ID: 1181849952

View in Genome Browser
Species Human (GRCh38)
Location 22:25742938-25742960
Sequence GGTCCCAGTGGCCCCATAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181849947_1181849952 17 Left 1181849947 22:25742898-25742920 CCCGGATAGCAGGCATTTCTCTG 0: 1
1: 0
2: 1
3: 22
4: 198
Right 1181849952 22:25742938-25742960 GGTCCCAGTGGCCCCATAGTGGG 0: 1
1: 0
2: 0
3: 13
4: 109
1181849948_1181849952 16 Left 1181849948 22:25742899-25742921 CCGGATAGCAGGCATTTCTCTGA 0: 1
1: 0
2: 2
3: 27
4: 211
Right 1181849952 22:25742938-25742960 GGTCCCAGTGGCCCCATAGTGGG 0: 1
1: 0
2: 0
3: 13
4: 109
1181849946_1181849952 18 Left 1181849946 22:25742897-25742919 CCCCGGATAGCAGGCATTTCTCT 0: 1
1: 0
2: 1
3: 7
4: 94
Right 1181849952 22:25742938-25742960 GGTCCCAGTGGCCCCATAGTGGG 0: 1
1: 0
2: 0
3: 13
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181849952 Original CRISPR GGTCCCAGTGGCCCCATAGT GGG Intronic
900056479 1:634705-634727 GGGGCCAGTGTCCCCCTAGTTGG - Intergenic
901973867 1:12929418-12929440 GGGCACAGTGGCCCCATAGCTGG - Intronic
902011311 1:13272350-13272372 GGGCACAGTGGCCCCATAGCTGG + Intergenic
906210530 1:44010313-44010335 GGTCCCAGAGCCTCCATACTTGG + Intronic
909540330 1:76784220-76784242 GATCCCAGAGGTCCCATAGCAGG - Intergenic
916326092 1:163561665-163561687 GGCCCCAGTGTCCCCCTATTCGG + Intergenic
918243572 1:182640633-182640655 GGTCCCAATGGGCCCACTGTGGG + Intergenic
918368396 1:183834173-183834195 GCTTCCAGCAGCCCCATAGTAGG + Intronic
922195913 1:223360421-223360443 GGTCTCAGTGGCCCCAAATGAGG + Intronic
922776209 1:228215267-228215289 GCTCCCAGGGGCCCTGTAGTGGG - Intronic
1066623503 10:37382375-37382397 GCTCCCAGGGACCCCAGAGTGGG + Intronic
1068077086 10:52269885-52269907 GCTCCCAGTGGCTCCAGAGGAGG - Intronic
1073434321 10:103507080-103507102 GGTCCCCTTGGCCCCAGAGTGGG + Intronic
1077014582 11:393988-394010 GGTCCCCGTGGCCCTGTTGTGGG + Intronic
1080404214 11:31964498-31964520 TGTCCCTGTGGCCCCATCATAGG + Intronic
1081582432 11:44361341-44361363 CCTCCCAGCGGCCCCGTAGTGGG + Intergenic
1081672320 11:44949323-44949345 GGTCCAAGGGACCACATAGTTGG + Intronic
1084480265 11:69415948-69415970 GGTCCCTGAGGTCCCATAGAGGG + Intergenic
1084679278 11:70656638-70656660 GATCACAGTGGCCCCATGGATGG - Intronic
1084788302 11:71456924-71456946 GGGCCCAGTGGCCCTAGAGCAGG + Intronic
1086869017 11:92014941-92014963 GGTGCCAGTGGGCCCCTACTGGG + Intergenic
1087800155 11:102495140-102495162 GGTCACAGCAGCCCCTTAGTCGG + Intronic
1091074947 11:132606654-132606676 GGTCCCATTGGCCCAGAAGTGGG - Intronic
1091645317 12:2268541-2268563 GGTCACATTCGCCCCATGGTGGG + Intronic
1096558519 12:52419038-52419060 GCTCCCAGTGGCCTCATACAAGG - Intergenic
1097127400 12:56785516-56785538 GGTCCCAGTGGTCTCATGGTTGG + Intronic
1102046044 12:109831010-109831032 GGTCCCTGTGGCTGCAGAGTGGG - Intronic
1102572871 12:113838194-113838216 AGTCTCAGTGGTCCCAGAGTGGG - Intronic
1102682647 12:114700884-114700906 GGTCCCAGTCTCCCCTAAGTGGG + Intergenic
1103060023 12:117851156-117851178 GGTCCCAGTGGCCCTAAGGCTGG + Intronic
1105303007 13:19152034-19152056 GGCCCCGGTGGCCCCAGAGGCGG - Intergenic
1110370812 13:74737960-74737982 AGTCCCAATGGCCTCATTGTTGG - Intergenic
1110909588 13:80939842-80939864 GGTCCCAGTGGACCAATTTTGGG + Intergenic
1113901464 13:113800594-113800616 GGTCCCAGAGGCCGGATAATCGG - Intronic
1123032529 14:105458657-105458679 GCTCCCAGTGGCCCAGGAGTGGG - Intronic
1124170301 15:27366947-27366969 GGTCCCGATGCCCCCATAGTAGG - Intronic
1129321183 15:74775853-74775875 GTTCCCAGTGGCCTCTCAGTTGG + Intergenic
1130302796 15:82692702-82692724 GGTCCCAGAGACTCCATAGATGG + Intronic
1133717409 16:8463192-8463214 GGGTCCAGTGGTCCCAGAGTTGG - Intergenic
1136694061 16:32060742-32060764 GGTCCATGTGGCAGCATAGTTGG - Intergenic
1136794557 16:33004006-33004028 GGTCCATGTGGCAGCATAGTTGG - Intergenic
1136875351 16:33850386-33850408 GGTCCATGTGGCAGCATAGTTGG + Intergenic
1141686251 16:85571618-85571640 GGTCCCTGTGGCCCCAAACACGG - Intergenic
1141895281 16:86955269-86955291 GGTGCCAGAGGCCCCACAGCTGG + Intergenic
1203096819 16_KI270728v1_random:1265656-1265678 GGTCCATGTGGCAGCATAGTTGG - Intergenic
1146534623 17:33639496-33639518 GCTCCCAGGGACCCCAGAGTGGG - Intronic
1150170134 17:62986236-62986258 GGTCCCTGTGTGCACATAGTGGG + Intergenic
1151934604 17:77254313-77254335 GTTCCCAGTGGCCCCGTTGTGGG - Intergenic
1152460882 17:80441773-80441795 GGCCCCAGTGGCCCCAGCGAAGG + Intergenic
1155025956 18:21941116-21941138 GGTCCCACTGGCTAAATAGTAGG + Intergenic
1155668652 18:28342826-28342848 GGTTCCAGATGCCCCATACTGGG - Intergenic
1157187542 18:45553304-45553326 TGTCACTGTGGCCCCAAAGTAGG + Intronic
1160961788 19:1725456-1725478 GGCCGCAGGGGCCCCACAGTCGG - Intergenic
1162643959 19:12035375-12035397 GGTCCCCTTGGCCCCACAGTGGG - Intronic
1164671877 19:30076945-30076967 GATCCCAGTGGCCTCTTTGTTGG + Intergenic
1165509216 19:36256585-36256607 GGTCTCTGTGGCCCCGTGGTCGG + Intergenic
1168614785 19:57828885-57828907 GGTCCCAGCTGCCCCAAGGTTGG - Intronic
927179808 2:20436951-20436973 GGTTCAAATGGCCCCAGAGTTGG + Intergenic
932416755 2:71578275-71578297 GCTCCCATTGGCCCCCTACTTGG + Intronic
932672690 2:73752137-73752159 GGACCCACTGGTCCCTTAGTAGG + Intergenic
936239993 2:110779274-110779296 GGTTCCAGGGGCCACATAGTAGG - Intronic
936452166 2:112641888-112641910 GGCCCCAGTTTCCCCAGAGTAGG - Intergenic
937261396 2:120588622-120588644 GGTTCAAGTGGCCCCATCCTGGG + Intergenic
943179744 2:184527418-184527440 GGTGCCACTGACCCCATATTGGG - Intergenic
945996027 2:216436788-216436810 TTTCCCAGTGGCCCCTGAGTAGG + Intronic
948364499 2:237446008-237446030 AGGCCCAATGGCCCCATAGCAGG + Intergenic
948496032 2:238350558-238350580 TGGCCCAGTGTCCCCAAAGTAGG - Intronic
1169371978 20:5034941-5034963 GGCCCCCATGGCCCCATGGTAGG - Intergenic
1172701765 20:36857722-36857744 GGACCCAGTGGCCACGTAGTAGG - Intronic
1173154121 20:40593550-40593572 GATCCCAGTGGCCTCAGAGAGGG - Intergenic
1173658703 20:44718459-44718481 GCTTCCAGTGGCCCCATCTTTGG - Intronic
1177727592 21:24989475-24989497 GGTCCCAGTTGCCCCAGATGAGG + Intergenic
1181620637 22:24088972-24088994 TGTTGCAGTGGCCCCAGAGTTGG + Intronic
1181849952 22:25742938-25742960 GGTCCCAGTGGCCCCATAGTGGG + Intronic
1185014607 22:48335632-48335654 GGTCCCTGTGTCCCCACTGTGGG + Intergenic
1185399570 22:50608797-50608819 TGTCCCAGTGACCCCAGAGCTGG - Intronic
950197882 3:11022056-11022078 TGGCCCAGTGGCCTCCTAGTGGG - Intronic
960560062 3:119073692-119073714 GGGCTCAGTGGCCCCACACTTGG - Intronic
960575859 3:119228742-119228764 CTTCCCAGAGGCCCCACAGTGGG - Intronic
962927090 3:140004933-140004955 GGTCCCAGTGGACCAATAGAAGG - Intronic
965114934 3:164477276-164477298 GCTCCCACTGGCTCCATAGAGGG - Intergenic
965139238 3:164814320-164814342 GGGCTCAGTGGCCCCACACTCGG + Intergenic
965661191 3:171043865-171043887 GGTACCTGTAGCCCCACAGTGGG - Intergenic
966863216 3:184241969-184241991 GGTCCCAGTGGCGCAGTAGCAGG - Exonic
968771895 4:2512813-2512835 AGTCCCAGTGGCCCCAGACAGGG + Intronic
969792705 4:9503121-9503143 GCTCCCAGGGGCCCCCTTGTAGG - Intergenic
985759366 5:1737276-1737298 GGTCCCAGGGACCCCCTAGTGGG + Intergenic
985760797 5:1747565-1747587 GGTGCCAGTGGCCCCAGAACAGG - Intergenic
985973472 5:3395149-3395171 GGACCCAGCGGCCCCATGGCGGG + Intergenic
986345523 5:6831702-6831724 GGTCCCAGTGCCCAGATATTTGG + Intergenic
992803005 5:80310274-80310296 GGACTCAGTGGCCCCACACTTGG - Intergenic
993592811 5:89815821-89815843 ATTTCCAGTGGCCCCATATTAGG - Intergenic
995269861 5:110207867-110207889 AGTCCCAGTGGGCCCCTAGAGGG - Intergenic
1001965542 5:175907521-175907543 GGTGCCAGTGACCCCACATTGGG - Intergenic
1005859922 6:29892443-29892465 GAACCCAGTGGTCCCACAGTGGG - Intergenic
1005874411 6:30000149-30000171 TGGCCCAGTGGTCCCATTGTGGG - Intergenic
1006003645 6:30986312-30986334 GGTCACACTGGACCCAGAGTTGG - Exonic
1006003870 6:30987482-30987504 GGTCACACTGGACCCAGAGTTGG - Exonic
1006588946 6:35140708-35140730 AGTCCCTGTGGCCCCCTAGGGGG - Intronic
1007349128 6:41255879-41255901 GGTCCCAGTAGCCACAGATTTGG - Intergenic
1007581595 6:42963268-42963290 GGGTCCAGTGGCCCCAAGGTGGG + Intronic
1008763190 6:54879043-54879065 GGTGTCAGAGGCCCCAAAGTTGG + Intronic
1016387971 6:143547332-143547354 AGTAACAGTGGCCACATAGTAGG + Intronic
1020417630 7:7964217-7964239 GGTGCCACTGGCATCATAGTTGG + Intronic
1023967307 7:44969671-44969693 TGTCCCAGTGCCACCACAGTGGG - Intronic
1024085970 7:45891810-45891832 GGTCCCCGTGGCCAGATCGTAGG + Intronic
1025261853 7:57425327-57425349 GCTCCCCGTGGCCCCAAAGTCGG - Intergenic
1035202417 7:157276103-157276125 GGTCCCAGGGGCCCCTGAGTAGG - Intergenic
1035240033 7:157523526-157523548 GGTCCCTGTGGCCACATGGCTGG + Intergenic
1039380941 8:37084735-37084757 GGTCCCAGTGGCTCAGTGGTTGG + Intergenic
1039858622 8:41437588-41437610 GGGCCCAGTGTGCCCAGAGTTGG - Intergenic
1042226593 8:66519601-66519623 GATCCCACTGCCCCCATTGTGGG + Intergenic
1042940462 8:74101931-74101953 GAATCCAGTGGCCCCACAGTGGG + Intergenic
1043542479 8:81279985-81280007 GGTCTCCCTGGCCCAATAGTGGG - Intergenic
1049247614 8:141571222-141571244 GGTCCCAGGGGCTCCCCAGTGGG + Intergenic
1051934798 9:22433924-22433946 GGGCTCAGTGGCCCCACACTTGG + Intergenic
1061303312 9:129718599-129718621 GGTCCCAGTGGAGTCATTGTTGG - Intronic
1061520452 9:131114499-131114521 GGACCCAGTGGCTCCCTTGTGGG - Intronic
1062446330 9:136596908-136596930 GGTCCCAGTGGGCCCCCAGGAGG + Intergenic
1190000394 X:46680948-46680970 GGGCCCAGTGTCCTCATATTGGG - Intronic
1190289233 X:48981345-48981367 AGGCCCAGTGGGCCCATAGGAGG + Intronic
1192555119 X:72083040-72083062 GGTCCCAGCTTCCCCAGAGTGGG + Intergenic
1198558591 X:137823906-137823928 GGCTCCAGTGGCCCAACAGTGGG + Intergenic