ID: 1181857911

View in Genome Browser
Species Human (GRCh38)
Location 22:25795669-25795691
Sequence TCACAAAATCCCTAGCAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181857911_1181857915 4 Left 1181857911 22:25795669-25795691 CCTGGTTGCTAGGGATTTTGTGA 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG 0: 1
1: 0
2: 1
3: 10
4: 84
1181857911_1181857918 12 Left 1181857911 22:25795669-25795691 CCTGGTTGCTAGGGATTTTGTGA 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1181857918 22:25795704-25795726 CCAGAAATATGATGGATCAATGG 0: 1
1: 0
2: 0
3: 11
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181857911 Original CRISPR TCACAAAATCCCTAGCAACC AGG (reversed) Intronic
901588892 1:10322393-10322415 TCACAAAATCCCTTGGTGCCAGG - Intronic
902987740 1:20165469-20165491 TCACAGTATCCCCAGCATCCAGG + Intronic
904996969 1:34638943-34638965 TCCCAAAATTCCCAGCACCCAGG + Intergenic
905252003 1:36655400-36655422 TCACAACAACCCTAGCAGGCAGG - Intergenic
905252010 1:36655485-36655507 TCACAACAACCCTAGCAGGCAGG - Intergenic
905309056 1:37037001-37037023 TCACAAAATGGCTCGCAGCCAGG - Intergenic
906987287 1:50697044-50697066 TCACACAATCCCAGGAAACCTGG + Intronic
912173072 1:107124254-107124276 TCACAGAAGCCCAAGCAGCCAGG + Intergenic
917623539 1:176822430-176822452 TGCCAAAATCACTATCAACCTGG - Intronic
920127645 1:203706207-203706229 TGAGAAAATCCCAAGCAAACTGG - Intronic
921213041 1:212916095-212916117 TCACAGATTCCCAAGTAACCTGG - Intergenic
922088630 1:222374642-222374664 TCACAAAACCCCTGGGAACAGGG + Intergenic
1062890789 10:1057729-1057751 TGACAAAATCTCTAAAAACCTGG - Intronic
1064352321 10:14587643-14587665 TCACCACAACCCTAGCAACTAGG + Intronic
1069779239 10:70944432-70944454 TCACAAAATCCTGAGCATCACGG - Intergenic
1070315947 10:75312489-75312511 TCACAAAATACCTAACATTCAGG + Intergenic
1071682131 10:87716927-87716949 TCACAAAAGCCCTAGAAAACAGG + Intronic
1071971955 10:90916328-90916350 TCACGGATGCCCTAGCAACCAGG - Intronic
1073010345 10:100354303-100354325 TCACAAAATACCCAGGAATCTGG - Intronic
1085254195 11:75163214-75163236 TCACAATATCCCTGGGAACTCGG + Intronic
1085444310 11:76590294-76590316 TCACAAAATCCTCAGAAATCTGG + Intergenic
1086664737 11:89466413-89466435 TCACAAAAGCCCTAACAGCTAGG - Intronic
1091926777 12:4357781-4357803 TCACAAAATTACTAAGAACCAGG - Intergenic
1094069133 12:26393814-26393836 TAACAAAATCTGGAGCAACCTGG + Intronic
1095804372 12:46302336-46302358 TCACAATAACCCTAGGAAGCAGG - Intergenic
1095927050 12:47589221-47589243 TCATATAAACCCTAGAAACCTGG + Intergenic
1097043593 12:56171214-56171236 TCACAAGATCCAGAGCTACCTGG - Intronic
1097395132 12:59064170-59064192 AGATAAAATCCATAGCAACCAGG + Intergenic
1098623379 12:72633713-72633735 TCATAAAAACCCTGGCAACCAGG - Intronic
1105838190 13:24229371-24229393 TTAAAAGATCCCTGGCAACCGGG + Intronic
1106132471 13:26951707-26951729 TTTCACAATCCCTAGCAACAGGG - Intergenic
1107607952 13:42080738-42080760 TCAGAAAATGCCTGGAAACCTGG - Intronic
1107674440 13:42780066-42780088 TCCCAAAATCCCTTGCTAGCTGG + Intergenic
1108024931 13:46167788-46167810 TCACCAACCCCCTAGCAGCCAGG - Intronic
1113401818 13:110001302-110001324 ACAGCAAATCCCTAGGAACCAGG + Intergenic
1115683353 14:35766736-35766758 TCACAAAATCATTAGCAATGAGG - Intronic
1115882634 14:37937204-37937226 TCAAAAAATGCATAGCAACTGGG + Intronic
1115909895 14:38243899-38243921 TCACAAAATCCCTGTGAAACTGG - Intergenic
1120485667 14:85110912-85110934 TCAGACAGTCCCTAGCAATCTGG - Intergenic
1121214770 14:92239295-92239317 TCATAAACTCCTTAGGAACCAGG + Intergenic
1124047263 15:26161749-26161771 TCACAACCGCCCTAGCACCCAGG - Intergenic
1124556540 15:30731173-30731195 AGACAAAATTCCTAGCACCCAGG - Intronic
1124674740 15:31674565-31674587 AGACAAAATTCCTAGCACCCAGG + Intronic
1129143593 15:73626196-73626218 TCATAAAATACCTACCTACCTGG + Intronic
1134475704 16:14571748-14571770 TCACAACAACCCTATCAAACAGG + Intronic
1139053878 16:63157720-63157742 TGACAAAATCCCTTGAAATCTGG - Intergenic
1139793725 16:69464088-69464110 TCATCAAATCCCTGGCAAGCTGG - Exonic
1144630805 17:16871330-16871352 TCACAAAGTCCCCACCAACATGG + Intergenic
1144650509 17:17004119-17004141 TCACAAAGTCCCCACCAACATGG - Intergenic
1144755513 17:17678304-17678326 TTACAACATCCCTAGGCACCTGG + Intergenic
1155025188 18:21934656-21934678 TCAGAAAATCACTAGCACCCAGG - Intergenic
1157171802 18:45413861-45413883 TCACAAAACACCTAACAAGCAGG - Intronic
1158214010 18:55080299-55080321 CCAGAGAATCCCTAGCAGCCAGG + Intergenic
1162457921 19:10796946-10796968 GCAGAAATTCCCTGGCAACCCGG - Intronic
1164180817 19:22816924-22816946 TCACAATATCCCTTGAAACAAGG - Intergenic
1164206058 19:23059786-23059808 TCACAAAAACCCTTGCAGACAGG + Intergenic
1164525126 19:29007923-29007945 TGAGAAAATCCATACCAACCTGG - Intergenic
926730630 2:16033250-16033272 TCATAAACTCCCTAGCAGCATGG + Intergenic
926849884 2:17184455-17184477 TCACAAAAACCCTATAAAACTGG - Intergenic
927367890 2:22319845-22319867 TCAAAAAATTCCTAGCAACAAGG - Intergenic
928590083 2:32805481-32805503 TCACAATAACCCTAGGAAGCAGG - Intronic
935550745 2:104450868-104450890 ACACCACATCCCTAGCATCCAGG + Intergenic
941553417 2:166944731-166944753 TCACAAAATCCCTATGACCTAGG + Intronic
942942547 2:181636327-181636349 TGACAATATCCCTTGCATCCAGG + Intronic
1174304783 20:49607457-49607479 GCACAAAATCCAAAGCTACCTGG + Intergenic
1179344710 21:40545997-40546019 CCAAATAATCCCTAGTAACCTGG + Intronic
1181857911 22:25795669-25795691 TCACAAAATCCCTAGCAACCAGG - Intronic
1181890421 22:26058258-26058280 TCACAAAATCAAGATCAACCAGG + Intergenic
1183500986 22:38178899-38178921 CCACAAAATCCCTGACATCCTGG + Intronic
949191888 3:1260174-1260196 TCACAAAGTCACTTGCAATCAGG - Intronic
955715064 3:61820726-61820748 TCAAACAATCCCCAGCAGCCAGG - Intronic
957460839 3:80517663-80517685 TCACAAAATCCTTAGAAAGGAGG - Intergenic
958161026 3:89817241-89817263 TAACAAAATGCCTTCCAACCAGG + Intergenic
960179477 3:114558310-114558332 TGATAAAGTCCTTAGCAACCAGG - Intronic
962046254 3:131762380-131762402 TCACAAAAGCCCTAGAATGCAGG + Intronic
962712352 3:138098696-138098718 TCCCAACCTTCCTAGCAACCAGG + Intronic
963264036 3:143221405-143221427 TCACGGAATACCTAGTAACCAGG + Intergenic
964048538 3:152361594-152361616 TCACAAAGTCCCTCATAACCTGG - Intronic
967186366 3:186948106-186948128 CCAGAAATTCCCCAGCAACCAGG - Intronic
969524819 4:7698977-7698999 TCACTGCATCCCTGGCAACCTGG - Intronic
970235487 4:13954271-13954293 TCACAATAACCCTAGGAAGCTGG + Intergenic
970956094 4:21813267-21813289 TTGCAAAATCCCTAGCTATCTGG + Intronic
971260817 4:25055046-25055068 TCACAAAACTCCTAGCACCATGG - Intergenic
974073291 4:57145341-57145363 TCACAAATTCAAGAGCAACCTGG - Intergenic
975734251 4:77366367-77366389 TCACAAGATTCCTAGCATACAGG + Intronic
976338274 4:83916157-83916179 TCACAAAATCTCTAGGAGGCAGG - Intergenic
983868335 4:172795064-172795086 TCACAAAATCCCTCGCAAAATGG + Intronic
987031786 5:13983084-13983106 GCACAAAAGCCCTAGGAATCTGG + Intergenic
991486836 5:67145641-67145663 TCAAAAGATCCCCTGCAACCTGG - Intronic
992569124 5:78035799-78035821 TCCCTAAATCTCTAGCAAACAGG + Intronic
992862011 5:80920801-80920823 TCACAAAATCCCTTGGAATTAGG - Intergenic
997075663 5:130672961-130672983 CCACAAAATGGCTAGCAGCCAGG + Intergenic
997392508 5:133528568-133528590 TGACTACATCCCTAGCACCCAGG + Intronic
998718544 5:144914656-144914678 ACACAAAATCCCCAGGAACCAGG + Intergenic
998974424 5:147628454-147628476 TTACACAATCCCTACCAAGCTGG - Intronic
999465557 5:151800848-151800870 TCAGAAAGTCCTTAGCAACAGGG + Exonic
1001050533 5:168410456-168410478 TCACAGAATCCTAAGCAATCAGG + Intronic
1004572935 6:16865521-16865543 TCACAGAATCCCTCACCACCTGG + Intergenic
1004779191 6:18887402-18887424 TCATAAAATCCTTAGCAAACTGG - Intergenic
1005562691 6:27056874-27056896 TAACACAATGCCCAGCAACCTGG + Intergenic
1006913614 6:37580235-37580257 TCCCAATATCCCTTGCAACTAGG + Intergenic
1009653736 6:66511861-66511883 ACACAAAATCCCAAATAACCTGG + Intergenic
1011101092 6:83723475-83723497 TCACAACATCCCTATCATCAAGG - Intergenic
1011483210 6:87815679-87815701 TCCCACAATCCCTAGCAACTAGG - Intergenic
1012841381 6:104333150-104333172 GCACAAAATCCCTTGCAGCTGGG - Intergenic
1020646083 7:10815979-10816001 TCCCAAAATTCATATCAACCCGG + Intergenic
1022269675 7:28793864-28793886 TCCCCAAATCCCAAGCAAGCTGG - Intronic
1022817485 7:33927697-33927719 CTCCAAAATCCCTACCAACCTGG + Intronic
1030290688 7:107869544-107869566 TGACAATATTCCTAGCAACTTGG - Intergenic
1030835953 7:114285725-114285747 TCATAAAATCACTAGCAATCAGG - Intronic
1031852855 7:126886552-126886574 TAACAAAATCCATAGAAAACAGG + Intronic
1033941807 7:146664043-146664065 TAATAAAAACCCTAGCAAACTGG - Intronic
1035048707 7:155985799-155985821 TCACGACAGCCCTAGCAAACAGG + Intergenic
1036503222 8:9332411-9332433 GCACAAAAGCCCTAGGAGCCAGG - Intergenic
1036701783 8:11017923-11017945 TCTCAGAATCCCTCTCAACCTGG - Intronic
1041640084 8:60188917-60188939 TCACAAAATCCCTCCAAACTGGG + Exonic
1042904469 8:73758925-73758947 TCACAAAAGCCCCAGCAAAGGGG - Intronic
1043813530 8:84773012-84773034 TGACAAAAGCCTTAGCAACTAGG - Intronic
1043975050 8:86575266-86575288 TCAAAAAATCCCCAGCAGCTGGG - Exonic
1044357797 8:91244814-91244836 TCACAAAATGCCTAGGGGCCAGG - Intronic
1050697537 9:8295601-8295623 TCCCAAATTCCCTTGCAACTAGG - Intergenic
1053323907 9:37124662-37124684 GCTCAAAATCACTTGCAACCAGG - Intronic
1055170981 9:73257807-73257829 TCACTAAATACCTATCAACATGG + Intergenic
1055227914 9:74023148-74023170 TCACAAAATCTCTCACAGCCTGG - Intergenic
1055567255 9:77581715-77581737 TCACAGAATCCTTAGGACCCAGG + Intronic
1060264139 9:122100597-122100619 TCAGAACATCCCCAGCACCCTGG + Intergenic
1185753124 X:2630091-2630113 TCACAATTTCCCTATGAACCAGG - Intergenic
1185753163 X:2630433-2630455 TCACAATTTCCCTATGAACCAGG - Intergenic
1185753220 X:2630913-2630935 TCACAATTTCCCTATGAACCAGG - Intergenic
1185753260 X:2631249-2631271 TCACAATTTCCCTATGAACCAGG - Intergenic
1185753350 X:2632045-2632067 TCACAATTTCCCTATAAACCGGG - Intergenic
1185753386 X:2632381-2632403 TCACAATGTCCCTATGAACCAGG - Intergenic
1186507287 X:10103284-10103306 TCACATAACCCTTAGCAGCCTGG + Intronic
1187283587 X:17881927-17881949 TCACAAGATATCTAGCAACCTGG + Intergenic
1194872998 X:99156207-99156229 TAACAAAAATCCTACCAACCAGG + Intergenic
1195698466 X:107684236-107684258 CCACAAAAGCCCTAGTGACCTGG - Intergenic
1198840919 X:140856975-140856997 TCACAATAGCCCTAGAAAGCAGG - Intergenic
1199700785 X:150373982-150374004 TCAGAAAAACCTTGGCAACCAGG - Intronic
1199717737 X:150518289-150518311 TCCCACAAGCCCTAGCAAACTGG - Intergenic
1200904976 Y:8472592-8472614 TCACAATATCCCTAGCATGCAGG - Intergenic