ID: 1181857907

View in Genome Browser
Species Human (GRCh38)
Location 22:25795644-25795666
Sequence CTCAACCTAGCAACTGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 231}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181857907_1181857909 -8 Left 1181857907 22:25795644-25795666 CCAGCTGCAGTTGCTAGGTTGAG 0: 1
1: 0
2: 1
3: 12
4: 231
Right 1181857909 22:25795659-25795681 AGGTTGAGCTCCTGGTTGCTAGG 0: 1
1: 0
2: 0
3: 10
4: 125
1181857907_1181857913 13 Left 1181857907 22:25795644-25795666 CCAGCTGCAGTTGCTAGGTTGAG 0: 1
1: 0
2: 1
3: 12
4: 231
Right 1181857913 22:25795680-25795702 GGGATTTTGTGATCCTGTGGCGG 0: 1
1: 0
2: 0
3: 12
4: 244
1181857907_1181857910 -7 Left 1181857907 22:25795644-25795666 CCAGCTGCAGTTGCTAGGTTGAG 0: 1
1: 0
2: 1
3: 12
4: 231
Right 1181857910 22:25795660-25795682 GGTTGAGCTCCTGGTTGCTAGGG 0: 1
1: 0
2: 0
3: 4
4: 102
1181857907_1181857915 29 Left 1181857907 22:25795644-25795666 CCAGCTGCAGTTGCTAGGTTGAG 0: 1
1: 0
2: 1
3: 12
4: 231
Right 1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG 0: 1
1: 0
2: 1
3: 10
4: 84
1181857907_1181857912 10 Left 1181857907 22:25795644-25795666 CCAGCTGCAGTTGCTAGGTTGAG 0: 1
1: 0
2: 1
3: 12
4: 231
Right 1181857912 22:25795677-25795699 CTAGGGATTTTGTGATCCTGTGG 0: 1
1: 0
2: 1
3: 14
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181857907 Original CRISPR CTCAACCTAGCAACTGCAGC TGG (reversed) Intronic
902884075 1:19392550-19392572 CTCAAGCGAGCCACCGCAGCTGG - Intronic
903000905 1:20265074-20265096 CTTAACACAGCACCTGCAGCAGG + Intergenic
903185702 1:21627736-21627758 CTCAGCCCAGCTACTCCAGCAGG + Intronic
909047503 1:70728068-70728090 TTCCAGCTAGCCACTGCAGCAGG - Intergenic
909324718 1:74336077-74336099 CTCCACCTAGCATCTGCAAAAGG + Exonic
911129205 1:94372284-94372306 CTCAACCTAGGAAGTTCCGCTGG + Intergenic
911751078 1:101498993-101499015 CTCAACCCAGGAAGTCCAGCTGG - Intergenic
911845217 1:102744577-102744599 CTCAACCCAGGAAGTCCAGCTGG + Intergenic
912082833 1:105958581-105958603 CTCAACCCAGGAAGTCCAGCTGG + Intergenic
913279543 1:117172730-117172752 CTCGACCTAGGAAGTCCAGCTGG - Intronic
913378924 1:118186811-118186833 CTCAACCCAGGAAGTCCAGCTGG - Intergenic
915162250 1:153929002-153929024 CTCAGCCTGGCAACAGCACCAGG - Intergenic
915762313 1:158327300-158327322 CTCAACCCAGGGAGTGCAGCTGG + Intergenic
917279524 1:173367875-173367897 CTCAACCCAGCAAGTCCAGCTGG - Intergenic
918024100 1:180726021-180726043 CTCAACCCAGGAAGTCCAGCTGG - Intronic
918117508 1:181509504-181509526 CACAAGTTAGCTACTGCAGCTGG - Intronic
919559322 1:199097472-199097494 CTCAACCCAGGAAGTCCAGCTGG - Intergenic
921991274 1:221370379-221370401 CCCAACCTAGCAACAGAAGGTGG - Intergenic
924136390 1:240971524-240971546 CACACCCTGGCTACTGCAGCTGG - Intronic
924506913 1:244694811-244694833 CTCAACTCTGCCACTGCAGCCGG - Intronic
1063070381 10:2657044-2657066 CTCAACCTTCCATCTGCAGTGGG - Intergenic
1065948555 10:30628945-30628967 CTCAACTCTGCCACTGCAGCAGG - Intronic
1066253149 10:33653578-33653600 CTCAAGGTAGCAAAGGCAGCTGG - Intergenic
1068501240 10:57841573-57841595 CTCAACCCAGGAAGTCCAGCTGG - Intergenic
1069152734 10:64985333-64985355 CTCAACCCAGGAAGTCCAGCAGG + Intergenic
1069743035 10:70697657-70697679 CACAACTGAGCAAGTGCAGCGGG - Intronic
1070492746 10:76993051-76993073 CTGAAGCTACCACCTGCAGCTGG + Intronic
1070677752 10:78424063-78424085 CTCAACCCAGGAAGTCCAGCTGG - Intergenic
1071054221 10:81490536-81490558 CTCAACCCAGGAAGTCCAGCTGG - Intergenic
1073187430 10:101625046-101625068 CTCAACCTAGTCTGTGCAGCAGG - Intronic
1073695782 10:105865542-105865564 CTGAACCTAGCAACTGTAAATGG + Intergenic
1074909223 10:117892397-117892419 TACTACCTAGCTACTGCAGCAGG + Intergenic
1075254077 10:120910471-120910493 CTCAACCCAGGAAGTCCAGCTGG + Intergenic
1076229268 10:128806641-128806663 GTCAACATAGCAGCTCCAGCAGG - Intergenic
1076897656 10:133321409-133321431 CTCAACCCAGGAAGTGCAGCTGG + Intronic
1077045045 11:540990-541012 CTCAGCCCAGCCCCTGCAGCTGG + Intronic
1078290329 11:10004506-10004528 GTCAAGCTAGGAACTGCACCAGG + Intronic
1078328233 11:10397771-10397793 CTCAACCTTGCAGCTGCTTCAGG + Intronic
1079913343 11:26338191-26338213 CTCAACCCAGGAAGTCCAGCTGG - Intronic
1081121383 11:39270899-39270921 CTCCACCCAGCAAGTCCAGCTGG - Intergenic
1081146439 11:39566218-39566240 CTCAACCCAGGAAGTCCAGCTGG - Intergenic
1081286305 11:41274497-41274519 CTCAACCGAGGAAGTCCAGCTGG - Intronic
1083480966 11:62946519-62946541 ATCTACATAGCAATTGCAGCTGG + Intronic
1087349288 11:97011014-97011036 CTCAACCCAGGAAGTCCAGCCGG - Intergenic
1087459345 11:98425104-98425126 CTCAACCCAGGAAGTCCAGCTGG + Intergenic
1087874713 11:103342112-103342134 CTCAACCCAGGAAGTCCAGCTGG - Intronic
1094462636 12:30713814-30713836 CTCTAGCTTGGAACTGCAGCTGG + Exonic
1094597968 12:31882718-31882740 CTCAACCCAGGAAGTCCAGCTGG - Intergenic
1095934445 12:47661689-47661711 CACAACATAAAAACTGCAGCTGG + Exonic
1096081611 12:48837000-48837022 CTCGCCCTAACAACTGCACCTGG + Exonic
1098344513 12:69487314-69487336 CTCTACTTAGCCAATGCAGCTGG + Intronic
1098700208 12:73614327-73614349 GTCAAGCTGGGAACTGCAGCAGG - Intergenic
1099720420 12:86355308-86355330 CTCAACCCAGGAAGTCCAGCTGG + Intronic
1100051110 12:90448488-90448510 CTCAACCCAGGAAGTCCAGCTGG + Intergenic
1101705550 12:107217299-107217321 CTCAACCCAGGAAGTCCAGCTGG - Intergenic
1103055741 12:117818779-117818801 GTCATCCTTGCACCTGCAGCTGG - Intronic
1104068954 12:125328301-125328323 CACACCCTTGCAGCTGCAGCAGG + Intronic
1104305833 12:127610379-127610401 CTCAACCCAGGAAGTCCAGCTGG - Intergenic
1106034863 13:26034618-26034640 CTCAGCTCAGCACCTGCAGCTGG + Intergenic
1108118930 13:47161800-47161822 CTCAACCCAGGAAGTCCAGCTGG + Intergenic
1108699731 13:52933536-52933558 CTGAGCCTAGCATCTGCAGGAGG + Intergenic
1108725398 13:53175285-53175307 CTCAACCCAGGAAGTCCAGCTGG - Intergenic
1108735444 13:53278912-53278934 CTCAACCCAGAAAGTCCAGCTGG - Intergenic
1109527277 13:63593143-63593165 CTCAACCCAGGAAGTACAGCTGG - Intergenic
1110931732 13:81226978-81227000 CTCTAGCCAGCAACGGCAGCTGG - Intergenic
1111017400 13:82399308-82399330 CACAACATAGCAACAGCTGCTGG + Intergenic
1111372217 13:87333633-87333655 CTCGACCCAGCAAGTCCAGCTGG - Intergenic
1113698602 13:112366139-112366161 CTCAGCCTAGCCAATGCTGCTGG + Intergenic
1114795450 14:25710440-25710462 CCTAACCAAGGAACTGCAGCTGG - Intergenic
1116520599 14:45842544-45842566 CTCAACCCAGGAAGTCCAGCTGG - Intergenic
1119545818 14:75470605-75470627 CTCAAAATAGTAACTGCAGGTGG - Intronic
1119900054 14:78251828-78251850 CTAAACCTCCCAACTTCAGCAGG - Intronic
1120769767 14:88366259-88366281 CTCAAGCTGGAAACTGCATCAGG - Intergenic
1121633390 14:95437596-95437618 CTGGACCTAGGAACTGCTGCAGG + Intronic
1122102792 14:99426819-99426841 CTGAACCTAGGAACTGAACCTGG - Intronic
1122956798 14:105074966-105074988 CCCCACCTAGCCACCGCAGCCGG - Intergenic
1123491569 15:20785691-20785713 CTCAGCCCAGCAGCTGCAGCAGG + Intergenic
1123548072 15:21354785-21354807 CTCAGCCCAGCAGCTGCAGCAGG + Intergenic
1124360269 15:29031854-29031876 CTCAACCCAGGAAGTTCAGCTGG + Intronic
1124655995 15:31507868-31507890 CTCAACCCAGGAAGTCCAGCTGG + Intronic
1124920261 15:34019152-34019174 CTCAACCCAGTAAGTCCAGCTGG + Intronic
1125345652 15:38716077-38716099 CTCAACCCAGGAAATCCAGCTGG - Intergenic
1126070597 15:44862037-44862059 CTCAACCCAGGAAGTTCAGCTGG + Intergenic
1127869750 15:63061519-63061541 CCCAACCTCGCAACAGCAGAAGG - Intronic
1128680176 15:69645747-69645769 AACAACCTAGAAACTGCAACTGG - Intergenic
1130683198 15:86014306-86014328 CTCAGGCAAGCCACTGCAGCTGG - Intergenic
1131478716 15:92763758-92763780 CTGAACCCAGCAACTCCAGAAGG + Intronic
1202956403 15_KI270727v1_random:82015-82037 CTCAGCCCAGCAGCTGCAGCAGG + Intergenic
1132681053 16:1141897-1141919 CTCACCGTGGCCACTGCAGCTGG + Intergenic
1133185098 16:4090208-4090230 CCCAACTTAGCAAATACAGCTGG + Intronic
1136382439 16:29901750-29901772 GCCAACCCAGCAACTGCCGCCGG + Exonic
1139141178 16:64264411-64264433 CTCAACCTAGGAAGTCCAGCTGG + Intergenic
1140748309 16:78000313-78000335 CTCAACCCAGGAAGTCCAGCTGG - Intergenic
1143107762 17:4538008-4538030 CGCAACCTGGCAAATGAAGCTGG + Exonic
1146310131 17:31762051-31762073 CTCGACCTAGGAAATCCAGCTGG - Intergenic
1147238362 17:39074251-39074273 CTCAACCTACTAAGTGCTGCAGG - Intronic
1147534631 17:41311616-41311638 CTCAGCCTCCCAAGTGCAGCTGG - Intergenic
1148607225 17:48939321-48939343 CTCAACCTCCCAAGTGGAGCTGG - Intronic
1149077843 17:52617576-52617598 CTCAACCCAGGAAGTCCAGCTGG - Intergenic
1149213949 17:54332413-54332435 CTCAACCCAGGAAGTCCAGCTGG - Intergenic
1149520147 17:57312497-57312519 GTCAGCCTTGAAACTGCAGCAGG - Intronic
1150135988 17:62695385-62695407 CTCAACCTAGGAAGTCCAGCTGG - Intergenic
1150137340 17:62703272-62703294 CTCAACCGAGCTAGGGCAGCAGG + Intronic
1150615147 17:66764670-66764692 CTCAACCTCCCATGTGCAGCAGG + Intronic
1150646624 17:66982589-66982611 CTCAACCCAGGAAGTCCAGCTGG + Intronic
1151463096 17:74267032-74267054 CTCAACCCAGGAAGTCCAGCTGG - Intergenic
1152034430 17:77863488-77863510 CTGAACCTGGGAACTGCAGGTGG - Intergenic
1158788943 18:60751395-60751417 TGCATCCTAGTAACTGCAGCAGG - Intergenic
1159475358 18:68914184-68914206 CTCTACATAGTGACTGCAGCAGG - Intronic
1163028071 19:14525292-14525314 ATCAACATAGCAACACCAGCAGG + Intronic
1164109116 19:22138030-22138052 CTCACCCTCGCACCCGCAGCGGG + Intergenic
1168292212 19:55362241-55362263 CTCCACCTGGCACCTGCAGGTGG - Exonic
1168338797 19:55612066-55612088 CTAAGCCTAGCAACAGAAGCAGG - Intronic
928700153 2:33890764-33890786 CTCAACCCAGGAAGTCCAGCTGG - Intergenic
931583012 2:63797258-63797280 CTCCTCGTAGGAACTGCAGCTGG - Intronic
933134536 2:78716253-78716275 CTCAACGTGGCATTTGCAGCAGG + Intergenic
933611297 2:84438697-84438719 CTCAACCCAGGAAGTCCAGCTGG - Intronic
933623346 2:84570252-84570274 CTCAACCCAGGAAGTCCAGCTGG - Intronic
933730910 2:85455766-85455788 CTCAACCCAGGAAGTCCAGCTGG + Intergenic
934867847 2:97829186-97829208 CTCAACCCAGGAAATCCAGCTGG - Intronic
935482982 2:103616520-103616542 CTCAACCAAGGAAGTCCAGCTGG - Intergenic
936030673 2:109067925-109067947 CTCCACCCAGCAGCTGGAGCTGG - Intergenic
936384560 2:112017385-112017407 CTCAACCCAGAAAGTCCAGCTGG + Intronic
936922670 2:117705230-117705252 CTCAACCCAGGAAGTCCAGCTGG + Intergenic
937000306 2:118459990-118460012 CACAACCATGCCACTGCAGCGGG + Intergenic
937591224 2:123615212-123615234 TTCACCATAGCCACTGCAGCTGG - Intergenic
940018248 2:149129697-149129719 CTCATCTTAGCACCAGCAGCTGG - Intronic
941324412 2:164095492-164095514 CTCAAAGTAGTAACTGCTGCAGG - Intergenic
942111922 2:172691033-172691055 CTCAACCCAGGAAGTCCAGCTGG + Intergenic
942117245 2:172740078-172740100 CTCAACTCTGCCACTGCAGCGGG - Intronic
942425598 2:175857365-175857387 CTCAACCTAGGAAGTCCAGCTGG - Intergenic
942997114 2:182276254-182276276 CTCCAAATAGCAACTGCTGCAGG + Intronic
944053075 2:195493438-195493460 CTCAACCCAGGAAGTCCAGCTGG - Intergenic
946822717 2:223647039-223647061 CTCAAGCTGGAAACTGCAGAGGG - Intergenic
947995253 2:234522270-234522292 CTCAAAATTGCAACAGCAGCTGG - Intergenic
1170893109 20:20392413-20392435 CTCAGCCTAGCGCCTGAAGCCGG + Intronic
1175658242 20:60790586-60790608 CTCAACCCAGGAAGTCCAGCTGG + Intergenic
1176220462 20:63967119-63967141 CTCAACCTCGGGACTGCAGTGGG + Intronic
1176701546 21:10057568-10057590 CTCCACCTAGGAAGTCCAGCGGG + Intergenic
1181857907 22:25795644-25795666 CTCAACCTAGCAACTGCAGCTGG - Intronic
1182592646 22:31393881-31393903 CTCAACCAAGGAAGTCCAGCTGG - Intergenic
1183001164 22:34860609-34860631 CTCAACCTAGAGACTGGAGGTGG - Intergenic
1184352171 22:43951706-43951728 CTCAGCACAGCAGCTGCAGCTGG - Intronic
949560635 3:5198733-5198755 GTCAAGCTAGGAACTGCATCAGG - Intronic
950238826 3:11349252-11349274 CTCAACCCAGGAAGTCCAGCTGG + Intronic
952107429 3:30086556-30086578 GTCAAGCTAGGAACTGCATCAGG + Intergenic
952631182 3:35469320-35469342 CTCAACCCAGCAAGTCCAGCTGG + Intergenic
953185243 3:40631491-40631513 CACAACATAGAAGCTGCAGCAGG + Intergenic
954618060 3:51980376-51980398 CAAAACCTAGGAACAGCAGCAGG - Exonic
954820344 3:53321089-53321111 TTCAACCTAGCAACAGAAGGTGG - Intronic
955088089 3:55722297-55722319 GTCAACTTAGCAACTGCACGTGG + Intronic
955090891 3:55749436-55749458 CTCAACCCAGGAAGTCCAGCTGG - Intronic
955493921 3:59511388-59511410 CTCAACATAGGAAGTCCAGCTGG - Intergenic
959334384 3:105045793-105045815 CTCAACCCAGGAAGTCCAGCTGG - Intergenic
960063290 3:113346032-113346054 CTCAACCCAGGAAGTCCAGCTGG - Intronic
961388962 3:126541119-126541141 TTTAACCTAGCACCTGCTGCGGG - Intronic
962209087 3:133461474-133461496 CACACCCTAACAACTGCACCGGG + Intronic
962356752 3:134700702-134700724 CACAAACAAGCAACTGCACCTGG - Intronic
962936848 3:140089413-140089435 CTCAACCCAGCTTCTCCAGCAGG + Intronic
964391596 3:156203209-156203231 CTCAACCCTGCCACTGCAGTGGG - Intronic
967330963 3:188288843-188288865 CTCTAGCTAGCAACTGTATCAGG + Intronic
968212837 3:196863413-196863435 CTCAACCCAGGAAGTCCAGCTGG + Intergenic
968876426 4:3270183-3270205 CTCCACCGAGCGGCTGCAGCAGG + Intronic
970402724 4:15733533-15733555 CTCGACCTAGGAAGTCCAGCTGG + Intronic
970699986 4:18724922-18724944 CTCAACCCAGGAAATCCAGCTGG - Intergenic
971369198 4:26002259-26002281 CTCATAAAAGCAACTGCAGCCGG + Intergenic
974395614 4:61330909-61330931 CTCAACCCAGGAAGTCCAGCTGG + Intronic
975019261 4:69467155-69467177 CTCAACCCAGGAAGTCCAGCTGG + Intergenic
976174004 4:82334291-82334313 CTCAACCCAGGAAGTCCAGCTGG + Intergenic
976174718 4:82339268-82339290 CTCAACCCAGGAAGTCCAGCTGG + Intergenic
977449888 4:97181963-97181985 CTCAACCCAGGAAGTCCAGCTGG - Intergenic
979420086 4:120493595-120493617 CTCAACCCAGGAAGTCCAGCTGG - Intergenic
980373710 4:131913815-131913837 CTCCACCTAGGAAGTCCAGCTGG + Intergenic
982486202 4:155968577-155968599 CTCAACCCAGGAAGTCCAGCTGG + Intergenic
984739359 4:183145073-183145095 ATCAATTTAGCAACTGCAGTTGG + Intronic
985553530 5:544953-544975 CTCAACCCAGGAAGTCCAGCTGG - Intergenic
990367334 5:55084666-55084688 CTCAACCCAGGAAGTCCAGCTGG + Intergenic
990460928 5:56030210-56030232 CTCCTCCTAGCAAATTCAGCAGG - Intergenic
992537597 5:77725555-77725577 GACAACCCAGCAACTGCAGTCGG - Intronic
993270134 5:85786307-85786329 CTCAACCTATCATCTACATCAGG + Intergenic
999869539 5:155734793-155734815 GTCAGCCAAGCAATTGCAGCAGG - Intergenic
1000661213 5:163940931-163940953 CTAAACGTAGAAGCTGCAGCAGG + Intergenic
1004530989 6:16455742-16455764 CTCAACCCAGGAAGTCCAGCTGG - Intronic
1006901017 6:37501345-37501367 CTCAACCCAGGAAGTCCAGCTGG + Intergenic
1007030806 6:38624048-38624070 CTCAACCCAGGAAGTGTAGCTGG - Intronic
1007940256 6:45774091-45774113 CTCAAGCAAGCAAGAGCAGCTGG - Intergenic
1009763752 6:68040899-68040921 CTCAACCCAGGAAGTCCAGCTGG + Intergenic
1012732410 6:102899570-102899592 CTCGACCTAGGAAGTCCAGCTGG - Intergenic
1017445510 6:154503730-154503752 CACCACCTAGCAACAGCATCAGG - Intronic
1018414573 6:163590205-163590227 CTCAACCCAGGAAGTCCAGCTGG - Intergenic
1021756151 7:23855154-23855176 CTCAACCCAGGAAGTCCAGCTGG + Intergenic
1024265544 7:47603522-47603544 CTCAACCCAGGAAATCCAGCTGG - Intergenic
1026172761 7:67968804-67968826 CTCAACCCAGGAAGTCCAGCTGG - Intergenic
1026379634 7:69786082-69786104 CTCAACCCAGGAAGTCCAGCTGG - Intronic
1026549733 7:71357745-71357767 CTCAACCCAGTAAGTCCAGCAGG - Intronic
1029898909 7:104019412-104019434 CCCAACCGAGAAACTGGAGCTGG + Intergenic
1030089253 7:105843094-105843116 ATCCACCTAGAGACTGCAGCAGG + Intronic
1036064564 8:5364636-5364658 CTAACCCAAGCAACTGCATCGGG - Intergenic
1036569396 8:9966535-9966557 ATCACCCTAGCAACCGCAGAGGG - Intergenic
1037434501 8:18848361-18848383 TGCAACCTAGCATCTGCAGATGG + Intronic
1038430042 8:27492843-27492865 CTCGACCTAGGAAGTCCAGCTGG + Intronic
1039275626 8:35932078-35932100 CTCAACCCAGAAAGTCCAGCTGG - Intergenic
1039405303 8:37307587-37307609 CTCAACCTTGCCATTACAGCAGG - Intergenic
1039726961 8:40228705-40228727 TTCAACTGAGCAACTCCAGCAGG + Intergenic
1040526784 8:48232838-48232860 CTCGACCTAGGAAGTCCAGCTGG - Intergenic
1040797219 8:51299544-51299566 CTCAACCTAGGAAGTCCAGCTGG + Intergenic
1044679127 8:94759417-94759439 CTCAACCCAGGAAGTTCAGCTGG + Intronic
1048468382 8:134686026-134686048 CTCCACCTAGGAAGGGCAGCGGG - Intronic
1050872622 9:10592571-10592593 CTCAACCCAGTAAGTCCAGCTGG - Intronic
1050923975 9:11240570-11240592 CTCAACCCAGAAAGTCCAGCTGG + Intergenic
1052432633 9:28387034-28387056 CTCAACCCAGGAAGTCCAGCTGG - Intronic
1053573787 9:39336973-39336995 CTCGACCCAGGAAGTGCAGCTGG + Intergenic
1053638696 9:40044062-40044084 CTCCACCTAGGAAGTCCAGCTGG + Intergenic
1053767389 9:41421151-41421173 CTCCACCTAGGAAGTCCAGCTGG - Intergenic
1053838408 9:42165530-42165552 CTCGACCCAGGAAGTGCAGCTGG + Intergenic
1054095353 9:60895657-60895679 CTCGACCCAGGAAGTGCAGCTGG + Intergenic
1054116815 9:61171581-61171603 CTCGACCCAGGAAGTGCAGCTGG + Intergenic
1054123357 9:61282036-61282058 CTCGACCCAGGAAGTGCAGCTGG - Intergenic
1054319490 9:63640625-63640647 CTCCACCTAGGAAGTCCAGCTGG + Intergenic
1054546055 9:66332646-66332668 CTCCACCTAGGAAGTCCAGCTGG - Intergenic
1054590938 9:67010980-67011002 CTCGACCCAGGAAGTGCAGCTGG - Intergenic
1057625667 9:96674135-96674157 CTCAACCCAGGAAGTCCAGCTGG + Intergenic
1058041827 9:100311007-100311029 CTCTACTTAACAACTTCAGCAGG + Intronic
1058766445 9:108186984-108187006 CACAACCTATCTTCTGCAGCTGG + Intergenic
1059845928 9:118276427-118276449 CTCAAGGTAGCAGCTGGAGCAGG + Intergenic
1202786565 9_KI270719v1_random:27652-27674 CTCCACCTAGGAAGTCCAGCGGG + Intergenic
1185779758 X:2834070-2834092 CACAGCGTAGCAACAGCAGCTGG - Intronic
1185936600 X:4263488-4263510 CTCAACCTGGCTTCTTCAGCAGG + Intergenic
1186506890 X:10100730-10100752 CCTGACCTAGCATCTGCAGCTGG + Intronic
1190761737 X:53442620-53442642 CTCAACCTACCATCTGCAGAAGG - Intergenic
1192484551 X:71513776-71513798 CTCAACCCAGGAAGTCCAGCTGG - Intronic
1193870878 X:86796396-86796418 CTCAACCCAGGAAGTCCAGCTGG + Intronic
1194250117 X:91563977-91563999 CTCTACCCAGGAAGTGCAGCTGG - Intergenic
1195579982 X:106490575-106490597 CTCAACCCAGGAACTGCAGCTGG + Intergenic
1196681118 X:118470517-118470539 CTCGACCTAGGAAGTCCAGCTGG - Intergenic
1197053899 X:122094194-122094216 CTCTTCATAGCCACTGCAGCTGG - Intergenic
1199746864 X:150777335-150777357 GTCAAGCTAGAAACTGCATCAGG - Intronic
1200945254 Y:8829324-8829346 CTCAACCCAGGAAGTCCAGCTGG - Intergenic
1201467822 Y:14303932-14303954 CTCAACCAAGCAAATATAGCAGG - Intergenic
1201720873 Y:17095389-17095411 CTCAACCTAGCTTCTTCAGCAGG + Intergenic
1201982151 Y:19919495-19919517 CTCAACCCAGGAAGTCCAGCTGG + Intergenic
1201989892 Y:20011773-20011795 CTCAACCCAGGAAGTCCAGCTGG + Intergenic
1202050928 Y:20779911-20779933 CTCAGCCTTGCAACTTCTGCAGG + Intronic
1202123987 Y:21553592-21553614 CTTCACCTTGAAACTGCAGCTGG + Intergenic
1202155021 Y:21875788-21875810 CTTCACCTTGAAACTGCAGCTGG - Intergenic