429654 ACAATGCCCCAGAAGAAGAGAGG - Intergenic
992895347 5:81240403-81240425 ACAATGGCCCAGAGGAATGGGGG + Intronic
993048344 5:82894922-82894944 AAAATGGGCGAGAAGGAGGGGGG - Intergenic
995015764 5:107306906-107306928 ACGTTGGCAGAGATGGAGGGAGG + Intergenic
996115063 5:119609062-119609084 ACATGAGGCCAGAAGCAGGGCGG - Intronic
997551889 5:134760448-134760470 ACTTGGGCCCAGAAAGCGGGTGG + Intronic
997882538 5:137603220-137603242 ACATTACCCCAGAAAGATGGTGG + Intergenic
1000724877 5:164757458-164757480 ACATTGTCATAGAAGGAGGTAGG - Intergenic
1001124863 5:169010350-169010372 ACTATGGCCCAGACTGAGGGTGG + Intronic
1001142111 5:169153189-169153211 CCATTGGCCCAAATGGAGTGAGG - Intronic
1001419326 5:171574586-171574608 CCATTGGCCCTGCTGGAGGGAGG + Intergenic
1001681904 5:173564182-173564204 CCATTGGGCCAGAAGAATGGGGG - Intergenic
1005645970 6:27838719-27838741 ACAAAGGCCCAGAAGAAGGACGG + Exonic
1006083391 6:31580356-31580378 CCATTAGCCCAGTTGGAGGGTGG - Intergenic
1006481897 6:34301858-34301880 ATATTGACCCAGAAGTGGGGAGG - Intronic
1008947370 6:57113145-57113167 ACATTGGGCCTGAATGAGGGAGG - Intronic
1011365003 6:86571838-86571860 ACATAGGCTCAAAAGGATGGAGG + Intergenic
1012672246 6:102068741-102068763 ACATTCACTCAGAAGAAGGGAGG - Exonic
1013839143 6:114369439-114369461 ACATAGGCACACAAGGTGGGAGG + Intergenic
1015013548 6:128381561-128381583 ACCTTGGGCCAGAGGGAAGGAGG + Intronic
1015696148 6:135982109-135982131 ACATGGACCTAGAAAGAGGGGGG - Intronic
1016056249 6:139580498-139580520 AACTTGAACCAGAAGGAGGGTGG - Intergenic
1017879263 6:158548411-158548433 AACATGGGCCAGAAGGAGGGTGG + Intronic
1018060459 6:160085961-160085983 ACACTGCCCCAGAAGGGGGAAGG + Intronic
1019215120 6:170438563-170438585 ACACGGGCACAGATGGAGGGTGG - Intergenic
1019453477 7:1112211-1112233 TCTTTGGCCCAGAATGAGGATGG + Intronic
1019585011 7:1795796-1795818 ACATTGGCCCAGAGTGATGCTGG + Intergenic
1019739905 7:2667515-2667537 ACATTGAACCAGAGGGAGGTGGG + Intergenic
1021909770 7:25373091-25373113 ACATTGGTGCAGTAGGAGAGAGG + Intergenic
1022184801 7:27956699-27956721 ACCATGGCCCAAAAGGAGGATGG + Intronic
1022555102 7:31286069-31286091 ACATAGGCCAGGATGGAGGGAGG - Intergenic
1022563583 7:31374383-31374405 ACAGTGGCCCCGGTGGAGGGAGG - Intergenic
1023442898 7:40202888-40202910 CCAATGGCCAAGGAGGAGGGAGG - Intronic
1023967631 7:44971117-44971139 ACTTTGGACAAGAAGGAGGAAGG + Intronic
1026869550 7:73842121-73842143 AGCATGGCCCAGGAGGAGGGTGG - Exonic
1027768563 7:82377513-82377535 ACCTTGACCCAGAAAGAAGGAGG - Intronic
1029530544 7:101122396-101122418 AGATCGGGCCAGAAGGCGGGAGG + Intergenic
1029603912 7:101586902-101586924 ACCTTGGCCCCCCAGGAGGGTGG - Intergenic
1030696122 7:112587709-112587731 ACATAGCCCCAGGAAGAGGGCGG + Intergenic
1034338642 7:150338879-150338901 AGCTTGGCCAAGCAGGAGGGAGG - Intronic
1034455634 7:151168211-151168233 ACTTGGGGCCCGAAGGAGGGCGG - Intronic
1036779442 8:11635356-11635378 GGATTGGCCCGGAAGCAGGGAGG + Intergenic
1038520639 8:28229483-28229505 ACATTGCCCCAAAAGGAAAGAGG + Intergenic
1039454938 8:37699902-37699924 GCATCAGACCAGAAGGAGGGAGG - Exonic
1040293113 8:46135585-46135607 ACATTGACGCAGACAGAGGGAGG - Intergenic
1040643157 8:49364756-49364778 ACATTGGAACAGAAGTAAGGTGG - Intergenic
1045057845 8:98384731-98384753 ACATGGGGCCAGCAGGAGGGTGG - Intergenic
1045510312 8:102807942-102807964 ACAGTGGCCCAGGAGGACCGAGG + Intergenic
1046405122 8:113763302-113763324 ACATTGCACCAGATGGAGTGGGG + Intergenic
1048017001 8:130506600-130506622 TCAGAGGCACAGAAGGAGGGGGG + Intergenic
1048123053 8:131603283-131603305 AAATTGACCCAGAAGAAGGCAGG + Intergenic
1049572796 8:143377558-143377580 ACTGAGGCCCAGAGGGAGGGAGG + Intronic
1053416996 9:37953112-37953134 CCAGAGGCCCAGAAGGAGAGTGG + Intronic
1055943148 9:81669329-81669351 CGAGTGGCCCAGAAGGAGGGAGG - Intronic
1057216918 9:93234251-93234273 ACAGTGTCCCTGAATGAGGGTGG - Intronic
1057218558 9:93243304-93243326 ACAATGACCCTGCAGGAGGGCGG - Intronic
1058383589 9:104407254-104407276 ACATTTGGCCAGAAGTAGAGGGG + Intergenic
1058444008 9:105037947-105037969 AAATTGGACCAGTAGGAGGAAGG - Intergenic
1058608612 9:106750896-106750918 ATATTTGCCCAGAAGAGGGGTGG - Intergenic
1060381781 9:123181969-123181991 ACTTTGGCTCACGAGGAGGGTGG + Intronic
1060717891 9:125951297-125951319 ACAATAGCCCAGCAGGAGTGTGG + Intronic
1060903227 9:127280321-127280343 ACACTGGGCAAGAAGTAGGGAGG - Intronic
1061779024 9:132984941-132984963 GCCTTGGCCCAGGAGCAGGGTGG - Intronic
1062221259 9:135416921-135416943 CCATTTGGCCAGCAGGAGGGAGG + Intergenic
1062521026 9:136958022-136958044 ACCGTGGCCCAGTAGGAGGAGGG - Intergenic
1186131531 X:6471265-6471287 ACATTCTCCCAAAAGGAAGGAGG - Intergenic
1186926021 X:14334459-14334481 ACACAAGGCCAGAAGGAGGGAGG - Intergenic
1188460147 X:30416125-30416147 ACAGTGGCCCAAATGGAGGATGG + Intergenic
1190266028 X:48827466-48827488 GCGTTGGCCCAGAAGGAGCGGGG - Intergenic
1192235687 X:69294165-69294187 GCAAAGGCCCAGAGGGAGGGAGG + Intergenic
1194891521 X:99384919-99384941 ACTTTGGCACAGAGGGAGGCTGG - Intergenic
1195652245 X:107297207-107297229 ACATTGGCTCTGTAGGGGGGAGG + Intergenic
1196042652 X:111222214-111222236 ACCTTGGCAAAGAAGGAGAGAGG - Intronic
1197907819 X:131445081-131445103 ACATTGGGCCTATAGGAGGGTGG + Intergenic
1198963417 X:142205063-142205085 AAATGGCCCCAGAAGAAGGGAGG - Intronic