ID: 1181857915

View in Genome Browser
Species Human (GRCh38)
Location 22:25795696-25795718
Sequence GTGGCGGCCCAGAAATATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181857911_1181857915 4 Left 1181857911 22:25795669-25795691 CCTGGTTGCTAGGGATTTTGTGA 0: 1
1: 0
2: 0
3: 11
4: 128
Right 1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG 0: 1
1: 0
2: 1
3: 10
4: 84
1181857907_1181857915 29 Left 1181857907 22:25795644-25795666 CCAGCTGCAGTTGCTAGGTTGAG 0: 1
1: 0
2: 1
3: 12
4: 231
Right 1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG 0: 1
1: 0
2: 1
3: 10
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181857915 Original CRISPR GTGGCGGCCCAGAAATATGA TGG Intronic
902628723 1:17692121-17692143 GTGAAGGCTCAGAACTATGATGG - Intronic
904659934 1:32076800-32076822 GCGGCGGCCCAGAACGATGGTGG - Exonic
906927938 1:50138911-50138933 GTGGCTGCAAAGCAATATGAAGG + Intronic
921757010 1:218869431-218869453 GTGGGGAACTAGAAATATGATGG - Intergenic
1065351565 10:24800160-24800182 TTGGAGGACCAGAAATAAGAAGG - Intergenic
1075349801 10:121713583-121713605 GTGGTGGCGCAGAAAGATGATGG - Intergenic
1079245989 11:18752695-18752717 GTGGAGGCCCAGAAGTACGAGGG + Intronic
1103958259 12:124591803-124591825 GTGAGGGCCCAGAAATGTCAGGG - Intergenic
1111500151 13:89108176-89108198 GTGGGAGCCAAGAAAAATGATGG - Intergenic
1114334054 14:21669549-21669571 AGGGCTGCCCAGAAATCTGAAGG + Intergenic
1116287715 14:42993735-42993757 GAGGTGGCTCAGAAATATGTTGG + Intergenic
1137533065 16:49295734-49295756 TTGGCGCCCCAGCAAGATGAAGG - Intergenic
1137912192 16:52388912-52388934 GTGGCGGGACACAAATGTGATGG - Intergenic
1140186464 16:72777235-72777257 AAGCCAGCCCAGAAATATGAGGG - Intergenic
1152478194 17:80532239-80532261 ATGGCTGCCCAGAAATATAAAGG - Intergenic
1157223942 18:45846190-45846212 CAGGGGGCCCAGAAACATGAGGG - Intergenic
1157934511 18:51858403-51858425 TTGGGTACCCAGAAATATGAAGG + Intergenic
1158686135 18:59616306-59616328 GAGGCGGCCCTGAAAAATGATGG + Intronic
1160153547 18:76413634-76413656 GTGGCAGCCCAGATATTTGGGGG - Intronic
1161784406 19:6314571-6314593 GTCGCGGCTCAGACATATCAGGG - Intronic
1164986472 19:32652217-32652239 GTGGGGACCCAGAAATTTCAAGG + Intronic
1167751082 19:51380575-51380597 GCGGCGGCCCAGGAAGCTGACGG + Exonic
1168418131 19:56182393-56182415 GTGACGGCCCAGAAGCTTGAAGG - Intronic
931772693 2:65512148-65512170 GTGGCGGTGCAGAAAGATAAAGG + Intergenic
934868544 2:97837891-97837913 GTGGTTGCCTAGAAATAGGAAGG - Intronic
945900290 2:215529796-215529818 ATGGTGGACCACAAATATGATGG - Intergenic
948792714 2:240387551-240387573 GGAGCAGCCCAGAAATCTGAGGG - Intergenic
1170909269 20:20548010-20548032 GTGGCAGACCACATATATGATGG - Intronic
1171292514 20:23990358-23990380 GCTGAGGCCCAGAAATGTGAAGG - Intergenic
1171984306 20:31648830-31648852 GGAGCGGCCCAGAAAGATCATGG + Intergenic
1172159090 20:32852919-32852941 GTGCCAGACCAGAAAAATGACGG - Intergenic
1172830263 20:37827936-37827958 TTAGAGGCCCAGAGATATGAAGG - Intronic
1173631837 20:44522021-44522043 GTGACTCCCCAGAAACATGACGG + Exonic
1178479955 21:32971180-32971202 GTCGGGGCCCAGATATATGCGGG - Intergenic
1180823582 22:18848122-18848144 GCTGAGGCCCAGAAATGTGAAGG - Exonic
1181124009 22:20691221-20691243 GCTGAGGCCCAGAAATGTGAAGG - Intergenic
1181189157 22:21126424-21126446 GCTGAGGCCCAGAAATGTGAAGG + Exonic
1181210042 22:21284071-21284093 GCTGAGGCCCAGAAATGTGAAGG - Intergenic
1181399477 22:22642873-22642895 GCTGAGGCCCAGAAATGTGAAGG + Intergenic
1181649939 22:24253195-24253217 GCTGAGGCCCAGAAATGTGAAGG - Intergenic
1181707438 22:24657551-24657573 GCTGAGGCCCAGAAATGTGAAGG + Intergenic
1181857915 22:25795696-25795718 GTGGCGGCCCAGAAATATGATGG + Intronic
1183591526 22:38781870-38781892 GTGGAGGCCCAGAGCGATGAGGG - Intronic
1184098196 22:42327973-42327995 GAGGGGGCCCAGAGCTATGATGG - Intronic
1184803170 22:46774740-46774762 TCGGGGGCCCAGAAATATCAGGG - Intronic
1185163967 22:49246522-49246544 GTGGCTGCCCAGAAATGGGAAGG - Intergenic
1185263844 22:49887015-49887037 GGGGCAGCCCAAAAATCTGACGG - Exonic
1203216905 22_KI270731v1_random:11362-11384 GCTGAGGCCCAGAAATGTGAAGG + Intergenic
1203273724 22_KI270734v1_random:74028-74050 GCTGAGGCCCAGAAATGTGAAGG - Intergenic
950005620 3:9689271-9689293 GTGGTGGCCCAGGAACATAAAGG + Intronic
960728478 3:120696868-120696890 GTGGCAGCTGAGAAAAATGAGGG + Intronic
965133412 3:164730813-164730835 TTGGCTGCTCAGAAATATAAAGG - Intergenic
966016442 3:175144678-175144700 AGGGCTGCCCAAAAATATGAAGG - Intronic
967413418 3:189190489-189190511 GAGGCTGCCCAGAGATTTGAGGG - Intronic
968386839 4:148107-148129 CTGCCCGCCCAGAAATCTGAAGG - Intronic
972817900 4:42665017-42665039 GTGGAGGCCCAGAAATATTTGGG - Intergenic
976593308 4:86870851-86870873 GTGGAAGCCCAGAAACAGGAAGG + Intergenic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
984561798 4:181279890-181279912 GTGGGGTCCCAGAAAGATTAAGG + Intergenic
986233282 5:5885882-5885904 GTGGTGGCCCAGAAGGCTGATGG - Intergenic
994420354 5:99523125-99523147 GCTGAGGCCCAGAAATATGAGGG + Intergenic
994420522 5:99523944-99523966 GCTGAGGCCCAGAAATATGAGGG + Intergenic
994486518 5:100390370-100390392 GCTGAGGCCCAGAAATATGAGGG - Intergenic
994486686 5:100391189-100391211 GCTGAGGCCCAGAAACATGAGGG - Intergenic
994486855 5:100392008-100392030 GCTGAGGCCCAGAAATATGAGGG - Intergenic
995348130 5:111144115-111144137 GTGGTAGCCCAGTAATCTGAAGG + Intergenic
995608023 5:113879304-113879326 GTAGAGGCCCAGAAATGTGGAGG + Intergenic
997698345 5:135878993-135879015 GTGTCGGCTCATAAATGTGATGG - Intronic
1005549302 6:26897856-26897878 GCTGAGGCCCAGAAATGTGAAGG - Intergenic
1005549479 6:26898673-26898695 GCTGAGGCCCAGAAATGTGAAGG - Intergenic
1005549655 6:26899493-26899515 GCTGAGGCCCAGAAATGTGAAGG - Intergenic
1009020042 6:57938966-57938988 GCTGAGGCCCAGAAATGTGAAGG - Intergenic
1012554581 6:100495971-100495993 GTAGCTGCACAGGAATATGAAGG - Intergenic
1016602542 6:145878814-145878836 CTGGCTGCCAAGAAAAATGATGG - Intronic
1031039851 7:116827804-116827826 GTGGCAGCACAGAAAAATCAGGG - Intronic
1033172214 7:139094171-139094193 GTGGGGGCCCAGGAATCTAATGG - Intronic
1034341952 7:150363092-150363114 GGGGAGGCCCCGAAAGATGAAGG - Intergenic
1036489566 8:9212360-9212382 ATGGAGGCCCAGAGATATTAAGG - Intergenic
1039413517 8:37375134-37375156 CTGGCGGCTCTGAAATGTGAAGG - Intergenic
1042699828 8:71600122-71600144 GTGGCTGCTCAGAAGTAGGAAGG + Intergenic
1044845531 8:96376882-96376904 GTGTGGGCCCAGAAAAGTGAGGG + Intergenic
1046478112 8:114776383-114776405 GTGGCTGCAGTGAAATATGAGGG + Intergenic
1046494960 8:115001181-115001203 GTGAAGGCCCAGAATTATTACGG + Intergenic
1048003829 8:130402101-130402123 GTGGCTGTCCAGAAATATGAAGG + Intronic
1048344911 8:133569215-133569237 ATGCCGGCCCAGAAAAATGCAGG + Intronic
1051123474 9:13777353-13777375 TTGGGGGCCCACAAGTATGAGGG - Intergenic
1053651091 9:40170583-40170605 GTGGCGGTTCAGCAATTTGATGG + Intergenic
1053901476 9:42799931-42799953 GTGGCGGTTCAGCAATTTGATGG + Intergenic
1054533489 9:66205620-66205642 GTGGCGGTTCAGCAATTTGATGG - Intergenic
1057481925 9:95451430-95451452 GTTCCCGCCCAGAAATATCAGGG - Intronic
1062674661 9:137733708-137733730 GTGACGGCCAAGAAATCTAAAGG + Intronic
1186636917 X:11416139-11416161 GCGGCAGCACAGAAATATCATGG + Intronic
1190029912 X:46962129-46962151 GTGGCTGCCCAGGAAGATGGAGG + Intronic
1196812893 X:119642797-119642819 CTGGCGGCCAAGCAATTTGAGGG - Intronic
1198909890 X:141601675-141601697 GAGAGGGCCCAGAAATAGGATGG - Intronic
1201942792 Y:19477794-19477816 CTGGAGGCCAAGAATTATGAGGG - Intergenic