ID: 1181864323

View in Genome Browser
Species Human (GRCh38)
Location 22:25843498-25843520
Sequence GGATGATGTTTGGGAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 237}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181864318_1181864323 29 Left 1181864318 22:25843446-25843468 CCAGGTGATACGTGGTTATATAT 0: 1
1: 0
2: 0
3: 6
4: 56
Right 1181864323 22:25843498-25843520 GGATGATGTTTGGGAAAAACAGG 0: 1
1: 0
2: 1
3: 19
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181864323 Original CRISPR GGATGATGTTTGGGAAAAAC AGG Intronic
900551655 1:3259429-3259451 GGATGATCTTAGGGCACAACTGG + Intronic
902220981 1:14964886-14964908 GAATCTTGTTTGGGAAAAACGGG + Intronic
902964444 1:19988897-19988919 GGATGATGTTTGGGGGAAGGAGG - Intergenic
903256586 1:22106321-22106343 GGATGATGCTTGGAGAAAATTGG + Intergenic
904502325 1:30921327-30921349 TGATTATTTTTGGTAAAAACAGG - Intergenic
905585485 1:39114066-39114088 GGTAGATGCTTGGGAAAAAATGG - Intronic
906378602 1:45317069-45317091 GGATGATTTTTGTCAAAAAATGG + Intergenic
910140220 1:84018903-84018925 GGATGACTTTTAGGAAATACAGG - Intergenic
911382025 1:97127211-97127233 AGATGATGTTTGTGACAAAGAGG + Intronic
911661830 1:100510064-100510086 GGATGATGTTTTCAAAAGACAGG - Intronic
911664467 1:100538349-100538371 GGATGCTGCTTGGGAGAAGCGGG + Exonic
912511224 1:110191438-110191460 GGGTGATGGTGGGGAAAAGCAGG + Intronic
916317389 1:163465003-163465025 TGATGTTGTTTTGGAAAGACTGG + Intergenic
916471752 1:165130273-165130295 GTATTTTGTTTGGGACAAACTGG - Intergenic
921900947 1:220450259-220450281 GGATACTGTTTAGGAAAATCAGG - Intergenic
924729878 1:246701401-246701423 TGATGATGTTAGGGAGCAACTGG + Intergenic
1063044404 10:2377073-2377095 GGATCAGGACTGGGAAAAACGGG + Intergenic
1064586753 10:16846855-16846877 GGATGGGGTTGAGGAAAAACTGG + Intronic
1064957773 10:20930442-20930464 GGCTGATGTCTAGGAAAAATGGG - Intronic
1065542857 10:26787353-26787375 CCATGATGTTTGAGAAAAATAGG - Intronic
1069332229 10:67306254-67306276 AGATAAAGTTTGGGAAAAATAGG + Intronic
1071261564 10:83924208-83924230 GGCTGATGTTTCAGAAACACTGG + Intergenic
1072884402 10:99261036-99261058 GGATGATTTTTGTCAAAAAATGG + Intergenic
1075084305 10:119404148-119404170 TGATGAGGTTTTGGCAAAACTGG - Intronic
1077478824 11:2803502-2803524 GGGCGAGGTTTGGGAACAACTGG - Intronic
1078128294 11:8590232-8590254 TGATGATTATTTGGAAAAACTGG - Intronic
1078878690 11:15425625-15425647 GGATAATGATTGGGACAAAAGGG - Intergenic
1079754533 11:24239746-24239768 GGACTCTGTTTGGGAAAACCAGG - Intergenic
1080413460 11:32048087-32048109 GGATGGTGTTTGGGAGAAGGAGG + Intronic
1080920393 11:36703073-36703095 GTCTGATGTTGGGGAAAACCGGG - Intergenic
1082024628 11:47563321-47563343 GGAGGATGATTGGGAGAAAATGG + Intronic
1082209776 11:49484644-49484666 GGATGGTATTTTGGAAAAATGGG - Intergenic
1084925353 11:72506972-72506994 GGATGATGTATGGAAAAGCCTGG - Intergenic
1086607962 11:88719698-88719720 TGATGAGGTTTGGGAGAAAAGGG - Intronic
1086639893 11:89140892-89140914 GGATGGTATTTTGGAAAAATGGG + Intergenic
1086843424 11:91717870-91717892 GGAAGAAGGTTAGGAAAAACAGG - Intergenic
1088113833 11:106294321-106294343 GGATGAATATTGGGAAAAAATGG + Intergenic
1088849089 11:113690716-113690738 GGGTGATGCCAGGGAAAAACAGG + Intronic
1091096098 11:132823496-132823518 TGATGATGCTGGGGAAAGACAGG - Intronic
1091316493 11:134617656-134617678 GGAGGATGTATGGGAAAGCCTGG + Intergenic
1093063348 12:14630441-14630463 GGAAAATGTTTGGAAAAAACAGG + Intronic
1093568080 12:20632709-20632731 GGATGCTGGTTGAGAGAAACAGG - Intronic
1094455917 12:30632731-30632753 GGATGATGTGCAGAAAAAACTGG - Intronic
1095264500 12:40138222-40138244 GGATGATTATTGGGAACAATGGG + Intergenic
1096607647 12:52778020-52778042 GTATGAGGTTTGGGAAGAAGAGG + Intergenic
1097862023 12:64527472-64527494 GAATGACATTTGGGAAACACTGG - Intergenic
1097930389 12:65177470-65177492 GGATCTTGTTTGGGGAAAAGTGG + Intronic
1098746316 12:74241749-74241771 TGATGATATTAGGGAAAAAAAGG + Intergenic
1102617087 12:114164158-114164180 GGGTGATATTGGGGAAAAATAGG - Intergenic
1105321200 13:19323903-19323925 AGAGGATGTATGGGAAAACCGGG - Intergenic
1105944209 13:25175905-25175927 AGCTGATGTTTGGGGAAATCAGG - Intergenic
1106969354 13:35119079-35119101 GAAAGATGTTTTGGAATAACAGG + Intronic
1108263146 13:48678417-48678439 GAATGATGATTGAGAAAGACTGG - Intronic
1109815118 13:67571764-67571786 GAATGTTGTTTTGGAAAAACTGG - Intergenic
1112179130 13:97059833-97059855 GGATGATCTCAGGGAAATACAGG - Intergenic
1112203829 13:97304090-97304112 GGATTAGGTTTGGAAAACACTGG - Intronic
1112623163 13:101073098-101073120 GGATGATGCTTGGGGAAGACAGG + Intronic
1112715393 13:102179214-102179236 CCATGATTCTTGGGAAAAACTGG - Intronic
1113197101 13:107820890-107820912 GGATGATGTTTGCCAATACCTGG - Intronic
1114145432 14:19970973-19970995 GGATCATGTTTTTCAAAAACCGG + Intergenic
1117291740 14:54341170-54341192 AGATGGTGTTTCTGAAAAACAGG - Intergenic
1118255049 14:64198553-64198575 GGATGGAGTTTGGGATATACCGG + Intronic
1120146735 14:80987014-80987036 GCATGAATGTTGGGAAAAACAGG - Intronic
1124394465 15:29289415-29289437 GGGTGATAATGGGGAAAAACAGG + Intronic
1124610441 15:31204367-31204389 GAAAGGTGTTTGGGGAAAACCGG + Intergenic
1124890209 15:33725588-33725610 GGATGATGACTGGGCAAAAAGGG - Intronic
1125440187 15:39693518-39693540 GGCTGATGTTTTGGAAAAATTGG - Intronic
1126334207 15:47569019-47569041 GGGTGCTGTTTGGGAAAACGAGG + Intronic
1127535519 15:59886576-59886598 GGAGGGTGTTGGGGAAAAATTGG - Intergenic
1128535646 15:68488150-68488172 GCTGGATGTTAGGGAAAAACAGG - Intergenic
1128750742 15:70147404-70147426 GCCTCATGTTTGGGAACAACTGG - Intergenic
1128977404 15:72163682-72163704 GGATGTTGTCTGGGAGAGACAGG + Exonic
1132309576 15:100847433-100847455 GAATCATGTATTGGAAAAACAGG + Intergenic
1133499563 16:6353169-6353191 AGATGATCTTTGGGAAAGATGGG - Intronic
1134471096 16:14526589-14526611 TGATGAGGTTTGGGAAAACCAGG - Intronic
1134831009 16:17322898-17322920 GCATGATGTTTGGCACAAAGGGG + Intronic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1135916253 16:26608045-26608067 GGGTGAGGTATGGGAGAAACGGG - Intergenic
1136531521 16:30872957-30872979 GAATGAAGTTTGGCAAACACTGG - Intronic
1139357816 16:66377694-66377716 GGATGATGTAGAGGAAGAACAGG - Intronic
1141559000 16:84854288-84854310 GGATGGTGTGTGGTAAAAACTGG + Intronic
1143226367 17:5307619-5307641 GGATGCTGTTGGGGCAAAAGGGG + Intronic
1143488814 17:7271624-7271646 CGATGATGTTAGGAAAAAATAGG + Intergenic
1149262409 17:54894368-54894390 AGATGCTGTTTGGGAAAAGAAGG - Intergenic
1150812772 17:68369739-68369761 AGATGATGTATGTGAAACACTGG + Intronic
1151729451 17:75902163-75902185 GGAAGATGTGTGGGAAAAACAGG + Intronic
1153114491 18:1638952-1638974 CTATGAGGTTTGGGAGAAACAGG + Intergenic
1153602630 18:6796391-6796413 AGTTGATGTGTGGGAAAGACAGG - Intronic
1154275805 18:12958981-12959003 TGATGAAGATTTGGAAAAACTGG - Intronic
1154462568 18:14608626-14608648 GGATCATGTTTTTCAAAAACCGG + Intergenic
1155531858 18:26775515-26775537 GGCTGATGTGTGGGTAAAATTGG + Intergenic
1156334752 18:36159553-36159575 GGAGCATGTTTGGAAAATACTGG + Intronic
1156590394 18:38481602-38481624 GGATGGTGGTTGCGAAAAGCTGG - Intergenic
1157001726 18:43535267-43535289 AGATAGTGTTTGGGAAAAAGAGG + Intergenic
1157322318 18:46644178-46644200 GGAAGCTGTTTGGGAATTACTGG + Intronic
1157390287 18:47296440-47296462 GGATGAGCTTTGGGAACCACTGG + Intergenic
1158532163 18:58273168-58273190 GGATGAGCTTAGGGGAAAACAGG + Intronic
1158576825 18:58645240-58645262 GGATGATTTTTGTCAAAAAATGG - Intergenic
1159013399 18:63080985-63081007 TTATGGTGTTGGGGAAAAACAGG + Intergenic
1159716434 18:71829248-71829270 GCATGATGTTAGGGGAACACAGG - Intergenic
1162484780 19:10952922-10952944 AGGTGATGTTTGGGAAACCCCGG + Intergenic
1162906574 19:13827427-13827449 GGCTGATTTTTGGGAGAGACGGG - Intronic
1164362478 19:27529813-27529835 GAAATATGTTTGAGAAAAACTGG + Intergenic
1165233517 19:34402631-34402653 GGATGAAGTGTGGTAAAAAAAGG + Intronic
1165457788 19:35924241-35924263 GGATGACCTTTCGGAAGAACTGG - Intergenic
1166259099 19:41625685-41625707 GGGTGATGTTTTGGAACAGCAGG + Exonic
1166640725 19:44493032-44493054 GGATGATTTCTGAGAAAATCAGG - Intronic
1168097163 19:54122483-54122505 GGATGATGTCTAGGGTAAACGGG - Exonic
927166729 2:20330584-20330606 GGATGATGTATGGGAGAATGGGG - Intronic
927469577 2:23362956-23362978 GGAGGATGTTTTGGACAAATTGG + Intergenic
929002303 2:37359663-37359685 TGATGATATTTGAGAAAGACCGG - Exonic
932112296 2:69012677-69012699 AGATGAAGTAGGGGAAAAACGGG - Intergenic
933876348 2:86624324-86624346 GGAGGAGGTTTGGCCAAAACTGG + Intronic
935571818 2:104670137-104670159 GCATGATTTTTGGGAATACCTGG - Intergenic
937727979 2:125189546-125189568 GGAGGACGTTTGGGAGAAGCGGG + Intergenic
940212858 2:151274011-151274033 GGATGATGTTTAGGACATCCTGG - Intronic
940311654 2:152285481-152285503 GGCTGAAGTTTGAGAAACACTGG - Intergenic
940864678 2:158806163-158806185 TGATGATGTTTGGAAAATTCTGG - Intronic
942142301 2:172989543-172989565 GGGTGATGTTTAGAAAAAAATGG + Intronic
942230354 2:173855350-173855372 AGATGATGTTTGAGAAATAGTGG + Intergenic
944287717 2:197970742-197970764 GGATGTTGTGGGGGAAAAAAAGG - Intronic
944899133 2:204196605-204196627 GAATTAAGTTTGGGGAAAACAGG - Intergenic
945271096 2:207941049-207941071 GGATGATTATTGGGTAGAACTGG + Intronic
948027842 2:234791949-234791971 GGAGGGTATTTGGGAAAAGCAGG - Intergenic
948060032 2:235036154-235036176 AGAAGATGTTTGGGATAAAGGGG - Intronic
1170885283 20:20335550-20335572 GGATGAAGTATGGGAAAAAGAGG - Intronic
1172032692 20:31992962-31992984 GGATGTTGTTTGGGAACCAGGGG - Intronic
1172744644 20:37197228-37197250 GGATCTTGTCTGAGAAAAACAGG + Intronic
1172921255 20:38484272-38484294 GGTTGCTGTTAGGGAAAAAAGGG - Intronic
1173307159 20:41861780-41861802 GGCTGATTGTTGGGAAACACTGG - Intergenic
1173392843 20:42650243-42650265 GGAGGTTGGTTGGGAAAACCTGG - Intronic
1174072279 20:47907761-47907783 GGATGAGGTTTGGGGCAAAAGGG + Intergenic
1175359923 20:58401581-58401603 GCATGATGAGTGGGCAAAACTGG - Intronic
1175448657 20:59043677-59043699 GGATGATTTTTGAGCAAGACCGG - Intergenic
1176811951 21:13549756-13549778 GGATCATGTTTTTCAAAAACCGG - Intergenic
1177700495 21:24633064-24633086 GGATGTTGATTGGGAAGAAAAGG - Intergenic
1181864323 22:25843498-25843520 GGATGATGTTTGGGAAAAACAGG + Intronic
1183754261 22:39745034-39745056 AGAAGATGTTTTGTAAAAACAGG + Intronic
949423770 3:3893970-3893992 TGAAGATGTGTGGGAAAAACAGG + Intronic
949431630 3:3982925-3982947 GGAAAATCTTTGGGAATAACAGG + Intronic
950407041 3:12811162-12811184 GGCTGCTGTTTGGGAGAAATGGG - Intronic
952443362 3:33356152-33356174 GTATGTTGTTTGGAACAAACTGG - Intronic
953019760 3:39106119-39106141 GGATGATGGTAGGGAAAGAAGGG - Intronic
956198453 3:66677937-66677959 GTATAATATTTGGGAAGAACTGG + Intergenic
956479966 3:69663517-69663539 TGATGATGTTTGGGAAATAATGG - Intergenic
956491517 3:69777497-69777519 AAATGATGTTTGAGAAAAGCAGG + Intronic
957909989 3:86608038-86608060 AGAGGATGTATGGGAAAACCTGG - Intergenic
958121927 3:89301856-89301878 GGATGATGTTTAAGAAAAAATGG + Intronic
958924623 3:100144514-100144536 GGGTGATGTTGGAGACAAACTGG - Intronic
960725343 3:120664268-120664290 GGTTGGAGTCTGGGAAAAACTGG + Intronic
960909424 3:122634151-122634173 GGATGATGTTCTGGAAACAGAGG - Intronic
962036683 3:131659324-131659346 GGAAGATACTTGGGGAAAACTGG - Intronic
962071500 3:132037876-132037898 AGATGATGAAGGGGAAAAACAGG + Intronic
963635740 3:147793373-147793395 TGTTGATGTTTGTGAAAAAAGGG - Intergenic
965346150 3:167553311-167553333 GGAAGAAGCTTTGGAAAAACTGG - Intronic
967177159 3:186871602-186871624 TGCTGATTTTGGGGAAAAACAGG - Intergenic
971286181 4:25291948-25291970 GGATCAGATTTGGGAAAAATTGG + Intergenic
972186856 4:36539259-36539281 GTTTGATGTTTGGTACAAACTGG - Intergenic
972642117 4:40934364-40934386 GGTTGATGGTTTGTAAAAACTGG + Intronic
973080632 4:45987959-45987981 GGATGATGATAGGGAAAGATAGG + Intergenic
973263687 4:48189182-48189204 GGCTGAAGTTTGGGCAACACTGG + Intronic
974947124 4:68542091-68542113 AAATGGTGTTTTGGAAAAACTGG - Intronic
975945563 4:79702166-79702188 GAATGATGTGAGGGAAAACCAGG - Intergenic
977021839 4:91769643-91769665 GGATTAGGTATGGGAATAACAGG - Intergenic
978306518 4:107334354-107334376 GGCTGAGTTTTGGGAAAAAAAGG + Intergenic
979501800 4:121449025-121449047 GACTGAAGTTTGGGAAACACTGG + Intergenic
982054691 4:151536461-151536483 GGATGATGTATGGGAAAATGGGG - Intronic
983320638 4:166191876-166191898 AGAAGATGTTTGGAAATAACTGG + Intergenic
984707698 4:182859870-182859892 GGATGGTGCATGGGAAATACAGG - Intergenic
985582929 5:709228-709250 AGAGGATGTATGGGAAAACCTGG + Intergenic
986132943 5:4947407-4947429 TTATGCTGTTTGGGAAACACAGG - Intergenic
986255492 5:6100042-6100064 AGAAGATGATTGAGAAAAACAGG - Intergenic
987390343 5:17369363-17369385 GGTTGATGTGTGGGAAAGCCAGG + Intergenic
987874587 5:23664411-23664433 GACTGATGTTTGGGAAGAAATGG - Intergenic
988389203 5:30605554-30605576 AGATGGTGTTTGGAAATAACAGG + Intergenic
988405231 5:30815789-30815811 GGAAGATGTTTGAGAACAAATGG + Intergenic
989132446 5:38121038-38121060 GGGTGATGTTTTGGAAATAGTGG - Intergenic
990495414 5:56343013-56343035 GGATGATTTGTGGGCCAAACAGG + Intergenic
991156844 5:63447224-63447246 GGATGATGTCTGAGATAAAATGG - Intergenic
993334020 5:86634541-86634563 GGCTGATGTTTGGGCAGAAGTGG - Intergenic
993641561 5:90412092-90412114 GAATGAGGTTTGAGAAACACTGG - Intergenic
994766726 5:103927741-103927763 GGATGATGTTTTGGAAGCAAAGG - Intergenic
995051813 5:107715400-107715422 GGATGATGTATTCAAAAAACTGG - Intergenic
996092964 5:119368992-119369014 GGATGCTTTTAGGGAAAAAAAGG + Intronic
996886795 5:128365959-128365981 GGATCAAGTTTGGGATATACTGG - Intronic
998474747 5:142411078-142411100 GGAAGAAGTTAGGGAAGAACAGG + Intergenic
1000927307 5:167209683-167209705 GAATGATGTGGGGGAAAAAATGG - Intergenic
1001161038 5:169313729-169313751 GACTGAAGTTTGGGTAAAACAGG + Intergenic
1001180530 5:169515754-169515776 GGCTGAAATTTGGGAAACACTGG - Intergenic
1001260990 5:170228375-170228397 GGATCATGTTTGAGAAACACTGG - Intergenic
1001337075 5:170807849-170807871 GATTGTTGTTGGGGAAAAACAGG - Intronic
1003026644 6:2560825-2560847 GGATGAAGCTGGAGAAAAACAGG - Intergenic
1004681382 6:17898719-17898741 GGCTGATGGTGGGGAAAAAATGG - Intronic
1006670754 6:35728487-35728509 GGGTGAGATTTGGGGAAAACAGG - Exonic
1006821241 6:36897339-36897361 GGATGATTTTTTGTATAAACAGG - Intronic
1009299541 6:61997494-61997516 GAGGGATGTTTGGGAAAAACTGG - Intronic
1010068037 6:71709012-71709034 GGATCATGTGTTGGAGAAACAGG - Intergenic
1010527433 6:76920516-76920538 GGATAATTTTTGAGAAAAAATGG + Intergenic
1012479602 6:99651691-99651713 ATATAATGTTTGGAAAAAACAGG - Intergenic
1012565408 6:100643016-100643038 GAATGATGTTTGGGAAATTCAGG - Intronic
1012858061 6:104526795-104526817 GTATCCTGTATGGGAAAAACAGG + Intergenic
1015012940 6:128374447-128374469 GGCAGATGTTTGGGAAGAATGGG - Intronic
1015704004 6:136067749-136067771 GCCTGATGTGTGGGAAATACTGG - Intronic
1016192236 6:141284196-141284218 GGATGAAGGTTTGGAAAAATGGG - Intergenic
1016295560 6:142569949-142569971 GGATGTGGTTTGGGAAAAGAGGG - Intergenic
1016528967 6:145037297-145037319 GCCTGGTGTTTGGGAAGAACTGG + Intergenic
1018548267 6:164962678-164962700 AGAGGATGTTTGGGAAAGCCTGG + Intergenic
1019202811 6:170332786-170332808 GGGTGTCATTTGGGAAAAACTGG - Intronic
1021660491 7:22914570-22914592 GGATGATTTTTGTCAAAAAATGG + Intergenic
1021667292 7:22996981-22997003 GGAACATGTTTGGCAAAAATAGG - Intronic
1021812702 7:24418617-24418639 GGGTGCTGTTTGGGAGATACAGG + Intergenic
1022983937 7:35630658-35630680 GGATGAAGTTGGGGAGAACCTGG - Intergenic
1025009793 7:55386899-55386921 GGATTATGTTAGGGTGAAACTGG + Intronic
1026521305 7:71120525-71120547 GAATGAAGTTTGGGAAATACTGG + Intergenic
1026889574 7:73974157-73974179 GGAGGATCTGTGGGAAACACTGG - Intergenic
1027383020 7:77631956-77631978 GAATCCTGTTTGGGAAACACTGG + Intronic
1027800115 7:82739738-82739760 GGATCATGTTTTAGAAAATCTGG - Intergenic
1027842211 7:83327145-83327167 GGATGATGGTGGGCAAAAAAAGG - Intergenic
1029231056 7:99068930-99068952 GACTGACGTTTGGGAAACACTGG - Intronic
1030930891 7:115522127-115522149 AGAGGATGTTTGGGAAAGCCTGG - Intergenic
1031185621 7:118476186-118476208 GGATATTGTTTGGGAAAGAATGG - Intergenic
1031869010 7:127072155-127072177 GGGTGATGTTTGGGTGAACCAGG - Intronic
1032975171 7:137214567-137214589 GGCTAGTGTTTGGGAAAAAAAGG + Intergenic
1033806150 7:144956130-144956152 GAATGATGTTGGCCAAAAACAGG + Intergenic
1035140238 7:156752395-156752417 GGATACAGTTGGGGAAAAACTGG + Intronic
1037519113 8:19662487-19662509 GGCTGATGTTTGGGTGAAAAAGG + Intronic
1037812683 8:22096313-22096335 TAATGATGTTTGGGAAACAAGGG - Intronic
1037990764 8:23319951-23319973 GGATGGTGTGTGGCCAAAACTGG - Exonic
1039862146 8:41468268-41468290 GGAGGATGTGAGGGAGAAACTGG - Intergenic
1040726586 8:50387983-50388005 AGACGTTGATTGGGAAAAACAGG - Intronic
1042523749 8:69743129-69743151 GGATGGTGTTTAGGAGAGACTGG + Intronic
1043426540 8:80153804-80153826 GGCTGATGTGAGGGACAAACAGG + Intronic
1043496984 8:80812353-80812375 TGATGATGTTGCGAAAAAACTGG - Intronic
1043597579 8:81902796-81902818 GGATGATTTTTGTCAAAAAATGG - Intergenic
1044740274 8:95319240-95319262 GGATGATGTGTGTGAAATATAGG + Intergenic
1045362839 8:101448991-101449013 GAAAGGTGTTTGGGAGAAACAGG + Intergenic
1046803431 8:118453914-118453936 GGTAGATCTTTGGGAAAAACAGG - Intronic
1051504385 9:17811669-17811691 GGATGTTGTGTGGGCAAAAGTGG + Intergenic
1051693119 9:19738355-19738377 GGATGATGTTAGGGTAAAAGTGG + Intronic
1052794439 9:32910285-32910307 GTAATATGTTTGGCAAAAACTGG - Intergenic
1053617590 9:39783983-39784005 GAATGGTGTTTAGCAAAAACTGG - Intergenic
1053875769 9:42543343-42543365 GAATGGTGTTTAGCAAAAACTGG - Intergenic
1053896881 9:42751287-42751309 GAATGGTGTTTAGCAAAAACTGG + Intergenic
1054235930 9:62558382-62558404 GAATGGTGTTTAGCAAAAACTGG + Intergenic
1054266575 9:62923452-62923474 GAATGGTGTTTAGCAAAAACTGG + Intergenic
1054550070 9:66592907-66592929 GAATGGTGTTTAGCAAAAACTGG + Intergenic
1056363583 9:85882128-85882150 GGATGATTTTTGTCAAAAAATGG + Intergenic
1058071997 9:100610593-100610615 GGCTGATGGCTGGGAAAAAGTGG + Intergenic
1060151060 9:121288669-121288691 GGATGATGTTTAGGGAGGACAGG - Intronic
1062216085 9:135390580-135390602 GGATGAGGTGGGGGAGAAACAGG + Intergenic
1186537411 X:10364276-10364298 GGATGATGTTGGAGGCAAACGGG + Intergenic
1187658043 X:21503273-21503295 GAATGATCTTTGGGAAAACTTGG + Intronic
1189759241 X:44304540-44304562 GGATGATGACTGGAAATAACTGG + Intronic
1192142280 X:68655922-68655944 GGATGATCTTTGGAAGAAAAGGG + Intronic
1192149023 X:68700407-68700429 GGGTGTGGTTTGGGGAAAACAGG - Intronic
1192159082 X:68769393-68769415 TGGTGATGTTTGGGAAACACTGG + Intergenic
1197347791 X:125345541-125345563 AGAGGATGTATGGGAAAATCTGG - Intergenic
1198296279 X:135290868-135290890 TGATGATGTATGGGAAATAAAGG - Intronic