ID: 1181855647

View in Genome Browser
Species Human (GRCh38)
Location 22:25779890-25779912
Sequence TTGGGCAGGGAGTGGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 928
Summary {0: 1, 1: 0, 2: 10, 3: 74, 4: 843}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181855635_1181855647 22 Left 1181855635 22:25779845-25779867 CCCAGCAATCGGTGCTCAGTGAA 0: 1
1: 0
2: 0
3: 11
4: 93
Right 1181855647 22:25779890-25779912 TTGGGCAGGGAGTGGGTGGCAGG 0: 1
1: 0
2: 10
3: 74
4: 843
1181855636_1181855647 21 Left 1181855636 22:25779846-25779868 CCAGCAATCGGTGCTCAGTGAAA 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1181855647 22:25779890-25779912 TTGGGCAGGGAGTGGGTGGCAGG 0: 1
1: 0
2: 10
3: 74
4: 843

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181855647 Original CRISPR TTGGGCAGGGAGTGGGTGGC AGG Intronic
900102478 1:967748-967770 GTGGGCAGGGAGAGGGAGCCGGG + Intronic
900204339 1:1425709-1425731 TGGGACAGGGGGTGGGGGGCTGG + Intergenic
900271360 1:1790927-1790949 ATGGGCATGGAAGGGGTGGCAGG + Intronic
900291468 1:1925470-1925492 CAGGGCAGGGGGTGGGTGGTGGG + Intronic
900415117 1:2531251-2531273 GTGGGTAGGGAGTGGGTGCCAGG + Intergenic
900606327 1:3525241-3525263 TTGGGCAGGGAGGGTCTGACGGG - Intronic
900641550 1:3690168-3690190 TTGGGCAGGCAGTGGAAGGCAGG + Intronic
900647316 1:3714831-3714853 TTGGGGACAGAGGGGGTGGCAGG - Intronic
900698173 1:4025886-4025908 TTGGGCAGGATGTGGGAGGCAGG + Intergenic
900709644 1:4105507-4105529 TTGGGCTGGGAGAGGATAGCAGG - Intergenic
901177951 1:7318320-7318342 TTGGTCAGTGACTGGTTGGCTGG + Intronic
901301027 1:8200291-8200313 TTGGGAATGGAGAGGGTGTCTGG + Intergenic
901651722 1:10746920-10746942 AGGGGCAGGGAGTGGGAGCCTGG - Intronic
901758488 1:11455722-11455744 TGGGCTAGGGAGAGGGTGGCGGG - Intergenic
901762478 1:11479823-11479845 CTAGGTAGGGAGTGGGTGGAGGG - Intronic
901817105 1:11800628-11800650 GTGGGATGGGAGAGGGTGGCAGG - Intronic
902608630 1:17583702-17583724 CTGGGCAGGGAGTGGGGGTGGGG - Intronic
902671789 1:17979718-17979740 GGTGGCACGGAGTGGGTGGCTGG + Intergenic
902715543 1:18270207-18270229 TTGGAGAGTGAGTGGATGGCAGG - Intronic
902728590 1:18353339-18353361 TTGGGCAGGGATTGGAGGGAAGG + Intronic
902805157 1:18856415-18856437 GTGGGCAGGGTGGGGGTGTCTGG - Intronic
902978894 1:20109238-20109260 TAGGGTGGGGAGGGGGTGGCAGG + Intergenic
903220379 1:21865919-21865941 TTGGGCAGGGAGGGGGGTGGGGG - Intronic
903248927 1:22038142-22038164 CTGAGCAGTGAGTGGGTGCCAGG + Intergenic
903422885 1:23231418-23231440 GTGCCCATGGAGTGGGTGGCAGG + Intergenic
903438227 1:23368454-23368476 TTGGCCAGGCTGTGGGAGGCGGG - Intronic
903981635 1:27192874-27192896 TTGGGCAGGGAGTTGCAGGGTGG + Intergenic
904043831 1:27598950-27598972 TTGGAGAGGGAGTGGGGGACAGG - Intronic
904197140 1:28794401-28794423 TAGGGCAGGGGGTGGGGAGCTGG - Intergenic
904410281 1:30320843-30320865 AGGGGCATGGAGTGGGTGGGGGG + Intergenic
904492896 1:30871370-30871392 TTGGGGAGGGTGTGCTTGGCAGG - Intronic
904586054 1:31581278-31581300 GTGGGTAGGGAGGGGATGGCCGG + Intronic
904617158 1:31756091-31756113 TTGGACAGGGTGTGGGCAGCAGG + Exonic
904925914 1:34048150-34048172 TTGGCCACGAAGTGGGAGGCAGG - Intronic
905108162 1:35576284-35576306 CAGGGCAGGAAGTGGGTGGGGGG + Intronic
905172066 1:36115300-36115322 GTGGGGAGGCAGCGGGTGGCGGG - Intronic
905309984 1:37042536-37042558 CGGGGCAGGGGGTGGGGGGCTGG + Intergenic
905362605 1:37430895-37430917 GTGGGCATGGTGTGGGTGGAGGG + Intergenic
905807504 1:40887420-40887442 TTGGGCAGGGAGGGATGGGCAGG + Intergenic
905858232 1:41329232-41329254 GTGGGCAGGGAGTCTGTGGTGGG + Intergenic
906034355 1:42741257-42741279 TTGGGGACGGAGGGGGCGGCGGG - Intergenic
906101455 1:43266384-43266406 CTGAGAAGGGAGTGGGTGCCTGG + Intronic
906202394 1:43968367-43968389 TTGGGGGGTGGGTGGGTGGCAGG + Intergenic
906615388 1:47229875-47229897 TTGGGCTGGAGGTGGGTGGATGG - Intronic
906942823 1:50271314-50271336 AAGGGCAGGGGGTGGGGGGCGGG - Intergenic
907440126 1:54473863-54473885 TTGGGCACTGGGAGGGTGGCAGG - Intergenic
907515629 1:54991628-54991650 TGGCGCAGGGAGTGGGTGGCGGG + Intronic
908082639 1:60597848-60597870 AAGGGCAGGGGATGGGTGGCGGG - Intergenic
908405152 1:63807264-63807286 ATGGGCAAGGTGGGGGTGGCTGG + Intronic
909561586 1:77014462-77014484 CTGGGCAGGGCCTGGGTGGGGGG - Intronic
910167178 1:84339730-84339752 TTGAGGAGTGAGTGGGAGGCAGG + Intronic
912550953 1:110484984-110485006 GTGGGCAGAGAGTGGCTGGTGGG - Intergenic
913004876 1:114619514-114619536 TTGGGGGGTGAGTGGTTGGCAGG - Intronic
913464732 1:119128570-119128592 TGGGGGTGGGAGTGGGTGGGTGG - Intronic
913661399 1:121009056-121009078 TTGGGAGGGGAGTGAGCGGCGGG - Intergenic
914012765 1:143792236-143792258 TTGGGAGGGGAGTGAGCGGCGGG - Intergenic
914446157 1:147752381-147752403 TTGTGCAGGGTGTAGTTGGCTGG - Intergenic
914651390 1:149700845-149700867 TTGGGAGGGGAGTGAGCGGCGGG - Intergenic
914899206 1:151703046-151703068 GTGAGCTGGGAGTGTGTGGCAGG + Exonic
915562713 1:156696738-156696760 TTGGTCACTGAGTGGCTGGCGGG - Intergenic
915604586 1:156942548-156942570 TTGGGAAGGAAGTGGGAGGTAGG - Intronic
915684505 1:157617716-157617738 GTGGGCTGGGGGTGGGTGGGGGG + Intergenic
916465995 1:165075297-165075319 TTTGGCAGGGAGAGGGTGCCAGG + Intergenic
916680672 1:167102146-167102168 TAGGGCAGGGAGGGGGTGAGAGG + Intronic
916844082 1:168630554-168630576 GTGTGCAGGGAATGGGTGGGTGG + Intergenic
917906266 1:179589306-179589328 GTGGGGTGGGAGTGGGTGGGTGG - Intergenic
918187138 1:182137980-182138002 TAGGGCACAGAGAGGGTGGCAGG - Intergenic
918419279 1:184346814-184346836 TTGGGTGGGGGGAGGGTGGCAGG - Intergenic
918550871 1:185740677-185740699 TTGGGCAGGGGGTGGGGGGTAGG + Intronic
918585900 1:186188050-186188072 TTGGTCAAGGAGTGGGAGGAAGG - Intronic
919670138 1:200330863-200330885 TTAGGGAGGAAGTGGGTGGTGGG - Intergenic
919861191 1:201740308-201740330 TGGGGCTGGGAGTGGGTGTGTGG + Intronic
919871292 1:201823555-201823577 TTGGGAAGGTAGAGGCTGGCAGG + Exonic
920181140 1:204132161-204132183 TAGGGGAGGGATGGGGTGGCTGG + Exonic
920367359 1:205455214-205455236 ATGGGGAGGCAGTGGGAGGCAGG + Intronic
920438742 1:205964706-205964728 TTAGGCAGGGAGTGGGAAGGAGG + Intergenic
920497325 1:206464572-206464594 GTGGGGAGGGAGAAGGTGGCTGG - Intergenic
920500082 1:206480261-206480283 GTGGGCAGAGAGGGGGAGGCGGG + Intronic
921314380 1:213876436-213876458 TCGGGCAGGGGGTGGGTGGGAGG + Intergenic
922332244 1:224587454-224587476 TTGGGAAGGAAGCGGGTGTCTGG + Intronic
922560215 1:226564348-226564370 TAGGGAAGGGAGTGGGTGAGTGG + Intronic
922623965 1:227018321-227018343 TTGGACAGGCAGAGGGTTGCAGG + Intronic
923130806 1:231073152-231073174 TTGGGCAGGAAATGGGAGGATGG + Intergenic
923311786 1:232742682-232742704 GTGGAAAGGGAGTGGGTGGTGGG - Intergenic
923766886 1:236900825-236900847 TTGGGGAATGAGTGGATGGCTGG + Exonic
924148780 1:241106010-241106032 TTGGGCAGTTAGGTGGTGGCAGG + Intronic
924308899 1:242719813-242719835 GTGGGCAGGGTGAGGGAGGCAGG - Intergenic
924673584 1:246153187-246153209 TTGGGTAGGAAGTTGGTAGCAGG - Intronic
1062827309 10:582139-582161 TGTAGCAGGGGGTGGGTGGCCGG - Intronic
1063320075 10:5044385-5044407 TTGGGCATGGTGTGGATGGTGGG + Intronic
1063464139 10:6232242-6232264 TTTTGCGGGGGGTGGGTGGCGGG + Intronic
1063601290 10:7483429-7483451 TTGAGCAGTGAGTGGGTAACGGG - Intergenic
1064636713 10:17376031-17376053 TTGGGAATGGAGTGTCTGGCTGG - Intronic
1065713161 10:28536096-28536118 TTGGGCATGGTGGTGGTGGCAGG + Intronic
1067058369 10:43065262-43065284 TGGGGCAGGGTGGGGCTGGCTGG - Intergenic
1067069171 10:43119809-43119831 CAGGCCAGGGTGTGGGTGGCAGG - Intronic
1067556458 10:47276721-47276743 TTGTGCAGTCAGAGGGTGGCAGG - Intergenic
1067942433 10:50668113-50668135 TCGGGAATGGAGTGGGAGGCAGG - Intergenic
1068931665 10:62596558-62596580 TTGGCCATGGGGTGGGTGGGTGG - Intronic
1069643855 10:69977100-69977122 TTAGGCAGGAAGTGGGGTGCAGG + Intergenic
1069781247 10:70957100-70957122 GGGGGCAGGGGGTGGGTGCCAGG - Intergenic
1069862470 10:71480218-71480240 ATTCTCAGGGAGTGGGTGGCCGG + Intronic
1069884106 10:71612677-71612699 TTGGGGCAGGAGTGGGAGGCCGG + Intronic
1070487192 10:76942382-76942404 TTTGGCAGGGAGTAGGTGGAGGG + Intronic
1070697174 10:78572015-78572037 CTGGGCAGGGAGTGGGTGGTGGG + Intergenic
1070750759 10:78962742-78962764 GAGGGGAGGGAGGGGGTGGCCGG - Intergenic
1070796475 10:79219918-79219940 TGGGGCAAGCAGGGGGTGGCTGG - Intronic
1070803893 10:79259227-79259249 TGGGGCAGGGAAGGGGGGGCTGG + Intronic
1070835735 10:79445793-79445815 CGGGGCAGGGAGTGGGCGGCGGG - Intergenic
1070863677 10:79693071-79693093 TCGGGAATGGAGTGGGAGGCAGG - Intergenic
1071837778 10:89436564-89436586 TTAGGCAGGCAGTGGGTGGCAGG - Intronic
1072155859 10:92723076-92723098 TTGAACAGGAGGTGGGTGGCAGG + Intergenic
1072710803 10:97714497-97714519 GAGGGCAGGGAGAGGGTGCCAGG - Exonic
1073047134 10:100646150-100646172 GTGGGCTGGGAGTTGGTGGAGGG + Intergenic
1073094549 10:100971721-100971743 ATGGGATGGGGGTGGGTGGCAGG - Intronic
1073112283 10:101069914-101069936 TTGGGGAGGGATGGGGTGGTGGG + Intergenic
1073114430 10:101083324-101083346 CTGGGCAGGCTGTGGGTGGAGGG - Intergenic
1073176931 10:101562370-101562392 TTGGGCACAGAATGGGAGGCGGG + Intergenic
1073331348 10:102671877-102671899 TTGGGCAGGGAGTGCTGGGAAGG + Intergenic
1073376471 10:103039719-103039741 TAGGGCAGTGAGTGAGGGGCTGG + Intronic
1073538950 10:104302508-104302530 TGGGGCAGGGCTTGTGTGGCTGG + Intronic
1075312028 10:121422268-121422290 TTAGGCAGGGAGCATGTGGCAGG + Intergenic
1076478607 10:130769407-130769429 CTGGGCAGGGTGCAGGTGGCTGG - Intergenic
1076586703 10:131553654-131553676 ATGGGCAGGGAGTGAGTGTGTGG + Intergenic
1076640018 10:131909058-131909080 TTGGGTAGGGAGTGGAGGGGAGG + Intronic
1076820140 10:132934254-132934276 GTGGGCACGGGGTGGGTGGGGGG - Intronic
1076846447 10:133071731-133071753 CTGGGGAAGGAGTGTGTGGCTGG - Intronic
1076905110 10:133357598-133357620 CGGGGCAGGGGTTGGGTGGCCGG - Intronic
1077015564 11:397672-397694 GGGGGCAGCGAGTGGGTGGTCGG - Intronic
1077143446 11:1034840-1034862 TGGGGCAGGGCGAGGGCGGCGGG - Intronic
1077155236 11:1088163-1088185 CAGGGCAGGGGGTGGGGGGCTGG - Intergenic
1077166029 11:1139272-1139294 TGGGGGAGGGAGGGGGTAGCTGG + Intergenic
1077305104 11:1865382-1865404 GTGGGCAGCGAGAGGGTGCCAGG + Intronic
1077315999 11:1919625-1919647 TTGGCCAGTGACTGGGTGGCCGG - Exonic
1077322063 11:1947050-1947072 TGGGGCCGGGAGTGCGGGGCGGG + Intergenic
1077332007 11:1987954-1987976 GTGGGGACGGCGTGGGTGGCGGG - Intergenic
1077374124 11:2197617-2197639 TGGGGCAGGGGAAGGGTGGCGGG + Intergenic
1077475531 11:2788552-2788574 TTGGGTTGGGTGTGGGGGGCGGG - Intronic
1077524112 11:3053995-3054017 TTGGGCAGGGAGTGGATCACTGG - Intronic
1078611061 11:12819987-12820009 GTGGGCAGAGACTGGGTGGTTGG + Intronic
1078982165 11:16548668-16548690 CTGGGCAGGGAGTAGGAGGATGG + Intronic
1079244748 11:18743932-18743954 CTGGGGAGGAAGTGGGAGGCTGG + Intronic
1080442511 11:32308032-32308054 ATGGGCAAGGAGAGGCTGGCGGG + Intergenic
1080552246 11:33382809-33382831 CAGGGCAGGGAGAGGGTGCCAGG - Intergenic
1081323838 11:41721891-41721913 TCTGTCAGGGAGTGGGGGGCTGG - Intergenic
1081549258 11:44096423-44096445 TAGGCCGGGGACTGGGTGGCCGG + Intronic
1081655455 11:44854188-44854210 TGGGGCAGGGGGTGGGGGGGGGG + Intronic
1081979518 11:47257795-47257817 TTTGGCCGGGAGTAGGGGGCGGG + Intronic
1082212909 11:49527014-49527036 TTGGGCAACTAGTGGGTGTCAGG - Intergenic
1082760562 11:57123414-57123436 TTGGGCAAGTAGTGGGTACCTGG - Intergenic
1083266751 11:61550439-61550461 GAGGGCAGGGGGAGGGTGGCTGG + Intronic
1083307668 11:61769574-61769596 TTCGGCGGTAAGTGGGTGGCTGG + Intronic
1083420967 11:62553080-62553102 TTGGGCAGGGAGAGTGGGGCAGG + Intronic
1083690311 11:64404396-64404418 TTGGGCAGGGAGAAGGTGTTGGG - Intergenic
1083702303 11:64487457-64487479 TTGGGCAGGGGGTGGGTGAGTGG + Intergenic
1083712639 11:64558696-64558718 AGGGGCAGGGAGTGGCTGGCAGG - Intronic
1083796267 11:65018548-65018570 CTGGGCAAGGAGCGGGTGACAGG - Intronic
1083823320 11:65184427-65184449 TTGCGGAGAGTGTGGGTGGCGGG - Intronic
1083898204 11:65630832-65630854 TTGGGCAGTGAGTATGGGGCAGG + Intronic
1084149689 11:67282373-67282395 GTGGGGAGGGAGAGGGTGGGGGG - Intronic
1084182285 11:67452745-67452767 CTGGACACGGAGTGGGTGCCTGG + Intronic
1084302089 11:68258592-68258614 GTGGGCAGGCAGTTGGTGGTGGG + Intergenic
1084316664 11:68349653-68349675 GTGGGGAGAGCGTGGGTGGCAGG + Intronic
1084484243 11:69438735-69438757 CTAGGCAGGGAGTGGGGGACAGG + Intergenic
1084650158 11:70484886-70484908 GAGGGCAGCGAGTGGGTGGGCGG - Intronic
1084664560 11:70569451-70569473 CTGGGCAGAGGGTGGATGGCGGG + Intronic
1085177824 11:74506396-74506418 TTAGGCTGGTAGTGAGTGGCAGG + Intronic
1085514731 11:77105540-77105562 CTGGGCAGGGGGTGGATGGAAGG + Intronic
1085911176 11:80828802-80828824 TTGGGCTGGGATTGGGAGGGGGG - Intergenic
1086636692 11:89097498-89097520 TTGGGCAACTAGTGGGTGTCAGG + Intergenic
1086891105 11:92259002-92259024 TTGGGCTGTGTGTGGGGGGCGGG + Intergenic
1087186474 11:95203804-95203826 CTGGGCAAGGAGTGGTTTGCTGG + Intronic
1088514706 11:110618083-110618105 GGGGGCAGGGGGTGGGTGGAAGG - Intronic
1088571760 11:111229736-111229758 GTGGGCAGGATGTGGGGGGCGGG + Intergenic
1088680001 11:112231842-112231864 TGGGGCAGGGGTTGGGGGGCAGG + Intronic
1088870447 11:113886189-113886211 GGGGGCAGGGGGTGGGGGGCGGG - Intergenic
1089282161 11:117381972-117381994 TTGGGGAGGGAGTGGGGAGCTGG + Intronic
1089693590 11:120201813-120201835 GGGGGCAGGGAGGGGGTGGGGGG - Intergenic
1089846969 11:121466269-121466291 CTGGCCTGGGAGTGGGTGGGAGG - Intronic
1089851220 11:121498263-121498285 TTGGGCAGGGATGGGGTGATGGG + Intronic
1090003205 11:122979480-122979502 GTGGGCAGAGCGTGGGTCGCCGG + Intronic
1090060523 11:123460715-123460737 TGGGGCAGGGAAGGGGAGGCAGG + Intergenic
1090060790 11:123462553-123462575 TTGGAGAAGGGGTGGGTGGCAGG - Intergenic
1090248732 11:125236381-125236403 TGGGGCGGGGGGTGGGTGGAGGG + Intronic
1090351981 11:126113648-126113670 TTGTACAGGCAGTAGGTGGCAGG - Intergenic
1090390416 11:126384012-126384034 TTGGGAAGGGAGAGTGGGGCAGG - Intronic
1090399324 11:126438911-126438933 TTGTGCAGGGAGGGTGGGGCTGG - Intronic
1090490469 11:127156041-127156063 TTGGGCAGGGAGTGGGGTATAGG + Intergenic
1090517784 11:127447196-127447218 TTGGGCGGGGGGTGGGTGCAGGG + Intergenic
1090593899 11:128299734-128299756 GTGTGCAGGGAGTGCATGGCAGG + Intergenic
1090847371 11:130542100-130542122 GTGGGCAGGGCATGGATGGCAGG - Intergenic
1202805079 11_KI270721v1_random:2363-2385 TGGGGCCGGGAGTGCGGGGCGGG + Intergenic
1202814988 11_KI270721v1_random:43130-43152 GTGGGGACGGCGTGGGTGGCGGG - Intergenic
1092143541 12:6200129-6200151 TTGAAGAAGGAGTGGGTGGCGGG + Intronic
1092810227 12:12266248-12266270 CGGGGTGGGGAGTGGGTGGCGGG + Intronic
1092913716 12:13171157-13171179 TTTGGCAGTGGGTGGGTGGGGGG + Intergenic
1094174045 12:27523971-27523993 TAGGGCTGGAAGTGGGTGGATGG - Intronic
1094308506 12:29050187-29050209 CTGGGAAGAGAGTGGGGGGCAGG + Intergenic
1094450540 12:30578850-30578872 TTGAGCAGGAAGTGTGTGGCTGG - Intergenic
1095195936 12:39317519-39317541 TAGGACTGGGAGTGGGTTGCAGG - Intronic
1095814447 12:46406227-46406249 GTTGGCAGGGAGTGGGGGGTGGG + Intergenic
1096214987 12:49793702-49793724 TGGGGTAGGGACTGGGTGGACGG - Intronic
1096227724 12:49877208-49877230 TTGAGCAGGGTGTGGGTTGGGGG + Intronic
1097053924 12:56239044-56239066 TTGGGAGGGCAGAGGGTGGCGGG - Exonic
1097054448 12:56241385-56241407 TTGGGGAGGGAGGGGGTCCCTGG + Exonic
1097338824 12:58414731-58414753 GTGGGTGGGGAGTGGGTGGGGGG + Intergenic
1097399346 12:59110054-59110076 TGGGGCAGGGAGTGGGGAGGTGG + Intergenic
1097476534 12:60063797-60063819 TGGGGGAGGGGGTGGGTGGATGG - Intergenic
1098005535 12:65993268-65993290 GTGGGGAGGGAGTGGGAGGAGGG - Intergenic
1098235007 12:68409979-68410001 CTGGGCAGGGAGTGGGGTGGTGG + Intergenic
1098312842 12:69164746-69164768 TTAGGCAGGGTTTGGGTTGCAGG + Intergenic
1100264068 12:92959099-92959121 TTGGGCAAGGAGTGAGTGATGGG + Intergenic
1100379705 12:94049994-94050016 CAGGGCAGGAAGTGGGTGGAGGG + Intergenic
1101175970 12:102151847-102151869 TTGGACAGTGAGTTGGTGCCAGG - Intronic
1101319648 12:103662326-103662348 TACTGCAGGGGGTGGGTGGCAGG + Intronic
1102766449 12:115437569-115437591 TTAGGGAGGGTGTGGATGGCAGG + Intergenic
1103231471 12:119334681-119334703 TTGGGCCGGGTGGGGGTGGGGGG - Intergenic
1103402227 12:120650750-120650772 TTGGGCACAGAAAGGGTGGCTGG + Intronic
1103447320 12:121002547-121002569 TTGGGCAGGTAGCGGGAGGCTGG + Intronic
1103506290 12:121443920-121443942 TGGGGCAGGGGGTGGGCAGCAGG - Intronic
1104753444 12:131254345-131254367 TTGTGCAGGCAGTGGGTAGGTGG - Intergenic
1104774853 12:131385038-131385060 ATGGGGAGGGAGTCGGTGGCAGG - Intergenic
1104975244 12:132549253-132549275 TTGGGCAGGGACATCGTGGCTGG - Intronic
1104979957 12:132569346-132569368 TTGGGCAGGGACTGGGTGGGAGG - Intronic
1105589056 13:21774451-21774473 TTGGAAAGTGAGTGGGTGGTGGG - Intergenic
1105638101 13:22235736-22235758 TGGGGCTGAGAGTGGGTGGCTGG + Intergenic
1105821875 13:24087287-24087309 GTGTGCAGGGGGTGGGTAGCAGG - Intronic
1106350985 13:28930435-28930457 TTGGGCTGGGAATGGGAGCCAGG + Intronic
1106540615 13:30686873-30686895 GTGGGCAGGAAGAGGGTTGCAGG + Intergenic
1106753446 13:32797629-32797651 TTGGGCGGGGGGTGGGGGGGTGG - Intergenic
1107972622 13:45658511-45658533 ATGGGGCAGGAGTGGGTGGCTGG + Intergenic
1108378789 13:49837428-49837450 ATGGGCAGGGGGTGGGAGACAGG + Intergenic
1108408074 13:50124549-50124571 TTCGGCGGGGAGAGGGGGGCCGG - Intronic
1109729567 13:66394076-66394098 GTGGGCTGGGATTTGGTGGCAGG + Intronic
1109889064 13:68583122-68583144 TTGGGCACAGAGGAGGTGGCAGG - Intergenic
1110289065 13:73783318-73783340 CTGGGAAGGGAGTGGGTAGAGGG + Intronic
1110377267 13:74807307-74807329 TTGGGCAATGACAGGGTGGCTGG - Intergenic
1110436481 13:75482157-75482179 TGGGGCAGACACTGGGTGGCTGG + Intergenic
1111706105 13:91751114-91751136 TTTGGCAGGGTTTAGGTGGCAGG - Intronic
1112197335 13:97238677-97238699 TTAGGTAGGGAGTGGGAGACAGG + Intronic
1112480902 13:99774492-99774514 TTGGGCTGGGAATGGGTCGTGGG + Intronic
1112742638 13:102492585-102492607 TTGGGCAGGGGGAGGGAGGAAGG + Intergenic
1112823716 13:103366648-103366670 TTGGGTAGGGAGTGGTGGGAGGG + Intergenic
1113779747 13:112969226-112969248 CTGGGCAGGGAGGCGGCGGCTGG + Exonic
1113897647 13:113776129-113776151 TTGAGCAGAGAGTGGGGGACGGG - Intronic
1113928997 13:113956657-113956679 TTGGGCGGCAAGTAGGTGGCCGG + Intergenic
1114284905 14:21232144-21232166 TTTGGTAGGCAGTGGGTGGCAGG - Intronic
1114612894 14:24053821-24053843 GTGGGGAGGGAGGAGGTGGCTGG + Intronic
1114669454 14:24401113-24401135 TTGAGCAAGGAGGGGGTGGCGGG - Intronic
1115236186 14:31210386-31210408 GCGGGCAGGAAGTGGGTGGGTGG - Intergenic
1115374635 14:32660918-32660940 TTGGGAGGGGGGGGGGTGGCGGG - Intronic
1115828037 14:37299289-37299311 TAGGGTAGGGAGAGGGGGGCGGG + Intronic
1115976813 14:39005631-39005653 TGGGGCTGGGGCTGGGTGGCAGG - Intergenic
1117619853 14:57574538-57574560 TGGGGCAGGGTGCGGGTGGAGGG + Intronic
1118388036 14:65272945-65272967 GTGGCCAGGGAGTGGGTTACAGG - Intergenic
1118489145 14:66242550-66242572 TTGGGTAGTGTGTGGGTGGGTGG - Intergenic
1118764558 14:68901101-68901123 CAGGGGAGGGAGTGGGTGGGAGG + Intronic
1118843179 14:69527711-69527733 TTGGGAAGGGAGGGACTGGCTGG + Intronic
1119024798 14:71144062-71144084 TTTTGCAGGGAGTGGGAGGGCGG - Intergenic
1119113474 14:71996777-71996799 TAGGGGAGGAAGGGGGTGGCGGG + Intronic
1119429358 14:74555759-74555781 AAAGGCAGAGAGTGGGTGGCTGG - Intronic
1119439062 14:74616074-74616096 ATGGGCAGTAAGTAGGTGGCAGG - Intergenic
1119702079 14:76762131-76762153 TTGTGCAGGGAGTTGGCCGCAGG + Intergenic
1119747689 14:77056041-77056063 TTGGGCAGGGCTTGGCTGGGTGG + Intergenic
1120234415 14:81874666-81874688 TTGGGAAGGGAGTAGGGAGCAGG + Intergenic
1120442249 14:84556557-84556579 TTGTGGTTGGAGTGGGTGGCCGG - Intergenic
1120625978 14:86827054-86827076 GAGGGCAGGGGGTGGGGGGCAGG + Intergenic
1121226037 14:92322796-92322818 GTGGGGAGGGGGTGTGTGGCGGG + Intronic
1121369488 14:93344022-93344044 CTGGGGTGGGGGTGGGTGGCAGG + Intronic
1121811018 14:96890408-96890430 TGGGGCAGGGTGGGGGTGGAGGG - Intronic
1122448320 14:101783456-101783478 TGGGGCAGGCAGCTGGTGGCTGG + Intronic
1122764597 14:104057737-104057759 ATGGGAAGGGAATGGGGGGCAGG - Intergenic
1122765234 14:104064571-104064593 TTGCCAAGGGAGTGGGAGGCAGG + Intergenic
1122789672 14:104178961-104178983 TTGGGCAGTGGGTGGGTGGCTGG + Intronic
1123008010 14:105333682-105333704 TTGGGGAGGGAGGAGGTGGGAGG + Intronic
1123407520 15:20030067-20030089 GTTGGCAGGGACAGGGTGGCGGG - Intergenic
1123432772 15:20232573-20232595 TTGAGCGAGGAGTGGGTGGCAGG - Intergenic
1123467967 15:20530121-20530143 GTGGGCAGGGCGGGGGAGGCAGG + Intergenic
1123516848 15:21036723-21036745 GTTGGCAGGGACAGGGTGGCGGG - Intergenic
1123650146 15:22470921-22470943 GTGGGCAGGGCGGGGGAGGCAGG - Intergenic
1123740552 15:23279763-23279785 GTGGGCAGGGCGGGGGAGGCAGG - Intergenic
1123746446 15:23322795-23322817 GTGGGCAGGGCGGGGGAGGCAGG + Intergenic
1123816903 15:23989701-23989723 TTGCACAGGGAGAGGTTGGCTGG + Intergenic
1124048606 15:26174697-26174719 TTGGTCAGGGAATGGGAGGAGGG + Intergenic
1124278713 15:28346112-28346134 GTGGGCAGGGCGGGGGAGGCAGG + Intergenic
1124303986 15:28565496-28565518 GTGGGCAGGGCGGGGGAGGCAGG - Intergenic
1124532867 15:30521971-30521993 GTGGGCAGGGCGGGGGAGGCAGG - Intergenic
1124765789 15:32485673-32485695 GTGGGCAGGGCGGGGGAGGCAGG + Intergenic
1124804480 15:32867629-32867651 TTGCACAGGGAGCGGGGGGCAGG - Intronic
1125312889 15:38399883-38399905 TGGGGCGGGGTGGGGGTGGCGGG - Intergenic
1125599421 15:40907168-40907190 GGAGGCAGGGAGTGGGCGGCGGG + Intergenic
1125973878 15:43934231-43934253 TTTGGCAGGGAGTTTGGGGCAGG + Intronic
1128137830 15:65277125-65277147 GTGGGGAGGGAGTTAGTGGCAGG - Intronic
1128240016 15:66095530-66095552 TAGGCCAGGCAGTGGGTGGGAGG - Intronic
1129193771 15:73952527-73952549 ATTGTAAGGGAGTGGGTGGCTGG - Intergenic
1129229321 15:74188174-74188196 CGGGGCAGGGAGTGGGGGGTGGG - Intronic
1129327230 15:74807165-74807187 TAGAGCAGGGGGTGGGTGGTGGG + Intergenic
1129577806 15:76770197-76770219 CTGGTCAGGGGGTGGGGGGCTGG + Intronic
1129668441 15:77592767-77592789 TTAGGCAGGGAGTGGTGGGGTGG + Intergenic
1129739631 15:77983982-77984004 TTGGGAAGGGTGTGGATGGTGGG + Intergenic
1129839417 15:78734578-78734600 TTGTGCGGGGGGTGGGTAGCGGG + Intergenic
1129846276 15:78769065-78769087 TTGGGAAGGGTGTGGATGGTGGG - Intronic
1129851526 15:78796557-78796579 GTGGGCCAGGAGCGGGTGGCGGG - Intronic
1129966157 15:79737685-79737707 CTGAGCAGAGAGTGGGTTGCCGG - Intergenic
1130042025 15:80413248-80413270 TTGGTAAGGGAGGGGGTGGAGGG - Intronic
1130255635 15:82324861-82324883 TTGGGAAGGGTGTGGATGGTGGG + Intergenic
1130599331 15:85265125-85265147 TTGGGAAGGGTGTGGATGGTGGG - Intergenic
1130652478 15:85769911-85769933 GTGAGCAGAGAGTGGGTGGGAGG - Intronic
1130685137 15:86030689-86030711 TTGGGCAGGGGGTAGGCGGGTGG - Intergenic
1131079996 15:89526889-89526911 ATGGGGAGAGAGGGGGTGGCTGG - Intergenic
1132055420 15:98648105-98648127 GTGGGCGGGGAGTGCGGGGCTGG - Intergenic
1132561065 16:594187-594209 TTGGTCAGGGTGTGTGTGCCCGG + Intronic
1132582854 16:693521-693543 TTGGGCAGGGAGAGGGCGGAAGG - Exonic
1132590428 16:724045-724067 TGGGGCAGTGGGTGGGTGGGGGG + Intronic
1132617439 16:848742-848764 CTGGGCAGGGAGAAGGTGGACGG - Intergenic
1132649400 16:1013794-1013816 TTGGGCAGGCAGAGGCTGCCAGG + Intergenic
1132687760 16:1169401-1169423 TTGGGCCCCGAGAGGGTGGCAGG + Intronic
1132750626 16:1455846-1455868 TGGGGGAGGGAGTTGGTGGTGGG - Intronic
1132841470 16:1980260-1980282 AGGGGCAGAGAGTGGGAGGCTGG - Exonic
1132929980 16:2454133-2454155 AAGGGCAGGCACTGGGTGGCTGG + Intronic
1133033202 16:3021313-3021335 CTGGGCTGTGAGTGGGGGGCAGG + Exonic
1133092540 16:3415495-3415517 TTGGGCAGGCAGTAGGAGACAGG - Intronic
1133303952 16:4798591-4798613 TCGGGGAGGGTGAGGGTGGCGGG + Exonic
1133358576 16:5155530-5155552 TTGGGCGGGGAGGGGGTGGCGGG - Intergenic
1133496033 16:6318485-6318507 TTGGGCAGGGAGGGGAGGGATGG + Intronic
1133989264 16:10692062-10692084 TTGCGCAGGGAGAGGCTGCCTGG + Intronic
1134884302 16:17776162-17776184 TGGGGCAGGGAATGGGAGGCAGG - Intergenic
1135047839 16:19168906-19168928 TTGGGGAGGGAATGGGGGGTGGG + Intronic
1135061530 16:19275173-19275195 TTGGGCAACGATGGGGTGGCTGG + Intergenic
1136350043 16:29700925-29700947 TTTGGGAGGGGATGGGTGGCTGG - Intergenic
1136590138 16:31213768-31213790 TTGGGGAATGAGTGGGTGACAGG + Intergenic
1136911829 16:34150095-34150117 GTGGGGAGGGAGTGCGTGGTGGG + Intergenic
1137350862 16:47712854-47712876 TGTCCCAGGGAGTGGGTGGCCGG - Intergenic
1137585329 16:49660821-49660843 TGGGGCAGGGTGTGGGGGGATGG + Intronic
1137619710 16:49868315-49868337 TTGGGGTGGGAATGGGCGGCGGG - Intergenic
1138062165 16:53903183-53903205 TTGGGAAGGGAATGAGTGGCTGG - Intronic
1138757866 16:59510389-59510411 CTGGGCTGTGAGTGGGTTGCTGG + Intergenic
1139344066 16:66290658-66290680 CAGTGCAGGGAGTGGCTGGCTGG - Intergenic
1139939742 16:70596624-70596646 TTTGGCAGGGTGTGGGGGACGGG - Intronic
1140296730 16:73716183-73716205 TAGGGGAGGGAATGGGTGGCTGG + Intergenic
1140456473 16:75108769-75108791 TAGGTGAGGGAGTGGGGGGCAGG - Exonic
1140818227 16:78639928-78639950 CTGTGGAGGGAGTGGGAGGCAGG + Intronic
1140843898 16:78868364-78868386 TGGGGCTGGGAGTGAGTGGAGGG + Intronic
1140927451 16:79598516-79598538 CTGGGGAGGGAATGGGTGTCTGG - Intronic
1141130999 16:81436758-81436780 TGGGGCTGGCAGTGGGTGACTGG + Intergenic
1141242205 16:82274543-82274565 GCGGGCAGGGAGTGGGGAGCTGG + Intergenic
1141271272 16:82543388-82543410 TTGGTCAGGGAGGGGCTCGCTGG + Intergenic
1141680596 16:85541555-85541577 TTGTCCACGGAGTGGCTGGCAGG - Intergenic
1141776166 16:86123837-86123859 TTTGGCTGGGATTGGGGGGCAGG + Intergenic
1142137693 16:88459200-88459222 CTGAGCGGGGAGTGGGTGACAGG - Intronic
1142196191 16:88740370-88740392 CTGGGAAGGGGCTGGGTGGCTGG - Intronic
1142241563 16:88949588-88949610 ATGGGCTGGGAGTGGGTGTGGGG + Intronic
1142497353 17:313391-313413 TGGGGCAGAGAGTGAGCGGCCGG - Intronic
1142525830 17:540068-540090 TTGGGCAGGGTGGCGGGGGCGGG - Intronic
1142555854 17:776818-776840 TTTGGCTGGGGGTAGGTGGCTGG - Intronic
1143137696 17:4720874-4720896 GAGGGCAGGGAGTGGGAGGCTGG + Intronic
1143755479 17:9064229-9064251 CTGGCCAGGAAGTGGGTGGATGG - Intronic
1143756687 17:9072656-9072678 ATGGGAAGTGAGTGGGAGGCAGG + Intronic
1143886243 17:10067138-10067160 TGGGGGAGGGATGGGGTGGCGGG + Intronic
1144831093 17:18131560-18131582 TTGGGCAGGGTCGGGGTGGGAGG + Intronic
1144863080 17:18317953-18317975 CTGAGCAGGGAGTAGATGGCTGG - Exonic
1145786478 17:27597188-27597210 TGGGGAAGGGAGGGTGTGGCTGG + Intronic
1145809214 17:27754757-27754779 TTGGGCAGGCTGTGGATGACGGG + Intergenic
1146413909 17:32614255-32614277 TTGGACGGGGTGTGGGGGGCGGG - Intronic
1146539771 17:33684291-33684313 TCGGGCTGGGAGTGGGTGCTAGG - Intronic
1147208021 17:38852820-38852842 TTGGGCAGTGAGTGGAGGGAGGG - Intronic
1147316270 17:39621904-39621926 TGGTGGAGGGAGTGGGAGGCGGG + Intergenic
1147386304 17:40084322-40084344 TTGGCTGGGGATTGGGTGGCAGG + Intronic
1147387566 17:40091109-40091131 TGGGGCAGGGGGTGGGGGGAGGG + Intronic
1147454941 17:40531292-40531314 TTGGGGGTGGGGTGGGTGGCAGG - Intergenic
1147587084 17:41658905-41658927 CAGGGCAGGGAGGGGCTGGCAGG + Intergenic
1147623736 17:41885754-41885776 TTTAGTAGGGGGTGGGTGGCAGG - Intronic
1147626807 17:41905697-41905719 TGGGGCAGGGAGTGGCAGCCTGG + Intronic
1147686824 17:42290926-42290948 TTGGGCAGGGAGGTGGTTTCTGG + Intronic
1147736611 17:42642768-42642790 GTGGGGTGGGAGTGGGGGGCAGG - Intergenic
1148129828 17:45256136-45256158 TGGGGCAGGGACTCGGTGCCAGG - Intronic
1148445190 17:47733357-47733379 ATGGGCAGGGAGCAGGGGGCGGG - Exonic
1148580807 17:48742499-48742521 TTTGGCAGGGAGTGGAGGGAAGG - Intergenic
1148664128 17:49362015-49362037 TTGGGCAGGGGGGGAGGGGCTGG - Intronic
1148864954 17:50623640-50623662 TTTTGCAGGGGGTGGGGGGCAGG + Intronic
1149028656 17:52059510-52059532 TTGGGCAGGGAGTGTGTGTGTGG - Intronic
1149552777 17:57552388-57552410 CAGGGCAGTGAGTGGGGGGCTGG - Intronic
1149591334 17:57831936-57831958 ATGGGGAGGCAGTGGGTGCCAGG - Intergenic
1150458243 17:65325620-65325642 TTGGCCAGGGATAGGGTGGAGGG + Intergenic
1150636228 17:66915190-66915212 TGGGGCAGGGAGAGGGAGGCAGG + Intergenic
1150849658 17:68692634-68692656 TTGGCCAGGGATTGGGTAGATGG + Intergenic
1151104512 17:71596984-71597006 ATGGGCTGGGAGTGGGTGAGTGG - Intergenic
1151310358 17:73288871-73288893 TCGGGCAGGGAGGGGGAGCCAGG + Intronic
1151375779 17:73687876-73687898 GTGGGCAGGGAGTGGAAGGCAGG + Intergenic
1151459090 17:74244056-74244078 TGGGGGAGGGAGTGGGTGGTGGG + Intronic
1151460369 17:74250497-74250519 ATGGGAAGGGAGGGGGTGCCTGG + Intronic
1151538402 17:74751480-74751502 TGGCGCAGAGAGTGGTTGGCTGG + Intronic
1151788217 17:76287011-76287033 GTGGGCAGGGGGTGGGGGGGCGG - Intronic
1152002328 17:77654558-77654580 TTGGGCTGGGAGATGGTGGTGGG - Intergenic
1152275357 17:79353403-79353425 TTGGGCACCTAGTGAGTGGCAGG - Intronic
1152323942 17:79624810-79624832 TGGGGCGGGGGGTGGGGGGCGGG - Intergenic
1152326883 17:79646810-79646832 TGGGGCAGAGGGTGGCTGGCAGG - Intergenic
1152362114 17:79837574-79837596 TTGGGAAGGGTGTGTGTGGGTGG - Intronic
1152748037 17:82050202-82050224 CTGGGCAGAGAGGGGGTGTCTGG - Intronic
1153265480 18:3264541-3264563 CTTTGCAAGGAGTGGGTGGCAGG - Intronic
1153698369 18:7666854-7666876 TTTGGCAGGGGGTAGGTGGGAGG + Intronic
1153935269 18:9914715-9914737 TTCGGCGGGGCGTGGGCGGCTGG + Intronic
1154119963 18:11644270-11644292 GTGGGCAGGGAGGGAGGGGCTGG + Intergenic
1155041369 18:22068101-22068123 TTGGGAGGGGAGTAGGGGGCAGG - Intergenic
1155086418 18:22463566-22463588 ATGGGCAGGGATTGGGAGGTGGG - Intergenic
1155229160 18:23756926-23756948 GGGGGAAGGGAGTGGGGGGCGGG - Intronic
1155577812 18:27267064-27267086 TTGGGGAAGGAGTGGGAGGAGGG + Intergenic
1155910325 18:31498131-31498153 GCGGGGAGGGAGAGGGTGGCCGG + Exonic
1155959226 18:31979685-31979707 TAGGGCAGAGAGTGGGAGGAGGG - Intergenic
1156084530 18:33382752-33382774 TTGGGCAGGCACTGGGCTGCAGG + Intronic
1156526641 18:37774256-37774278 AGGGGCAGGGAGTGGGGGGCAGG + Intergenic
1157018022 18:43743176-43743198 TGGGGCAGGGAGTAAGTGGGTGG + Intergenic
1157295306 18:46437884-46437906 GTGGGCAGAGGGTGGGTGGAGGG + Intronic
1157555538 18:48610692-48610714 GTGGGCAGGGCATGGCTGGCCGG - Intronic
1157622467 18:49024321-49024343 TTGGGCAGGGAGTGTGGAGTGGG + Intergenic
1157804081 18:50645059-50645081 CAGGCCAGGGAGTGGGTGGCTGG + Intronic
1157865876 18:51184197-51184219 TTGAGTAGGGAGTGGGAGGTGGG - Intronic
1158137510 18:54223985-54224007 GGGGGCGGGGAGGGGGTGGCGGG - Intronic
1158435161 18:57430308-57430330 TTTGGGTGGAAGTGGGTGGCCGG - Intergenic
1158534069 18:58291875-58291897 TTGGGAAGGGGGTGGCTGGAAGG - Intronic
1158710645 18:59834699-59834721 TTGGAAAGGCAGTGGGTGTCTGG + Intergenic
1158889260 18:61858286-61858308 TGGGGGAGGGAGGGGCTGGCAGG - Intronic
1159353225 18:67300999-67301021 TTGGGCAGGTGGCGGGTAGCTGG - Intergenic
1159667873 18:71185608-71185630 ATGGGCAGGGTCTGGGTGGAGGG + Intergenic
1160328770 18:77973717-77973739 CTGGGCAGGGTGTGGGGGGCAGG + Intergenic
1160543735 18:79639265-79639287 CTGGTGAGGGAGTGGGGGGCTGG + Intergenic
1160745621 19:709629-709651 TTGGGAAGGGCGGGGGTGGGGGG - Intronic
1160788510 19:912522-912544 TGGAGCAGGGAGTGGGGGGACGG + Intronic
1160847186 19:1171750-1171772 TTAGGCAGCAAGTGGGTGGGGGG + Intronic
1160909703 19:1468942-1468964 CTGGGCAGGGGCTGGGAGGCGGG - Exonic
1161104626 19:2437139-2437161 CTGGGCAGGGAGTGTGGGCCCGG + Intronic
1161334612 19:3706058-3706080 TAGGGCAGGGATGGGGTGACAGG + Intergenic
1161453868 19:4360797-4360819 CTGGGGTGGGTGTGGGTGGCTGG + Exonic
1161583627 19:5093667-5093689 CTGGGGTGGGTGTGGGTGGCAGG - Intronic
1161844052 19:6701667-6701689 TTAGCCAGGCAGGGGGTGGCGGG - Intronic
1161977606 19:7615141-7615163 TGGGGGAGGGGGTGGCTGGCTGG + Intronic
1162015468 19:7844521-7844543 CTGGGCAGGGAGGGGCTGGGAGG - Intronic
1162153964 19:8664357-8664379 ATGGGCAGGAAGTGGGGGGTGGG - Intergenic
1162781497 19:13009300-13009322 CTGGGCAGCGGGTGGGTGGGGGG + Intronic
1162936961 19:13986213-13986235 GTGGGCAGGGAGTGGGGGGCTGG + Intronic
1163252760 19:16136048-16136070 GTGGGAAGGGAGTTTGTGGCTGG - Intronic
1163716906 19:18878289-18878311 TGGGGCAGGCAGGGGGTGTCTGG - Exonic
1164096991 19:22020559-22020581 TTGGGCAATGACGGGGTGGCTGG + Intergenic
1164526755 19:29018683-29018705 TTGGGAAGGCACAGGGTGGCAGG + Intergenic
1164645432 19:29855700-29855722 GAGGGGAGGGAGTGGGGGGCAGG - Intergenic
1164646575 19:29862688-29862710 TGTGGCAGAGAGTGGGTGGGAGG + Intergenic
1164740244 19:30570377-30570399 TGGGGTACGGAGAGGGTGGCAGG + Intronic
1165113140 19:33513651-33513673 TTGGGCAGGGAGTGTGTGCTGGG - Intronic
1165124058 19:33581590-33581612 TTGAGCAGGCTATGGGTGGCGGG - Intergenic
1165152950 19:33771699-33771721 CTGGCCTGGGAGAGGGTGGCGGG - Intronic
1165218967 19:34299038-34299060 TGGAGAAGGGAGTGGCTGGCAGG - Intronic
1165263800 19:34643411-34643433 CTGGGAAGGGTGTGGGTGGGGGG + Intronic
1165394600 19:35557576-35557598 CTGGGCCGGGAGTGGTGGGCAGG + Intronic
1165809729 19:38605330-38605352 TGGGGTGGGGAGGGGGTGGCAGG - Intronic
1165921782 19:39303483-39303505 TTGGCCAGGTAGGGGGTGGGTGG - Intergenic
1165937405 19:39397716-39397738 TGGGGCAGGCAGTGGTTGGTGGG + Exonic
1166060016 19:40320362-40320384 GTGGGCAGGGGCTAGGTGGCTGG - Exonic
1166380136 19:42351347-42351369 GGGTGCAGGGAGTGGGTGGGTGG + Intronic
1166395017 19:42433293-42433315 TTGGGCAAGGGTTTGGTGGCAGG + Intronic
1166823289 19:45593757-45593779 TTGGGTAAGGAGTGGGAGGCTGG - Intronic
1167591321 19:50406020-50406042 TGGGGCTGGGTGTGGGTGGCTGG - Intronic
1167715833 19:51142400-51142422 TGGGGGAGGGAGAGGGTGGAAGG + Exonic
1167721820 19:51184837-51184859 TGGGGGAGGGAGGGGGTGGAGGG + Intergenic
1168405500 19:56108306-56108328 CTGGGCAGGGGCTGGGTGGTGGG - Intronic
1168405528 19:56108376-56108398 CTGGGCAGGGGTTGGGTGGAGGG - Intronic
1168707338 19:58477552-58477574 TTGGGCTGGGTGAGTGTGGCTGG + Exonic
925057123 2:864209-864231 TGGGGCAGGGAGGGTGTGGCTGG - Intergenic
925123672 2:1438573-1438595 TGGGGCAGGGTGGGGGTGGGTGG - Intronic
926671979 2:15585270-15585292 TTGGGCAGGGCTTAGCTGGCTGG - Intergenic
926913971 2:17876362-17876384 CTGGGCAGGAAGTGGGTGTGTGG + Intergenic
927459634 2:23286955-23286977 TGGGTCAGGCTGTGGGTGGCCGG - Intergenic
927702292 2:25276209-25276231 TGGGGCAGGGAGTGGAGGGACGG - Intronic
927710768 2:25324599-25324621 TTGGGCAGGGGGTGGGGGTGGGG - Intronic
927865251 2:26583757-26583779 GGGGGCTGGGAGTTGGTGGCTGG - Intronic
927956283 2:27209755-27209777 TTGGGCAGACACTGGCTGGCTGG + Intronic
928112559 2:28522391-28522413 TTGGTCAGGGTGGGGGTGGAGGG + Intronic
928355137 2:30605840-30605862 TCGGGGAGGGAGTGGGGGGATGG + Intronic
928917886 2:36492840-36492862 TTGGGCAGGGATTGGGGGGTTGG - Intronic
928954264 2:36845976-36845998 TTGGGGAGGGGGTGGGAGGGGGG - Exonic
929761524 2:44811200-44811222 TTGAGTGGGAAGTGGGTGGCGGG - Intergenic
929853447 2:45614067-45614089 TTAGGCACTGTGTGGGTGGCGGG - Intergenic
929854599 2:45626114-45626136 TTAGGCAGGGACTTGGTGCCTGG + Intergenic
931070070 2:58636907-58636929 TAGGTCAGGGACTGGGTTGCAGG + Intergenic
931579779 2:63760055-63760077 TTGGGAAGGTGGTGGGAGGCAGG + Intronic
931819960 2:65941954-65941976 TGGGGCAGGGGGCGGGGGGCGGG - Intergenic
932330173 2:70894292-70894314 AAGGGCAGGGAGAGGATGGCTGG - Intergenic
932719744 2:74130428-74130450 TTGGGCAGGGAGTGGAGAGGCGG + Intergenic
933574761 2:84055022-84055044 GAGGGCAGGTAATGGGTGGCTGG - Intergenic
933770830 2:85742881-85742903 TGGGGCGGGGAGAGGGTGCCAGG + Intergenic
933786674 2:85848457-85848479 TTAGGCTGGGGGTGGGAGGCGGG - Intronic
934035598 2:88086374-88086396 GTGTGCAGTCAGTGGGTGGCAGG + Intronic
934762451 2:96864151-96864173 GGGGGCAGGGTGTGGGGGGCAGG + Intronic
935489449 2:103698611-103698633 TTGGGCAGGCACTGGGCTGCAGG - Intergenic
935544531 2:104386880-104386902 CTGGGCAGTGAGGAGGTGGCTGG - Intergenic
935597225 2:104888708-104888730 TGGGGAAGGAAGTGGGTGGGTGG - Intergenic
935598918 2:104902156-104902178 TTGGGCAAGGAGAAGGTTGCAGG - Intergenic
937315384 2:120928691-120928713 TTGGGGAGGCAATGGGTGTCCGG - Intronic
937920012 2:127122289-127122311 TTGGGGAGGCAGTGAGGGGCAGG - Intergenic
938378941 2:130825931-130825953 TGGGGCGGGGAGAGGATGGCTGG - Intergenic
939925812 2:148172473-148172495 TGGGGAAGGCAGAGGGTGGCTGG + Intronic
940111823 2:150163190-150163212 TTTGTCTGGGAGTGGATGGCTGG + Intergenic
940150663 2:150597147-150597169 TTAGGCTTGGGGTGGGTGGCGGG + Intergenic
940642284 2:156358365-156358387 TTGAGCAGGAGGTGGGTAGCGGG - Intergenic
941016706 2:160365881-160365903 TAGGGCAGGGCGTGCCTGGCAGG + Intronic
941714900 2:168753920-168753942 TTGGGCATGGCGTGGGCGGCAGG - Intronic
942032605 2:171977911-171977933 TTGGGCAGGGAGTTGGGGTATGG - Intronic
942200519 2:173566390-173566412 TTTGTCATGAAGTGGGTGGCAGG + Intergenic
942289502 2:174454924-174454946 TTGGGCAGGTAGGGGGTGGCAGG + Intronic
942627148 2:177913518-177913540 TTGAGAAGGGAGTGGGTAGTGGG - Intronic
943732735 2:191320054-191320076 TTTGGAAGGTATTGGGTGGCTGG + Intronic
945037577 2:205717225-205717247 TGAGGAAGGGAGTGGGTGGTGGG - Intronic
945147411 2:206752926-206752948 AGGGGCAGGGGGTGGGTGGGTGG - Intronic
945254447 2:207791917-207791939 TTGGGCGCGGTGGGGGTGGCTGG + Intergenic
946220627 2:218222990-218223012 TAGGGCAGGCAGCAGGTGGCAGG - Intronic
946367761 2:219260595-219260617 TTTGGCAGGGAGTGGGGTGAGGG - Intronic
946388655 2:219402022-219402044 GTGTGCAGGGGGTGGGTGGTGGG - Intergenic
946689140 2:222297843-222297865 GTGTGAAGGGAGTGGGTGGCGGG + Intronic
947535129 2:230935291-230935313 TGGGGCTGGGAGTGGCTGCCGGG - Intronic
947769455 2:232659448-232659470 GAGGGCAGGGAGGGGGTGGCTGG + Intronic
948200206 2:236124247-236124269 TTGGGGTGAGAGTGGGTGGGCGG - Exonic
948725991 2:239934299-239934321 GTTGGGAGGGAGTGGGGGGCAGG + Intronic
948873850 2:240817291-240817313 CTGGGCATGGAGTGGGTGATGGG + Intronic
1169124314 20:3116128-3116150 CTGGGGAGGGAATGGGGGGCAGG - Intronic
1169343541 20:4813353-4813375 TTGGGCAGGGAGGGCTGGGCCGG - Intronic
1169554670 20:6736451-6736473 GTGGGAAGGGTGGGGGTGGCAGG + Intergenic
1169912016 20:10654755-10654777 CTGGGCAGGGAGAGGGAGGTGGG + Intronic
1170459819 20:16567041-16567063 GTGGGCAGGGGGTGGTTGGAAGG - Intronic
1170783637 20:19449069-19449091 GTGGGCAGGGAGAGGGAGGCAGG + Intronic
1171010847 20:21508708-21508730 TGGGGCGGGGGGTGGGGGGCGGG + Intergenic
1171017293 20:21553344-21553366 TTTTGCAGGGAGTTGGTGGTGGG + Intergenic
1171101031 20:22384241-22384263 TTGGGTAGGGAGGGGTTGGGAGG + Intergenic
1171424802 20:25042743-25042765 TGGGGCCGAGAGTGGGTGGGTGG - Intronic
1171486472 20:25489808-25489830 CTGGGCAGAGTGGGGGTGGCGGG - Intronic
1172132220 20:32663673-32663695 TTGGGCTGGGGCTGGATGGCAGG + Intergenic
1172270712 20:33654316-33654338 AGGTGCAGGGAGTGGGTGGAAGG + Intergenic
1172481350 20:35273722-35273744 TTGCCCAGGGAGTGATTGGCAGG + Intronic
1172782807 20:37447338-37447360 CTGGGCTGGAAGTGGGAGGCAGG - Intergenic
1172950855 20:38722813-38722835 TTGGGATGGGAGGAGGTGGCAGG + Intergenic
1173384224 20:42573336-42573358 ATGGGCAGGGAGTTGGAGGTTGG - Intronic
1173457871 20:43217806-43217828 TTGGGCAGGGAGGGAGTGACAGG + Intergenic
1173719050 20:45237234-45237256 GTGGGGAGGGAGGGGGTGGTGGG - Intergenic
1174107376 20:48172152-48172174 CTGGACAGGGAGTGGGGAGCAGG + Intergenic
1174340477 20:49892078-49892100 TTGGGCTGGGAGGGGAAGGCGGG + Exonic
1175141926 20:56867217-56867239 TGGGGCAGGGTGTGGGAGTCAGG - Intergenic
1175612804 20:60365435-60365457 CAGGGCAGGGAGGGGCTGGCCGG - Intergenic
1175689393 20:61054660-61054682 TTTGGCAGTGATTGGGTGCCTGG - Intergenic
1175905824 20:62378856-62378878 ATGGGAAGGGAGTGGCCGGCCGG - Intergenic
1176022338 20:62968167-62968189 CAGGGCAGTGGGTGGGTGGCGGG + Exonic
1176108315 20:63399737-63399759 TTGGGCAGGGAGTGGGGGCAGGG + Intergenic
1176128889 20:63487951-63487973 TTGGGCAGGGAGGGGGTCCGGGG + Intergenic
1176411959 21:6453973-6453995 CTGTGCGGTGAGTGGGTGGCGGG - Intergenic
1177220210 21:18182871-18182893 ATGTGGAGAGAGTGGGTGGCAGG - Intronic
1178091414 21:29167634-29167656 TTCGGGAGGGAGAGGGTGTCAGG + Intronic
1178172964 21:30062386-30062408 TTGGGTGGGGAGGGGGTGGAGGG - Intergenic
1178250174 21:30996213-30996235 TGGGGCAGGGAGTGGGGAACGGG + Intergenic
1178265752 21:31141609-31141631 CTGAGCAGAGAGTGGGTGGCAGG + Intronic
1178307682 21:31504039-31504061 TTGGGCAGGGATTGGCAGGAGGG - Intronic
1178377161 21:32076392-32076414 TTGGGCTGGGAGCTGATGGCAGG + Intergenic
1178466506 21:32853444-32853466 CTGGGCAGGGAGGGGGTCACTGG - Intergenic
1179021318 21:37643515-37643537 ATGGGCAAGGGGTGGGTAGCTGG + Intronic
1179398653 21:41064069-41064091 TTGGGCAGGGACTGCGTAACAGG - Intergenic
1179687453 21:43062295-43062317 CTGTGCGGTGAGTGGGTGGCGGG - Exonic
1179873973 21:44258258-44258280 AGGGGCCGGGAGAGGGTGGCTGG - Intronic
1180256597 21:46634212-46634234 TTGGGCGGGGGTTGGGGGGCGGG - Intergenic
1180750358 22:18120029-18120051 CAGGGCAGGGTGTGGGTGGGAGG + Intronic
1181056293 22:20261951-20261973 TTAGGCAGGCAGTGCCTGGCTGG + Intronic
1181164593 22:20976622-20976644 ATGGGCAGGGGGTGGCAGGCTGG - Intronic
1181274835 22:21681799-21681821 TCTGGCAGGGAGTGGGTGTAGGG + Intronic
1181466628 22:23113935-23113957 CTGGGCAGGGTGTGGCTGGAGGG - Intronic
1181509729 22:23383789-23383811 TTGGCCAGCAAGTGGGGGGCAGG - Intergenic
1181522371 22:23457015-23457037 TGGGCCAGGGAGTGTGTGCCCGG - Intergenic
1181539413 22:23565512-23565534 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1181855647 22:25779890-25779912 TTGGGCAGGGAGTGGGTGGCAGG + Intronic
1181861757 22:25824219-25824241 TTGGGGAGTGAGTGGGAGACAGG + Intronic
1181960369 22:26618118-26618140 CTGGGCAGGGAGTGGGGGACTGG + Intergenic
1181979644 22:26756991-26757013 TCAGGCTGGGAGCGGGTGGCCGG - Intergenic
1182085811 22:27560424-27560446 CTGGGCAGTGAGTGAGTGGGCGG - Intergenic
1182423089 22:30257931-30257953 TGGGGCAGGGAGTGGTGGCCTGG - Intergenic
1182436558 22:30334530-30334552 TGGGGCAGGGGGTGGGAGACAGG + Exonic
1182623459 22:31630311-31630333 AGGGCCAGGGAGCGGGTGGCCGG - Intronic
1183351840 22:37338916-37338938 TTGGGGAGGGCCAGGGTGGCTGG - Intergenic
1183379516 22:37484038-37484060 TGGGGCAGGGGAGGGGTGGCCGG + Intronic
1183382100 22:37495484-37495506 CTGGGCAGGTAGTGGGTGGGGGG - Intronic
1183432507 22:37774296-37774318 TAGGGCAGGAAGAGGGTGGCAGG - Exonic
1183665080 22:39242428-39242450 TTGGGGAGGGGGTGGCCGGCCGG - Intronic
1183724437 22:39580646-39580668 TGGGGCAGGGGCTGGATGGCAGG + Intronic
1183732574 22:39627115-39627137 TGGGGACGGGAGTGGGTGTCTGG - Intronic
1183794921 22:40108929-40108951 GTTGGCTGGGGGTGGGTGGCGGG - Intronic
1184109754 22:42387802-42387824 GTGGTCAGAGAGTGGGTGGCAGG - Intronic
1184198441 22:42947851-42947873 TTGGCCAGGGAGAAGGTGACTGG + Intronic
1184205573 22:43000273-43000295 ATGCACAGGGAGTGGGTAGCAGG + Intronic
1184208933 22:43023854-43023876 TGGGGCAGGGAGTGGGCAGGTGG + Intergenic
1184273479 22:43397759-43397781 TTGTGCAGGGGGCAGGTGGCAGG + Intergenic
1184278185 22:43422214-43422236 TTGCACAGAGAGTAGGTGGCAGG - Intronic
1184730428 22:46368516-46368538 TTGCGCAGGGGCTGGGTGTCAGG - Intronic
1184755831 22:46515220-46515242 GTGGGCTGGGAGTGGTGGGCAGG - Intronic
1184782248 22:46655259-46655281 TGAGGCTGGGAGTGGGTGGGTGG + Intronic
1184930632 22:47678628-47678650 TTGGGCATGGAGTAGGAGGGGGG + Intergenic
1185212560 22:49579128-49579150 TGGGGGAGGGACTGGGTGGGAGG - Intronic
1185341884 22:50294682-50294704 TGGGAAAGGCAGTGGGTGGCTGG - Intronic
949364652 3:3267737-3267759 ATGGGAAGGTAGTGGGTGGTTGG + Intergenic
949928589 3:9060769-9060791 CTGTGCAGGGCTTGGGTGGCAGG - Intronic
950096078 3:10331432-10331454 TGGGGCAGGGGGATGGTGGCAGG + Intronic
950252155 3:11474860-11474882 ATGGGGTGGGAGTGGGGGGCCGG + Intronic
950366675 3:12490753-12490775 TTGGGCCGGGAGTGGGAGCAGGG - Intronic
950445646 3:13035995-13036017 TGAGGAAGGGAGTGAGTGGCTGG + Intronic
952316412 3:32236611-32236633 TTGGGAAGGGCTTGGCTGGCAGG - Intergenic
952520325 3:34150373-34150395 TTGTGCAGGGAGTGGGGGGCAGG + Intergenic
952562223 3:34608506-34608528 TTTGGCTGGGGGTGGGTGGTAGG + Intergenic
952934225 3:38383106-38383128 TTGGGCACTGAGTGTGTGCCCGG + Intronic
953820333 3:46202763-46202785 TTTGGCAGTGGGAGGGTGGCGGG + Exonic
953905640 3:46867128-46867150 TTGGTCAGGGTTTGGGTGCCAGG - Intronic
953979815 3:47407969-47407991 TTGGGCAGGGAGGCGGAGGCAGG + Intronic
954010255 3:47630163-47630185 TGGGGCAGGGTGGGGGTGGGGGG + Intronic
954427119 3:50449298-50449320 GTGGGCAGGAAGAGGGTAGCAGG + Intronic
954797321 3:53168196-53168218 TGGGGCAGGGAGTGGGCATCTGG + Intronic
955397801 3:58569449-58569471 GTGGGCATGAAATGGGTGGCTGG + Intronic
955711463 3:61783639-61783661 TTGGGGTGGGAGTGGGGAGCTGG + Intronic
956074649 3:65491757-65491779 TTGGGATGTGACTGGGTGGCTGG - Intronic
956640178 3:71408043-71408065 TAGGGAAGGGAGTCGTTGGCAGG - Intronic
956815446 3:72904182-72904204 TTGGGCAGGGAATGGGTGATAGG - Intronic
956929529 3:74027323-74027345 TTTGGCTGGCAGTGGGTGGCGGG - Intergenic
957766745 3:84634997-84635019 TGGTGGAGGGAGTGGGTGGAGGG - Intergenic
959542021 3:107550751-107550773 TGGAGCAGGGTATGGGTGGCAGG + Intronic
959765376 3:110020739-110020761 TTGGGGAGGGTGGGGGTGGGAGG + Intergenic
959889840 3:111542156-111542178 TTTAGCACGAAGTGGGTGGCTGG + Exonic
960093344 3:113664583-113664605 TTGGGCAGCTAATGAGTGGCAGG + Intronic
960681924 3:120257523-120257545 TTGGAAAGGGAGTGGGAGGTGGG + Intronic
961026550 3:123563369-123563391 ATGAGCATGGAGTGGGAGGCAGG + Intronic
961094484 3:124142754-124142776 TGGTGCAGGGAGTGGGTGGGGGG - Intronic
961311987 3:126008062-126008084 TTGGGGAGGCAGTGGATAGCTGG + Intronic
962219257 3:133550099-133550121 GTGGGCTGGGAGTGAGGGGCAGG - Intergenic
963140167 3:141940419-141940441 TTGGGGAGGGTGTGGGTGGTGGG - Intergenic
963186590 3:142424712-142424734 TCGGGCGGGGAGTGGGTAGGAGG + Intronic
963367826 3:144361526-144361548 TAGGGCATGGAGTGGGTGGAAGG - Intergenic
963602435 3:147390174-147390196 TTCAGCAGGGGGTGGGTGGGTGG - Intronic
964670147 3:159216087-159216109 TGGGGCGGGGGGTGGGTGGATGG + Intronic
964675121 3:159269528-159269550 TTGGAAAGGGAGTGGGAGCCTGG + Intronic
965119350 3:164531620-164531642 TTGGGGAGGCAGTAGGAGGCAGG - Intergenic
965694756 3:171396108-171396130 TTGGGGGGGCAGTGGGTGGGAGG - Intronic
965777192 3:172243595-172243617 TGTGGGAGGGAGTGGGTGGGAGG - Intronic
965821714 3:172691017-172691039 TTGGGCAGTGTGTGGATGTCAGG - Intronic
966284242 3:178274461-178274483 TTGGGCAGGGAATGAGCAGCTGG - Intergenic
966743450 3:183254248-183254270 TTGGGCCGGGGGCGCGTGGCTGG + Intronic
966780522 3:183580210-183580232 TGGGCCACGGAGTGGGTGGCAGG - Intergenic
967053305 3:185804842-185804864 ATTAGCTGGGAGTGGGTGGCGGG + Intronic
967155315 3:186686269-186686291 TAGTGCAGAGAGTGGGTGGGTGG + Intergenic
967889513 3:194355089-194355111 TTGGAAAGTGAGTGGGAGGCCGG - Intergenic
968166236 3:196467459-196467481 TTGAGAAGGGAGTATGTGGCTGG - Intergenic
968691514 4:1992622-1992644 TGACGCAGGGAGTGGGTGTCAGG - Intronic
968754250 4:2407090-2407112 TCGGGGAGGGAGTGGGTAGATGG - Intronic
969239184 4:5888166-5888188 GTGGGCTGGGAGTGGGCGCCCGG - Intronic
969271907 4:6108644-6108666 TTGAGCATGGAGGGTGTGGCGGG - Intronic
969286593 4:6206274-6206296 TGGGGCAGGGCGAGAGTGGCAGG + Intergenic
969311732 4:6356889-6356911 CTGGGCAGGGAGGGGCTGTCAGG + Intronic
969331194 4:6474218-6474240 GTGGACAGAGAGTGGGGGGCTGG - Intronic
969346536 4:6574048-6574070 TTGGGCAGGGAGTAGTGGACAGG + Intergenic
971244669 4:24917225-24917247 CTGGGCAGGGAGGGCTTGGCAGG - Intronic
971817329 4:31505865-31505887 TTGGGCTGTGACAGGGTGGCTGG - Intergenic
972922465 4:43960641-43960663 TTGGTCAGTGAGTAGGTGGGGGG + Intergenic
973551863 4:52043617-52043639 TTGGGAACTGAGTGGGAGGCAGG - Intergenic
973613665 4:52659273-52659295 TTTGGCTGGGAGAGGGAGGCCGG + Exonic
973652652 4:53012059-53012081 TGGGGCAGGGAGTAGGGGGATGG - Intronic
973722996 4:53744029-53744051 TTGGGCAGGTGGTGGGGAGCAGG + Intronic
974239262 4:59224680-59224702 TTGGGGTGGGATTTGGTGGCAGG - Intergenic
974310225 4:60197307-60197329 TTGAGCAGGGATTGGCTGGGAGG - Intergenic
974791477 4:66695672-66695694 TTGGGCTGGCAGTGAGTGCCTGG - Intergenic
975386616 4:73766720-73766742 TTGGGCAATGACAGGGTGGCTGG + Intergenic
975661124 4:76689720-76689742 CTGGGCACGGAGAGGGAGGCGGG + Intronic
975847099 4:78536229-78536251 TTGGGGTGGGAGTGAGAGGCAGG - Intronic
976965584 4:91036450-91036472 TTTGGCAGGGAGTAGGAGTCTGG - Intronic
977708121 4:100093827-100093849 TGGGGGACAGAGTGGGTGGCAGG + Intergenic
978091844 4:104726741-104726763 TTGAGCAGAGAGAGGGTGGATGG + Intergenic
978328394 4:107585186-107585208 TTGGGCAGGGGGTCGGGGGAGGG + Intergenic
979223549 4:118258681-118258703 TTGGCCTGGGAGTGAGTGGGAGG + Intergenic
979868346 4:125784360-125784382 TTGGGCAGGGATTAGATTGCTGG + Intergenic
980442092 4:132862402-132862424 TGGGGTAAGGAGTGGGTGACGGG + Intergenic
980572594 4:134639978-134640000 TTTGGCAGGGGGTGGGTGGGGGG + Intergenic
980875773 4:138660481-138660503 TTAGGTAAGGAGTGGGTGGGTGG + Intergenic
981148452 4:141353324-141353346 TTTAACAGGAAGTGGGTGGCTGG - Intergenic
983527380 4:168772945-168772967 TTGGGCATGGAGTGGGTCACTGG + Intronic
983534034 4:168838458-168838480 TCGGGGAGGGAGTGCGGGGCCGG + Intronic
984858620 4:184217537-184217559 CTGGGCAGGGAGGGGAGGGCTGG - Intronic
984884312 4:184436652-184436674 CTAGGCAGGGAGAAGGTGGCAGG + Intronic
985178925 4:187235485-187235507 GTGGGCGGCGAGGGGGTGGCTGG + Intergenic
985560938 5:585362-585384 TAGGTCAGGGAGTGGGTGGGTGG + Intergenic
985574098 5:665690-665712 TTGGCCTGGGAGGGGGTGGGTGG - Intronic
985590538 5:762209-762231 CTGGGCTGTGAGTGGCTGGCCGG - Intronic
985837281 5:2280640-2280662 ATGGGCAGGGGATGGGTGGGCGG + Intergenic
986336288 5:6758344-6758366 GTGGGCAGGGTGGGGCTGGCAGG + Intergenic
987308532 5:16660862-16660884 CGGGGCGGGGAGTGGGGGGCGGG + Intergenic
987342039 5:16947823-16947845 TAGGGCAGAGAGTGTGTGGGTGG + Intergenic
987374374 5:17219269-17219291 TCGGGAGGGGAGTGGGTGGCTGG - Intronic
987964647 5:24855748-24855770 TAGGCCAGTGAGTGGGTGGCGGG - Intergenic
988322534 5:29717749-29717771 TGGGTCAGGGGGTGGATGGCAGG + Intergenic
988739144 5:34052699-34052721 TTTGACAGTGAGTGGGTGCCAGG - Intronic
988989054 5:36651535-36651557 TTGGGCTGGGGGTGGGAGGGTGG - Intronic
989191776 5:38677265-38677287 TGGGGCAAGGGATGGGTGGCGGG + Intergenic
990466865 5:56078934-56078956 TTAGGGAGGGGGTGGGAGGCTGG + Intergenic
991013691 5:61910095-61910117 TTGGGCAACGACGGGGTGGCTGG + Intergenic
992212083 5:74490733-74490755 TTTGGCAGGGGGTGGGAGGAAGG - Intergenic
993019567 5:82575503-82575525 TTGAGCTGGGTGTGGGAGGCAGG - Intergenic
993305710 5:86272648-86272670 AGGGGCAGGGAGTGGGGGGGAGG + Intergenic
993864504 5:93176239-93176261 TGGGGCTGGGGGTGGGTGGGTGG - Intergenic
994173388 5:96682970-96682992 GTGGGCAGGGTGTGGGAGGATGG - Intronic
994475000 5:100256538-100256560 CTGGGGAGGGGGTGGGTGGGTGG - Intergenic
995585398 5:113643180-113643202 TTTGTCAGGGGGTGGGGGGCAGG + Intergenic
996487699 5:124056256-124056278 TTGGGGATGGAGTGGGAGGAAGG + Intergenic
998068689 5:139179564-139179586 GTAGGCAGGTAGGGGGTGGCAGG + Intronic
998138847 5:139688749-139688771 ATGGGCTGGGGGTGGGGGGCGGG - Intergenic
998806498 5:145922172-145922194 CTGGGCAGAGGGTGTGTGGCAGG - Intergenic
999459812 5:151748285-151748307 ATGGGCAGGGAGTCGGTGGGAGG + Intronic
1000014872 5:157267269-157267291 ATGGGCAGGGAGACGGAGGCAGG + Intronic
1000071374 5:157743873-157743895 TGGGGTAGGGAATGGGAGGCAGG - Exonic
1000736947 5:164915413-164915435 TTGGGCAGAGAGTAGGAGGAAGG + Intergenic
1001342916 5:170863272-170863294 CAGGGGAGGCAGTGGGTGGCAGG + Intronic
1001383828 5:171321647-171321669 TGGTGCAGGGAGAGGGAGGCCGG - Intergenic
1001425809 5:171621624-171621646 ATGGGCAGGAAGTGGGTTGGAGG + Intergenic
1001490981 5:172155094-172155116 ATGGACAGAAAGTGGGTGGCTGG + Intronic
1001566146 5:172700738-172700760 TGGGGCGGGGAGCGGGGGGCGGG - Intergenic
1001571816 5:172735208-172735230 GAAGGCAGGGAGGGGGTGGCAGG + Intergenic
1001585161 5:172829024-172829046 TTTGGACGGGAGTGGGTGGAAGG + Intergenic
1001855004 5:175003311-175003333 TTGGGCGGGGAGGGGGTGGGGGG + Intergenic
1001979942 5:176031163-176031185 TGGGGGAGGGTGTGGGTGGGGGG + Intronic
1001988274 5:176094482-176094504 TTGAGCAGGGAGAGTGGGGCAGG + Intronic
1002019918 5:176356935-176356957 GTTGCCAGGGAGTGGGTGGGGGG + Intronic
1002062655 5:176635315-176635337 ATGGGCAGCAAGTGGGTGACTGG + Intronic
1002098285 5:176844850-176844872 CTGGGCAGGGAGTCTGTGGCTGG - Intronic
1002168782 5:177363809-177363831 TTGTGGAGGCAGTGGGAGGCAGG - Intronic
1002191337 5:177479314-177479336 GAGGCCAGGGTGTGGGTGGCGGG - Intergenic
1002227391 5:177733647-177733669 TTGAGCAGGGAGAGTGGGGCAGG - Intronic
1002228594 5:177743658-177743680 TTGAGCAGGGAGAGTGGGGCAGG - Intronic
1002237448 5:177812528-177812550 TGGGGGAGGGTGTGGGTGGGGGG - Intergenic
1002266754 5:178040124-178040146 TTGAGCAGGGAGAGTGGGGCAGG + Intronic
1002593425 5:180306520-180306542 TGGGGCAGGGACAGGGTGCCAGG - Intronic
1002774220 6:315018-315040 CTGGTCAGGGAGTGGCTGGGTGG + Intronic
1002796440 6:474619-474641 TGGGGCAGGGCGTGGGGCGCTGG + Intergenic
1002967248 6:1978561-1978583 ATGGGGTGGGAGGGGGTGGCTGG - Intronic
1003062799 6:2875979-2876001 TGGGGGAGGGAGCGGGTAGCTGG - Intergenic
1003179120 6:3777235-3777257 TTGGGGTGGGTGGGGGTGGCAGG + Intergenic
1003331506 6:5133086-5133108 TTGGGCAGGGTGTGTGTGCTGGG + Intronic
1003565568 6:7219489-7219511 GTGGTCAGGCAGTGGCTGGCGGG + Intronic
1003891658 6:10569215-10569237 TGGCGGGGGGAGTGGGTGGCAGG - Intronic
1003894234 6:10591652-10591674 AGGAGGAGGGAGTGGGTGGCAGG - Intronic
1004104745 6:12655720-12655742 TTGGGAAGGAAGTGGGAGGGAGG + Intergenic
1004273682 6:14216660-14216682 TTTAGCAGGGACTGGATGGCTGG + Intergenic
1005987546 6:30884168-30884190 GTGGGCTGCGAGTGGGTGGAGGG + Intronic
1006388257 6:33744279-33744301 TGGGGCAGGGTGTTGGAGGCTGG - Intronic
1006401684 6:33821479-33821501 CTGGCCTGGGGGTGGGTGGCAGG - Intergenic
1006442415 6:34060656-34060678 TTGGGATGGGAGTAGGGGGCAGG + Intronic
1007257365 6:40538348-40538370 GAGGGAAGGTAGTGGGTGGCAGG - Intronic
1007418654 6:41706509-41706531 TTGGGCAGGATGGGGGTGGGGGG - Intronic
1007673425 6:43575707-43575729 TGGGGCTGGGAGAGGGTGTCGGG + Intronic
1007724472 6:43906741-43906763 TTTGGCAGTGTGTGGGAGGCGGG + Intergenic
1007772516 6:44202810-44202832 TTGGGCAGGGAGGTGGGGGAGGG - Intergenic
1008046301 6:46854663-46854685 GTGGGCAGAGAGTGTGTGTCGGG + Intronic
1008320349 6:50104422-50104444 GTGGGCAGGGTGGGGGTGGGAGG + Intergenic
1009983128 6:70749290-70749312 TTGGGAAGGGACTTGGTGGGAGG - Intronic
1009994987 6:70887554-70887576 TTGGGCAAGGAGTGGAGGGCAGG + Intronic
1010186180 6:73146008-73146030 TGGGGGAGGGACTGGGTGGGAGG - Intronic
1010314893 6:74436557-74436579 CTGGTCAGGGAGTGGGTGACTGG - Intergenic
1010804006 6:80213600-80213622 TTGGGCAGAGAGTGAGGGGGAGG - Intronic
1011640788 6:89414034-89414056 GAGGGCAGGGAGTGGGTCCCTGG + Intergenic
1013004622 6:106060788-106060810 GTGAACTGGGAGTGGGTGGCTGG + Intergenic
1013983080 6:116156935-116156957 CTTGCCAGGGAGTGAGTGGCTGG - Intronic
1014060444 6:117065339-117065361 GGGGGGAGGGAGGGGGTGGCGGG - Intergenic
1014752092 6:125268178-125268200 GTGGGCAGGTGGTGGGTAGCTGG - Intronic
1014920842 6:127213354-127213376 TTGGGCAGGGGGAGGGTCACGGG + Intergenic
1016015845 6:139185142-139185164 TTGGGCAGGGAGTGGGATAGTGG + Intergenic
1016647248 6:146424378-146424400 AGGGGCAGGTAGTGGGAGGCTGG + Intronic
1016728873 6:147406853-147406875 CTGGTCAGGGAGTGCGTGTCAGG + Intergenic
1017371593 6:153715970-153715992 TATGGGAGGGAGTGGGTAGCTGG - Intergenic
1017975390 6:159352676-159352698 GTGGGCAGGTAGAGCGTGGCTGG - Intergenic
1018215396 6:161521679-161521701 AAGGTCAGGGAGTGGCTGGCTGG + Intronic
1018677558 6:166236113-166236135 GTGGGCAGGGGGTGGGGGGGGGG - Intergenic
1018787678 6:167121095-167121117 TGGGGCAGGGAGGGTGTTGCAGG + Intergenic
1019058716 6:169241010-169241032 TGGGGCAGGGAGGGGGTCGATGG - Intronic
1019177045 6:170165333-170165355 TGGGGCTGGCAGGGGGTGGCCGG - Intergenic
1019354217 7:570513-570535 CTGGGCAGGCAGTGGGGGGACGG - Intronic
1019515749 7:1439144-1439166 TTGGGCAGGACGTGGGTGTAGGG - Intronic
1020890633 7:13873704-13873726 TTGGGCATGTTGTGGGTGGGGGG - Intergenic
1021759760 7:23892223-23892245 TTTGTCAGGGAGTGGCTGGAAGG + Intergenic
1022411512 7:30141973-30141995 TTAAGCAGGGTGGGGGTGGCAGG - Intronic
1022485628 7:30775416-30775438 TAGGGCAAGGTGTGGGTGGAGGG + Intronic
1022539808 7:31125137-31125159 TTTTCCAGGGACTGGGTGGCAGG + Intergenic
1023340796 7:39217322-39217344 GCTGGCAGGGAGTGGGTGGGTGG + Intronic
1023652484 7:42386767-42386789 TTGGCCAGGGTGTGGGCTGCGGG - Intergenic
1023842931 7:44106939-44106961 GGAGGCAGGGAGTGGGAGGCAGG + Intronic
1023991244 7:45130084-45130106 CTGGCCAGGCAGAGGGTGGCTGG - Intergenic
1024599213 7:50964708-50964730 GTGGGATGGGAGTGGGGGGCGGG - Intergenic
1024866202 7:53907138-53907160 TTGGGCAATGACGGGGTGGCTGG - Intergenic
1026017090 7:66679960-66679982 TTAGCCAGGGAGTTGGAGGCAGG + Intronic
1026479339 7:70764825-70764847 TTGGGCAGGGAGAGGGGGAACGG - Exonic
1026665837 7:72338961-72338983 TTGGGAAGGGTGAGGGGGGCTGG - Intronic
1027684899 7:81267498-81267520 GTGGGCAGGTGGTGGGTAGCTGG + Intergenic
1027909245 7:84227918-84227940 TGTGTCAGGGAGTGGGGGGCGGG + Intronic
1028155809 7:87428012-87428034 TTGGGCAGGTAGTGGGAAGCTGG - Intronic
1028841221 7:95431983-95432005 TGGGGTAGGTGGTGGGTGGCTGG - Intronic
1030939647 7:115630246-115630268 TAGGGCAGGGAGTGTGAGGCAGG - Intergenic
1032004215 7:128286880-128286902 GTGGGCAGGGTTTGGGAGGCTGG + Intergenic
1032264471 7:130361458-130361480 TTGGTCAGGAAGTAGGTGGGAGG + Intronic
1032824818 7:135558453-135558475 GTGGTCAGGAAGAGGGTGGCGGG + Intronic
1033137674 7:138798341-138798363 TTAGGCAGGGGGTGGGAGGTGGG + Intronic
1033656895 7:143381015-143381037 TCGGGCGGGGAGGGGGAGGCAGG + Intergenic
1034210781 7:149360203-149360225 TGGGGCAGTGGGTGGGTGGGTGG - Intergenic
1034339446 7:150342121-150342143 TGGCTCAGGGAGTGGGAGGCAGG - Intergenic
1034464491 7:151218531-151218553 CAGGGCAGGGCATGGGTGGCTGG - Intronic
1034606222 7:152318432-152318454 ATGGGGAGGGGGTGGGTGGGTGG - Intronic
1034904951 7:154935743-154935765 TGGGGCAGGGACTTGGTGGGAGG - Intronic
1035687647 8:1537458-1537480 TGGGGCAGGGTGGTGGTGGCAGG - Intronic
1036777286 8:11622369-11622391 GTTGGCAGTGAGGGGGTGGCAGG - Intergenic
1036810180 8:11862596-11862618 GTGGGTTGGGAATGGGTGGCAGG + Intronic
1037681549 8:21101861-21101883 CAGGGGAGGGAGTGGGAGGCAGG - Intergenic
1037890700 8:22622485-22622507 TTGGGCAGGGAGTGGGGGCAGGG - Intronic
1038687902 8:29735301-29735323 TTGGGGAGGGAGAGGGAGGGAGG - Intergenic
1039438803 8:37580379-37580401 TGGGGCAGAGAGTGTCTGGCAGG + Intergenic
1039913529 8:41843397-41843419 GTGGGCGGGGAGTGGGTGGGGGG - Intronic
1039921731 8:41897699-41897721 ATGGAGAGGGAGTGGGTGGGCGG - Intergenic
1040040557 8:42912669-42912691 GTGGGCAAGGAGTGTGTGGTGGG - Intronic
1040374010 8:46805771-46805793 TTGTGCAGGGAGGAGGTGCCTGG - Intergenic
1040875784 8:52150572-52150594 GCGGGCAGGGAGAGGGAGGCAGG + Intronic
1040932111 8:52746442-52746464 TTGGAAAGGGAGAGGTTGGCAGG + Intergenic
1041238383 8:55827653-55827675 TGGGGCGGGGGGTGGGGGGCCGG - Intergenic
1041388827 8:57331211-57331233 TTGGGCAGGGAATGGGGCCCTGG - Intergenic
1042082610 8:65071541-65071563 CTGGGCAGGGCGCGGGGGGCGGG + Intergenic
1042104182 8:65307211-65307233 TGGGGGAGGGACTGGGTGGGAGG - Intergenic
1042108585 8:65355527-65355549 TTGGGCAGGGGGTGGGTAGCTGG + Intergenic
1042210414 8:66375140-66375162 TTGAACAGGGAGTGAGTGGTAGG - Intergenic
1043147707 8:76677989-76678011 TGGGGCAGGGAGTGGGAGTCAGG + Intergenic
1044745277 8:95365032-95365054 TTGAGCAGGGAGGAGGAGGCAGG + Intergenic
1045319393 8:101070213-101070235 TGGGGCAGGGAGGGGGTGCTGGG + Intergenic
1045535934 8:103027880-103027902 TGGGGGTGGGAGAGGGTGGCAGG - Intronic
1045708096 8:104950730-104950752 GTGGGTGGGGAGGGGGTGGCAGG - Intronic
1046162215 8:110381158-110381180 TAGGGCAGGGAGTCAGTGCCTGG + Intergenic
1046442123 8:114270840-114270862 TGTGGGAGGGAGTGGGTGGGAGG - Intergenic
1046614671 8:116463240-116463262 TGGGGCAGGGAGTGGATGGTGGG - Intergenic
1046752874 8:117943773-117943795 TGGGGCAGGAAGTGCGTAGCTGG + Intronic
1048543862 8:135367738-135367760 TTGGTCAGGAAGTTGGTGGTGGG - Intergenic
1048885254 8:138904358-138904380 TTGGGCCAGCAGGGGGTGGCGGG - Intronic
1049102196 8:140587908-140587930 TTGGACAGGCAGTGGGAGCCAGG - Intronic
1049462868 8:142738227-142738249 CGGGTCAGGGAATGGGTGGCTGG + Intergenic
1049604911 8:143524817-143524839 TGGGGCAGAGCGTGGCTGGCAGG - Intronic
1049641116 8:143716433-143716455 TCGGGCAGGGGGTGAGTGCCTGG + Exonic
1049684518 8:143933964-143933986 TGGGGCAGGCAGTGGGCGGGAGG - Intronic
1049724690 8:144140281-144140303 TTGGGCAGGGACTAGGCTGCAGG - Exonic
1049795348 8:144494802-144494824 GTGGGCTGTGAGTGGCTGGCAGG + Intronic
1050056343 9:1659659-1659681 TTTGGCAGGGAGTGTGTGAAAGG - Intergenic
1050526858 9:6553790-6553812 TGGGGCTGGGAGTGGGAGGGAGG - Intronic
1051001522 9:12288296-12288318 TTGGGGAGGGACTTGGTGGAAGG + Intergenic
1051243989 9:15090762-15090784 TTGGGCAGTGACTTGGTTGCTGG - Intergenic
1052821516 9:33141173-33141195 TTGGTAGGGGAGTGGGCGGCAGG + Intronic
1052912676 9:33897725-33897747 TTGGGCAGTGAATGCGTGGGAGG - Intronic
1053786399 9:41655560-41655582 TTGGGGAGGGGGTGGGGGACAGG + Intergenic
1054718995 9:68584894-68584916 GGGGGCAGGGAGGGGGTGCCAGG + Intergenic
1054771851 9:69090640-69090662 GGGGGCAGGGAGTGGGGGGAAGG - Intronic
1054798770 9:69326003-69326025 AAGGACAGGGTGTGGGTGGCAGG + Intronic
1054806869 9:69404012-69404034 ATGGGCAGGAAAGGGGTGGCAGG + Intergenic
1054902746 9:70387429-70387451 GAGGGTAGGGAGTGGGTGGGGGG - Exonic
1055155826 9:73061742-73061764 CAGGGTAGGGAGTGGGTGGGGGG - Intronic
1056089032 9:83186373-83186395 TTGAGCAGGGAGTGGCTGTTTGG - Intergenic
1056658749 9:88529555-88529577 CTGGGGAGGGAGTGGGCTGCAGG - Intergenic
1057261790 9:93588570-93588592 GGGGGCAGGGAGTGCATGGCAGG - Intronic
1057422939 9:94926794-94926816 TGGGGCCGGGGGTGGGTTGCGGG + Intronic
1057443057 9:95095849-95095871 GTGGGCCGGGAGGGAGTGGCCGG + Intergenic
1058131098 9:101254479-101254501 CTGGGCAGGAGGTGAGTGGCAGG - Intronic
1058416354 9:104793011-104793033 ATGGGCAGGGAGGGGGCTGCGGG + Intronic
1058472549 9:105295749-105295771 TGGGGCGGGGAGTGGGGGGGAGG + Intronic
1058723643 9:107781950-107781972 ATGGGCAGGGAGGTGGTGGAAGG - Intergenic
1059438542 9:114290168-114290190 TGGTGCAGGGAGTGGGAGGAGGG - Intronic
1060088202 9:120720575-120720597 TTGGGCAGGCAGTGCTAGGCAGG - Intergenic
1060113829 9:120925890-120925912 GTGGGCAGAAAGTGGGTGCCAGG - Intronic
1060228146 9:121808716-121808738 GTGGGCTGGGAGTGGGTGCAGGG - Intergenic
1060228178 9:121808879-121808901 TGGGGCAGGGGGAGGCTGGCAGG - Intergenic
1060385763 9:123226755-123226777 TTGGGGAGTGAGGGGGTGGCGGG + Intronic
1060407766 9:123381340-123381362 CTGGGCAGAGAGAGAGTGGCGGG + Exonic
1060889348 9:127178147-127178169 GTGGGCAGGGAGGGGGAAGCAGG + Intronic
1060896048 9:127218305-127218327 GTGTGCAGAGGGTGGGTGGCTGG - Intronic
1060942291 9:127549923-127549945 TGGGACAGAGAGTGGGAGGCTGG - Intronic
1061211866 9:129198323-129198345 GTGGGGATGGAGTGGGAGGCGGG + Intergenic
1061256115 9:129454703-129454725 TGGTGGAGGTAGTGGGTGGCAGG + Intergenic
1061275555 9:129568018-129568040 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1061668350 9:132173625-132173647 TGGGGCAGGCAGTGGATGGATGG + Intronic
1062056781 9:134472930-134472952 TTGGGCGTGGAGGAGGTGGCAGG + Intergenic
1062194186 9:135264008-135264030 GAGGGCAGGGAGTGGGGGGGAGG - Intergenic
1062259649 9:135655101-135655123 TTGGGTAGGGAAGGGGTGGGGGG + Intergenic
1062291854 9:135798955-135798977 TTGGGCTGGGAGGTGGTGGTGGG - Intergenic
1062352190 9:136144666-136144688 CAGGGCCCGGAGTGGGTGGCGGG - Intergenic
1062458695 9:136653789-136653811 GCTGGCAGGGAGTGGGTGCCCGG + Intergenic
1062520569 9:136956040-136956062 TCAGGCTGGGAGTGGGTGTCTGG - Intronic
1062565435 9:137162089-137162111 GTGGGCAGGGGCCGGGTGGCGGG + Intronic
1062699560 9:137891868-137891890 GAGGGCAGGGACTGGGTGGGGGG - Intronic
1062717776 9:138019636-138019658 CTGGGCAGGGCGGGGGCGGCAGG - Intronic
1186523026 X:10222354-10222376 ATGGGCTGGGAGTAGGAGGCGGG + Intronic
1186822131 X:13300306-13300328 TTGGGATGGGGGTGGGTGGAAGG - Intergenic
1186863127 X:13692703-13692725 TTTGGGAGGGAGTGGTTGACTGG + Intronic
1187927088 X:24260468-24260490 ATGGCAATGGAGTGGGTGGCAGG - Intergenic
1188979230 X:36712241-36712263 TTTGGCAGGGAGTGTATGGGTGG + Intergenic
1189958886 X:46306392-46306414 TTGGGTAGGGATAGGATGGCAGG + Intergenic
1190249313 X:48710082-48710104 TTGGTCAGGCAGGAGGTGGCAGG - Intergenic
1190888926 X:54552320-54552342 GTGGGCAGAGTGTGAGTGGCTGG - Exonic
1190917568 X:54821710-54821732 TTGGGTAGGGCTTGGGTGCCGGG + Intergenic
1190931365 X:54951662-54951684 TTGGGCAGGCCTTGGGTGCCAGG + Intronic
1192316337 X:70054664-70054686 GTGGGCTGGCAGTGGGTGCCGGG - Intergenic
1192326228 X:70134437-70134459 TGGGGGACGGAGTGGGAGGCTGG - Intronic
1192338165 X:70239140-70239162 TCAGGCAGTGAGTGAGTGGCAGG - Intronic
1195275327 X:103275796-103275818 GTGGGGAGGGAGGAGGTGGCAGG - Intronic
1195959548 X:110371530-110371552 CTGGGAAGGTAGTGGGGGGCTGG - Intronic
1196947389 X:120841324-120841346 TTTGGTAGGGAGTGGGAGGGGGG + Intergenic
1197892237 X:131279048-131279070 TTGGCCAGGGAGTGGCTGGTTGG - Intronic
1198243127 X:134803716-134803738 TTGAGCAGGGAGTAGGAGGTGGG - Intronic
1198799278 X:140432721-140432743 TTGGGAAGGGAGTTGGGGGAGGG + Intergenic
1199815620 X:151394550-151394572 TTGGGGATGGTGTGGGTGACCGG - Intergenic
1200102819 X:153696496-153696518 TGGGGCTGGGTGAGGGTGGCGGG + Exonic
1200216298 X:154369533-154369555 TAGGGGAGGGAGGGGTTGGCTGG - Intronic
1200267829 X:154655277-154655299 TGGGGCTGGGTGAGGGTGGCGGG + Intergenic
1201236241 Y:11914626-11914648 GGGGGCAGGGAGTGGGGGGTGGG + Intergenic
1201765335 Y:17569392-17569414 TTGGGCATGGCGCTGGTGGCTGG - Intergenic
1201836217 Y:18336597-18336619 TTGGGCATGGCGCTGGTGGCTGG + Intergenic
1201987426 Y:19985293-19985315 TGGGGCAGGGCAGGGGTGGCGGG + Intergenic
1202119572 Y:21509307-21509329 GTGGGCAGGGGGTTGGGGGCGGG + Intergenic
1202122024 Y:21532847-21532869 GTGGGCAGGGGGTTGGGGGCGGG + Intronic
1202156982 Y:21896535-21896557 GTGGGCAGGGGGTTGGGGGCGGG - Intronic
1202159428 Y:21920076-21920098 GTGGGCAGGGGGTTGGGGGCGGG - Intergenic
1202185876 Y:22184991-22185013 GTGGGCAGGGGGTTGGGGGCGGG - Intergenic
1202205484 Y:22401405-22401427 GTGGGCAGGGGGTTGGGGGCGGG + Intronic
1202234052 Y:22689540-22689562 TTGGGCCGGGAGTGCGAGGAGGG - Intergenic
1202309104 Y:23506618-23506640 TTGGGCCGGGAGTGCGAGGAGGG + Intergenic
1202561697 Y:26163974-26163996 TTGGGCCGGGAGTGCGAGGAGGG - Intergenic