ID: 1181850734

View in Genome Browser
Species Human (GRCh38)
Location 22:25748224-25748246
Sequence TCCCCAGGACAGTCACACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 1, 2: 4, 3: 21, 4: 240}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181850734_1181850737 -5 Left 1181850734 22:25748224-25748246 CCACTGTGTGACTGTCCTGGGGA 0: 1
1: 1
2: 4
3: 21
4: 240
Right 1181850737 22:25748242-25748264 GGGGAGGTAGCTCTCTGAGAAGG 0: 1
1: 0
2: 0
3: 8
4: 171
1181850734_1181850738 24 Left 1181850734 22:25748224-25748246 CCACTGTGTGACTGTCCTGGGGA 0: 1
1: 1
2: 4
3: 21
4: 240
Right 1181850738 22:25748271-25748293 AAGCATCAGACTTTACTCATTGG 0: 1
1: 0
2: 1
3: 12
4: 130
1181850734_1181850739 25 Left 1181850734 22:25748224-25748246 CCACTGTGTGACTGTCCTGGGGA 0: 1
1: 1
2: 4
3: 21
4: 240
Right 1181850739 22:25748272-25748294 AGCATCAGACTTTACTCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181850734 Original CRISPR TCCCCAGGACAGTCACACAG TGG (reversed) Intronic
900312065 1:2038453-2038475 TCACCAGGACAGTGACAACGAGG - Intergenic
901650560 1:10740508-10740530 TCCCCAGGGCAGCCACACCATGG + Intronic
902212108 1:14911727-14911749 TCCCTAGGACAGTTTCCCAGTGG + Intronic
903358680 1:22763459-22763481 TCTCCTGGACAGGCACACGGTGG + Intronic
904401193 1:30257836-30257858 CCCCCAGGACTGTGACAGAGAGG + Intergenic
905390863 1:37634631-37634653 CGCCCAGGACAGTCCCGCAGCGG - Exonic
906273124 1:44497025-44497047 TCCCTAGGCCAGTGTCACAGAGG - Intronic
908439675 1:64141414-64141436 TCCCAAGGACAGTACCACGGGGG + Intronic
909980325 1:82092095-82092117 TCCCCAGCACATTGACACAAAGG + Intergenic
911242316 1:95479670-95479692 TCCCCAGTACCCTCTCACAGGGG + Intergenic
911373798 1:97025411-97025433 TCCCAAGGCCAGTAACACTGTGG - Intergenic
913053054 1:115133691-115133713 TCCCCAGGGCATTCACACACTGG - Intergenic
917675294 1:177313025-177313047 TTCCCAGGACTGTCACTCATTGG - Intergenic
918001934 1:180505574-180505596 CCCCAAGGCCAGGCACACAGTGG + Intergenic
918436544 1:184519597-184519619 TACCCAGAACAATAACACAGTGG + Intronic
918905909 1:190493342-190493364 TCTCCAATACAGTCACACTGGGG + Intergenic
920061824 1:203232216-203232238 CCACCAGGACAGACAAACAGAGG + Intronic
921232273 1:213084977-213084999 GCCCCAGGAAACTAACACAGTGG - Intronic
921634709 1:217478081-217478103 TCCCAAGAACAGTAACACTGTGG - Intronic
923794722 1:237142702-237142724 GCTCCAGGTCAGACACACAGAGG + Intronic
1062948450 10:1477983-1478005 ACCCAAGCACAGGCACACAGTGG - Intronic
1063448308 10:6134219-6134241 AGCCCAGGACAGTGTCACAGGGG - Intergenic
1065780903 10:29166025-29166047 TCTCCAGTACAGTCACATGGGGG + Intergenic
1066639819 10:37544605-37544627 TCCACAGGACACCAACACAGGGG - Intergenic
1067812925 10:49444342-49444364 TCAACAGGACAGGCAAACAGGGG + Intergenic
1070533933 10:77361430-77361452 ACCCCAGGCCAGTGGCACAGAGG - Intronic
1070811493 10:79300417-79300439 TCCCCAGGACAGAGACAGAGGGG - Intronic
1071205520 10:83271712-83271734 TCCCCAAGACATTAACAGAGAGG - Intergenic
1072042103 10:91617322-91617344 TGCCCAGCTCACTCACACAGTGG + Intergenic
1072620962 10:97078949-97078971 TTCCCAGGCCAGACACACAATGG + Intronic
1073905365 10:108273944-108273966 TCCCAAGGCCAGTAACACTGTGG + Intergenic
1074225654 10:111481631-111481653 TCACCAGGTGAGTCACCCAGGGG + Intergenic
1074370395 10:112896014-112896036 TCCCCAAGACAAGCACAGAGAGG - Intergenic
1076407502 10:130222476-130222498 TCCACGGCACTGTCACACAGTGG - Intergenic
1076593698 10:131610202-131610224 TCCCCAGCACATGCACACAAGGG - Intergenic
1076979983 11:199114-199136 TTCCCAGGACTGGCACACACTGG + Intronic
1077255803 11:1582198-1582220 ACTCCAGGAAAGCCACACAGAGG - Intergenic
1077497009 11:2891289-2891311 TCCACAGGACACAGACACAGGGG + Intronic
1077898115 11:6469253-6469275 TCTCCCAGACTGTCACACAGGGG + Intronic
1078532101 11:12144549-12144571 TCCCCGAGACTGTCCCACAGAGG + Intronic
1079139383 11:17797917-17797939 CCCCCAGGACAGTCCCACAGTGG + Intronic
1080634688 11:34113405-34113427 TTCCCAGGATACACACACAGGGG - Intronic
1080657390 11:34268606-34268628 GCCCCAGGAAACTCACGCAGTGG - Intronic
1080781579 11:35434607-35434629 TCCCCAGGTCAGTAACACAGTGG + Exonic
1082729281 11:56775280-56775302 TCCACAGGACTGTCACTCAGAGG - Intergenic
1083014887 11:59443255-59443277 TGCCCAGGAAGGTCACAAAGAGG - Exonic
1083050421 11:59771553-59771575 TGCCCAGGTCAGGCATACAGAGG + Intronic
1083526595 11:63372065-63372087 TTCCCAGGACAGTATCACAGAGG - Intronic
1083621250 11:64050416-64050438 TCCCCACCACTGTCACACTGAGG - Intronic
1084673738 11:70622417-70622439 AGCCCAGGACACTCGCACAGAGG - Intronic
1085260675 11:75203015-75203037 GCCCCAGGCCTGGCACACAGTGG - Intronic
1088279493 11:108121791-108121813 GCCCCAGGACAGTCACGCGACGG + Intronic
1089014903 11:115157758-115157780 TTCCCAGGACAGAAGCACAGAGG - Intergenic
1089695151 11:120212004-120212026 TCCCCAGAAAAGTGAAACAGAGG - Intronic
1091400788 12:179443-179465 GCCCCAGGACACTCGCAGAGAGG + Intergenic
1095823673 12:46508755-46508777 GCCACATGACAGTCACATAGAGG + Intergenic
1098382016 12:69879434-69879456 TACCCAGGGCTGTGACACAGAGG - Intronic
1098654705 12:73013429-73013451 TCCACAGGAAAGTGACATAGAGG - Intergenic
1102063359 12:109952256-109952278 CCCCCAGGACACACCCACAGAGG - Intronic
1102886887 12:116528911-116528933 TCCCAAGGACAGGGAAACAGAGG - Intergenic
1104376404 12:128267824-128267846 GCCCCAGCACAGTCACCCTGTGG + Intronic
1108066797 13:46586291-46586313 TGCCCAGGAAGGTCTCACAGAGG + Intronic
1108080552 13:46730455-46730477 TCCCCAGGAGAGCCTCACAGTGG + Intronic
1108809983 13:54210925-54210947 TCCCCAGCAAAGTCACCCTGGGG - Intergenic
1110529578 13:76580551-76580573 TCCCAAGAACAGTCAAACACAGG + Intergenic
1111386695 13:87537552-87537574 TCACAAAGACAGTCACACATGGG - Intergenic
1113190931 13:107744917-107744939 TCACCGTGACTGTCACACAGTGG + Intronic
1113619013 13:111700577-111700599 ACCCCAAGACAGCCCCACAGTGG - Intergenic
1113624542 13:111785838-111785860 ACCCCAAGACAGCCCCACAGTGG - Intergenic
1113635601 13:111916983-111917005 GACCCAGGACAGTCTCAAAGTGG - Intergenic
1113815942 13:113171273-113171295 TCTCCAGGCCAGTCAAACATTGG - Intronic
1114345548 14:21790660-21790682 TCCCCAGGACAGTCTCATAGAGG + Intergenic
1115936730 14:38560822-38560844 TCACAAGGACAGTACCACAGGGG + Intergenic
1116034981 14:39616810-39616832 TCCCCACTGCAGTCACAAAGAGG - Intergenic
1118319373 14:64744063-64744085 TCCCCAGGAGACTCAGGCAGTGG + Exonic
1118786233 14:69047573-69047595 TCCCCAGGAGGGACACATAGAGG + Intergenic
1121678823 14:95776022-95776044 TCGCGAGGACAGTACCACAGGGG + Intergenic
1122641554 14:103162829-103162851 TCCCCAGGAGCTTCACACAAAGG + Intergenic
1122825864 14:104370168-104370190 TCCCCATGAGAGACACACAGGGG + Intergenic
1202854464 14_GL000225v1_random:42240-42262 TTGCCAGGACAGTCTCACACAGG - Intergenic
1126790758 15:52219007-52219029 TCCCCAGGCTGGTCACAAAGGGG - Intronic
1127862253 15:63004090-63004112 TCACCTGTGCAGTCACACAGCGG - Intergenic
1128259275 15:66221232-66221254 TCCCAAGGAGAGTCGCAGAGAGG - Intronic
1128536385 15:68493751-68493773 TCCCCAGGACCTAGACACAGTGG - Intergenic
1129869234 15:78930141-78930163 TCCCCAGGGCCTACACACAGCGG + Intronic
1132425098 15:101709458-101709480 ACACCAGGACAGTCCCACAGAGG + Intronic
1134015889 16:10888067-10888089 TCCCCTGGTCACTCTCACAGAGG + Intronic
1136411575 16:30080831-30080853 TGCCCAGGGCAGGCCCACAGTGG - Intronic
1138519930 16:57565189-57565211 TCAACAGGAGAGTCACAGAGGGG - Intronic
1139206952 16:65038156-65038178 TCCCGAATGCAGTCACACAGTGG + Intronic
1139873686 16:70128050-70128072 TCCCCAGTATAGCCAAACAGTGG - Intronic
1140362090 16:74353092-74353114 TCCCCAGTATAGCCAAACAGTGG + Intergenic
1141409310 16:83821692-83821714 GCCCCAGGACAGTCACACACAGG - Intergenic
1141870893 16:86784751-86784773 GCCCCGGGACACTCACACACAGG + Intergenic
1142113986 16:88346960-88346982 TTCCCAGGAGAGGCACACTGAGG + Intergenic
1142134354 16:88444796-88444818 GCCCCAGGACAGCCACGCTGAGG + Intergenic
1143743947 17:8975919-8975941 TCCCCAGGTCTGTCTTACAGTGG - Intergenic
1144276053 17:13668682-13668704 TCCCAAGGACAGGCACACTCAGG + Intergenic
1144703604 17:17353629-17353651 GCGCCAGGCCAGTCACACGGTGG - Intergenic
1145061842 17:19738673-19738695 TCCCCAGGGCATCCACACTGTGG + Intronic
1146423336 17:32711062-32711084 TCCCAAGGACATCCTCACAGAGG + Intronic
1146577987 17:34011684-34011706 TCTCCAGCAAAGTCACAAAGGGG + Intronic
1150613994 17:66754936-66754958 TCTACAGAACAGTCACACTGGGG + Intronic
1151954342 17:77373150-77373172 TGCCCAGGACTGTCCCCCAGCGG + Intronic
1151994873 17:77602245-77602267 CCTCCAGGGCAGCCACACAGAGG - Intergenic
1152294290 17:79457601-79457623 TCCCCAGGACAGTGGCAGTGTGG + Intronic
1152418768 17:80180508-80180530 GGCCCAGGACAGTGACACAGAGG - Intronic
1152854906 17:82659168-82659190 GCCCCGGGACACTCATACAGTGG + Intronic
1153315582 18:3718387-3718409 TCACATGGACAGTCACAAAGGGG - Intronic
1156801427 18:41119382-41119404 TCCCCAGAACACTCACACATAGG + Intergenic
1158427532 18:57353037-57353059 TCCCGAGGGCACTAACACAGAGG - Intronic
1160225004 18:77005690-77005712 GCCCCAGCACAGAAACACAGAGG + Intronic
1160508670 18:79441297-79441319 TACCCAGTCCAGACACACAGGGG - Intronic
1160578932 18:79872907-79872929 TCCCCACGGCCGCCACACAGGGG - Intronic
1161953827 19:7482172-7482194 TCCCTAGGACGGAGACACAGCGG + Exonic
1162214056 19:9117604-9117626 TCCACAGAACAGACACAGAGAGG - Intergenic
1163642702 19:18470492-18470514 TCCCCAGGACATTCTCTCAGGGG - Intronic
1166050276 19:40255124-40255146 TCTCAAGGGCAGCCACACAGAGG + Intronic
1168640551 19:58028847-58028869 TCCCCTGGACAGTCAAAGCGGGG + Intergenic
1168684528 19:58340117-58340139 TCCCCTGGAGAGTGATACAGGGG - Exonic
925628252 2:5863370-5863392 TCCCCTGGTAAGTCACCCAGCGG - Intergenic
925745087 2:7037120-7037142 TCCACAGCACACACACACAGTGG + Intronic
926730768 2:16034064-16034086 TTACCAGGCCACTCACACAGAGG + Intergenic
927179025 2:20430887-20430909 TGCCCAGGACAGACCAACAGAGG + Intergenic
927207758 2:20620872-20620894 CCCCCAGCCCAGTCAGACAGGGG + Intronic
927666433 2:25036113-25036135 TCCTAACGACTGTCACACAGCGG - Intergenic
928447965 2:31349834-31349856 TCCCAAGGAGAGAGACACAGAGG + Intronic
929779871 2:44950716-44950738 TCACCATGACAAACACACAGAGG + Intergenic
929963171 2:46511552-46511574 CAACCAGCACAGTCACACAGGGG - Intronic
932900850 2:75698028-75698050 GCCACAGGAAAGTAACACAGTGG + Intronic
934491649 2:94765245-94765267 TCCCCAGGAAAATAACACAAAGG + Intergenic
936260845 2:110958755-110958777 TCCCCTGGACAATGCCACAGAGG + Intronic
937042522 2:118833485-118833507 TCCCCAGGGAAGCCACGCAGGGG + Intergenic
937117127 2:119415748-119415770 TCTCCAGCACACACACACAGAGG + Intergenic
938161154 2:128985619-128985641 TTCCCAGGACAGAAACACAGTGG - Intergenic
940176646 2:150884960-150884982 TGCCCAGGATAGTCACAGAGTGG + Intergenic
941625616 2:167827408-167827430 GCCCAAGGGCAGTAACACAGTGG - Intergenic
942053095 2:172158808-172158830 TGCCCAGGACAGACAGACATGGG + Intergenic
943625750 2:190197569-190197591 GCCCCAGGAGAGTCAGAGAGTGG - Intronic
944599155 2:201285515-201285537 TTCCCAGGTCAGTTACAAAGTGG + Intronic
946062990 2:216960952-216960974 TCCCCAGCACACAAACACAGAGG + Intergenic
946383243 2:219363955-219363977 TCCCCAGGCCAGCCCCAAAGGGG - Intergenic
948672344 2:239576533-239576555 TCCCCAGGTCACTCAGCCAGTGG + Intergenic
948675959 2:239596887-239596909 GCTCCAGGAAACTCACACAGAGG + Intergenic
948790008 2:240372239-240372261 CCCCCAGCCCAGGCACACAGCGG - Intergenic
1170631273 20:18068159-18068181 TCCCAAGGACAGACAAAGAGAGG + Intergenic
1170749626 20:19134004-19134026 TGCCCAGCACAGTCACCCACAGG + Intergenic
1171153007 20:22844397-22844419 GCCCTAGGAAAGTCATACAGAGG + Intergenic
1171202525 20:23253805-23253827 TCCCCACGACATAGACACAGTGG + Intergenic
1173038020 20:39431198-39431220 GCCACAGGACAGTCACACTCAGG - Intergenic
1174116840 20:48232038-48232060 TTATCAGGAAAGTCACACAGTGG + Intergenic
1175061865 20:56250796-56250818 CTCCCAAGAAAGTCACACAGTGG - Intergenic
1175162460 20:57019144-57019166 TGCACAGGACAGCCCCACAGCGG - Intergenic
1178702019 21:34841649-34841671 GCCCCAGGGCAGTGACACAGGGG - Intronic
1178718794 21:34990404-34990426 GCACCAGGAATGTCACACAGCGG - Intronic
1179249789 21:39663300-39663322 ACCCAAAGCCAGTCACACAGAGG - Exonic
1180859803 22:19071256-19071278 TCCCCAGCACAGGAACACACTGG + Intronic
1181310482 22:21942065-21942087 TCTCAGGGACAGGCACACAGGGG - Intronic
1181436674 22:22915112-22915134 AGCCCAGGACAGACAGACAGTGG + Intergenic
1181850734 22:25748224-25748246 TCCCCAGGACAGTCACACAGTGG - Intronic
1181982741 22:26777395-26777417 ACCCCAGGACAGGGTCACAGTGG + Intergenic
1182468395 22:30532179-30532201 TCCCATGGACAGACACAAAGAGG - Intronic
1182572189 22:31247895-31247917 TCCCCAGGACAGGCAGAGGGAGG + Intronic
1183160418 22:36109619-36109641 TCTACAGGACAGTCACAGAGAGG + Intergenic
1183574046 22:38675753-38675775 AACCCAGCACAGTGACACAGTGG + Intergenic
1184173298 22:42772136-42772158 TCGCCAATACAGTCACTCAGGGG - Intergenic
1184365709 22:44049867-44049889 TCCCCACCAGAGCCACACAGAGG - Intronic
1184610346 22:45599277-45599299 TCCCCAGGGCAGTCAAAAGGAGG - Intronic
1185053276 22:48564763-48564785 CCCCCAGGACATTCCCTCAGTGG - Intronic
1185170656 22:49291818-49291840 TCCTCATTACAGACACACAGAGG - Intergenic
1185251296 22:49802982-49803004 TTCCATGGACAGACACACAGTGG + Intronic
950675844 3:14554002-14554024 TCCCCAGGGCAGTCACATCTGGG - Intergenic
951300463 3:20990127-20990149 TCCACAGAAAAGTTACACAGTGG + Intergenic
952114072 3:30158463-30158485 TCCCCAGTGCTGTCTCACAGAGG - Intergenic
953198456 3:40755394-40755416 CCCCCAGGGCAGTCACCCAGGGG - Intergenic
955039747 3:55304324-55304346 TTCCCAGGACTGACACTCAGTGG + Intergenic
955700217 3:61674814-61674836 TAACCATGACACTCACACAGAGG - Intronic
960284724 3:115815000-115815022 TCCCCAGTTCATTCACCCAGAGG - Intronic
962883327 3:139599862-139599884 TCCTCAATCCAGTCACACAGAGG - Intronic
965781945 3:172295406-172295428 TCCACAGGAAAGTCCAACAGGGG - Exonic
968718060 4:2176773-2176795 ACCCCAGGAGATGCACACAGAGG + Intronic
969111462 4:4846938-4846960 TCCCCAGGAGAGTCCCAGGGAGG + Intergenic
970919530 4:21376746-21376768 TCCCAAGACCAGGCACACAGGGG + Intronic
971835741 4:31760695-31760717 TACCCAGGACAGGCACAATGTGG + Intergenic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
974158559 4:58106095-58106117 TCTCCAGAACAGACACACAGTGG - Intergenic
974471921 4:62329802-62329824 TCTCCAGGATATTCACACACTGG + Intergenic
975029668 4:69599930-69599952 TCCCCAGGACAGCAAATCAGAGG + Intronic
975853262 4:78595431-78595453 TGCCCAGGTCAGTAACAAAGCGG + Exonic
977782659 4:100996507-100996529 CCCCCAGGAAAGTCAAAAAGGGG + Intergenic
981886863 4:149686101-149686123 TCCCCAGGAAAGCCACAAATTGG + Intergenic
982658444 4:158177565-158177587 TCCCCAGGGCACACACACAAAGG + Intergenic
984150072 4:176118692-176118714 TTTCCAGGACAGTAGCACAGTGG + Intronic
984409873 4:179383488-179383510 TCCTCCTGACATTCACACAGCGG - Intergenic
985685270 5:1278745-1278767 CCCCCAGGACAGGCTCACGGAGG - Exonic
985766907 5:1784890-1784912 GCCCCAGGACAAGCCCACAGAGG + Intergenic
992467551 5:77021977-77021999 TTCCTAGGTCATTCACACAGAGG + Intergenic
992643742 5:78793182-78793204 GCCCTAGGACAGTCCCACACAGG + Intronic
994250697 5:97533362-97533384 TCCCCAAGACAGTCACACCCTGG - Intergenic
997717843 5:136055448-136055470 GCCCCAATAAAGTCACACAGAGG - Intronic
997737602 5:136225651-136225673 TCCCCAGGAAAGCCAGACAGTGG + Intronic
997776861 5:136616975-136616997 TCCCCAGGACTGACACAGATTGG - Intergenic
997837825 5:137210696-137210718 TCACCAGGCAAGGCACACAGGGG + Intronic
997859825 5:137406199-137406221 TCACCAGGACAGTCATACCTAGG + Intronic
997878026 5:137566260-137566282 CCTCCAGGACACCCACACAGAGG + Intronic
999264092 5:150255331-150255353 TGCCCAGGACAGTCAGAGAGGGG + Intronic
1002195844 5:177500900-177500922 TCCCCAGGGCCAGCACACAGTGG + Intergenic
1004526433 6:16412848-16412870 TCCCCAAGGCAGTCACTCTGGGG - Intronic
1005828587 6:29652105-29652127 TGACCAGGGCAGTCACACAAGGG + Intergenic
1006479555 6:34280796-34280818 TCCCCTGGGGAATCACACAGTGG - Exonic
1007073385 6:39051990-39052012 TCCCCAACACACACACACAGAGG - Intronic
1007369557 6:41417374-41417396 TCTCCAGGACCCTCAGACAGAGG + Intergenic
1007679671 6:43625530-43625552 TCCCCAGGACGGCCACACGGAGG + Exonic
1007779435 6:44244314-44244336 TCCCCAGGATCTCCACACAGTGG + Intergenic
1015971274 6:138744855-138744877 TCCCAAAGAAACTCACACAGAGG + Intergenic
1016354332 6:143201714-143201736 TCCCCAGGTCCGTAACAAAGAGG - Intronic
1016992423 6:149939107-149939129 TCCCAGGGACGGTCACACGGTGG - Intergenic
1017999854 6:159569475-159569497 TCCCCAGGTCAATCACACTTAGG + Intergenic
1018424347 6:163667152-163667174 TCCCCTGGGCAGGCACACAGTGG - Intergenic
1018707923 6:166476369-166476391 GCCCCAAGAAACTCACACAGAGG + Intronic
1019416771 7:931249-931271 TTCCAAGGACAGTCACAGAAGGG - Intronic
1019647777 7:2140215-2140237 TCCCCAGGCCAGTGTCCCAGAGG + Intronic
1019656465 7:2198705-2198727 TCCCTGGGAGAGTCACTCAGCGG - Intronic
1021482001 7:21128443-21128465 TCCCCAGCACACTTGCACAGGGG + Intergenic
1022804093 7:33804508-33804530 TACAAGGGACAGTCACACAGAGG - Intergenic
1024011086 7:45267351-45267373 TCCCCAGGGAAGGGACACAGGGG - Intergenic
1024731951 7:52262850-52262872 TCCCCAGCACTGTCATACTGTGG + Intergenic
1032238870 7:130146001-130146023 GCCCTAGGAAACTCACACAGTGG + Intergenic
1032455529 7:132070627-132070649 TTCCCGAGAGAGTCACACAGAGG - Intergenic
1033977238 7:147116857-147116879 TCCCCAGCAGCGTAACACAGTGG - Intronic
1035220962 7:157406383-157406405 TCCCCAGGCCAAGCACACAAGGG - Intronic
1035621461 8:1038349-1038371 TGCCAAGGTCAATCACACAGAGG - Intergenic
1036824713 8:11967100-11967122 TTCCCAGGACAGGCAGCCAGCGG + Intergenic
1037252291 8:16910387-16910409 TACCCAAGACAGACACATAGAGG + Intergenic
1038472867 8:27839710-27839732 TACTCAAGAGAGTCACACAGTGG + Intergenic
1039279545 8:35968713-35968735 TCCTCAGCACACTCCCACAGAGG - Intergenic
1039600883 8:38836190-38836212 TCCACAGGACACCGACACAGGGG - Exonic
1042482234 8:69317318-69317340 TCTCCAATACAGTCACACTGGGG - Intergenic
1043069544 8:75621126-75621148 TCCCCTGGGGAATCACACAGTGG - Intergenic
1048291145 8:133182707-133182729 TTCCCAGGACTGTGACCCAGAGG - Intergenic
1048331535 8:133473996-133474018 ACCCCAGGACCTGCACACAGTGG + Intronic
1048643242 8:136388049-136388071 CCCCAAATACAGTCACACAGGGG - Intergenic
1049266625 8:141671119-141671141 CCCCCAGGGCAGGCCCACAGCGG - Intergenic
1049514328 8:143045481-143045503 TCCTCAGCACAGTCACCCAAAGG + Intronic
1051259074 9:15244343-15244365 TACCTAGGACAGGAACACAGTGG - Intronic
1052607564 9:30723907-30723929 TCCCAAGCACAGTAACACTGTGG - Intergenic
1055686268 9:78778181-78778203 CCCCCTGGCCATTCACACAGAGG + Intergenic
1055715849 9:79117178-79117200 TGACCTGGGCAGTCACACAGGGG + Intergenic
1057640777 9:96818852-96818874 GCCTCAGAAAAGTCACACAGGGG - Exonic
1057705467 9:97392173-97392195 CTGCCAGGACAGTCACAGAGGGG - Intergenic
1059584441 9:115590979-115591001 TCCACAGGACAGTCACACAGTGG - Intergenic
1060348763 9:122839161-122839183 TCCACAAGACAGTGACCCAGTGG + Intergenic
1062094215 9:134694731-134694753 AGCCCAGGACTGTGACACAGGGG + Intronic
1062301425 9:135874024-135874046 TCCCCAGGACAAACACAAATTGG - Intronic
1062320933 9:135990255-135990277 GCCCCAGGCCAGGCCCACAGCGG - Intergenic
1185552793 X:997489-997511 TGCCCAGGACAGCCCCACCGCGG + Intergenic
1185630324 X:1512097-1512119 TCCCCAGGACACTCTTACACAGG - Intronic
1185650276 X:1642504-1642526 TCCCCATCACACACACACAGAGG - Intronic
1188022470 X:25173867-25173889 TGCTCAGGACTGTCACAGAGTGG + Intergenic
1190461842 X:50684501-50684523 TCCCTAGGACACTAATACAGAGG + Intronic
1190579795 X:51881256-51881278 TCTCCAATACAGTCACACTGAGG + Intronic
1191111277 X:56804581-56804603 TGCCCAGCACAGGAACACAGAGG - Intergenic
1192544180 X:71999076-71999098 TCCCCAGGTCAGACACAAGGAGG - Intergenic
1194240036 X:91434684-91434706 TCCGCAGGACAGTCCAACGGAGG - Intronic
1195062391 X:101208968-101208990 TCCCAAGGACATATACACAGTGG - Intergenic
1200079762 X:153570403-153570425 TCCCCAGAACTGGCACTCAGAGG + Intronic
1201411038 Y:13699650-13699672 GCCCAAGGACAGGCACACGGTGG - Intergenic