ID: 1181864739

View in Genome Browser
Species Human (GRCh38)
Location 22:25846264-25846286
Sequence CACCATCTGCAGCTTGATCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 1, 2: 4, 3: 21, 4: 171}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181864739_1181864743 -2 Left 1181864739 22:25846264-25846286 CCCAGATCAAGCTGCAGATGGTG 0: 1
1: 1
2: 4
3: 21
4: 171
Right 1181864743 22:25846285-25846307 TGAGTGGGCACCCTGTCTCATGG 0: 1
1: 0
2: 0
3: 11
4: 156
1181864739_1181864744 6 Left 1181864739 22:25846264-25846286 CCCAGATCAAGCTGCAGATGGTG 0: 1
1: 1
2: 4
3: 21
4: 171
Right 1181864744 22:25846293-25846315 CACCCTGTCTCATGGTGTCCTGG 0: 1
1: 0
2: 1
3: 12
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181864739 Original CRISPR CACCATCTGCAGCTTGATCT GGG (reversed) Exonic
900866045 1:5269404-5269426 CTCCACCAGCACCTTGATCTTGG - Intergenic
900867996 1:5282522-5282544 CACTGTGGGCAGCTTGATCTTGG + Intergenic
901676688 1:10889557-10889579 CCACATCTGCAGCTTCATCGAGG + Intergenic
902943543 1:19817195-19817217 GGCCACCTTCAGCTTGATCTGGG - Intergenic
903057241 1:20644738-20644760 CTCCATGTGCACCTTGATCAGGG + Intronic
906722100 1:48015733-48015755 CACCAGCTACAGCTTTTTCTGGG - Intergenic
908466332 1:64399707-64399729 CCCCATCAGTACCTTGATCTTGG - Intergenic
912656412 1:111489877-111489899 CACCATGTCCAGCTTGACCATGG + Intronic
915670155 1:157482328-157482350 CACCTTCTGCATCTTCAGCTTGG - Intergenic
915745664 1:158155073-158155095 CTTCATCTGCTGCTTGATGTAGG + Intergenic
916340687 1:163730260-163730282 CACCAACTTCACCTTGAGCTAGG - Intergenic
917464777 1:175266514-175266536 CTCCATCTGAAGCTTGTTTTTGG + Intergenic
919134153 1:193487911-193487933 CTCCACCTGCAGCCTGTTCTTGG - Intergenic
919570709 1:199243637-199243659 CACCATCTGGAGGAGGATCTGGG + Intergenic
920738809 1:208560574-208560596 CAGCATCTTCAGCATGACCTGGG - Intergenic
922527043 1:226311987-226312009 CAACATTGGCACCTTGATCTTGG - Intergenic
922641367 1:227235173-227235195 CACCATCTGCAGCCTGGTCTGGG + Intronic
924657738 1:245988719-245988741 CACCATCTGCTGATTGGCCTGGG - Intronic
1063058473 10:2526537-2526559 AACCACCAGCAGCTTCATCTCGG + Intergenic
1070006055 10:72425359-72425381 CAGCAGCTGCAGCTTGCTCAAGG + Intronic
1071116475 10:82227148-82227170 CACCCACTGCAGCTTGTACTTGG + Intronic
1073029160 10:100511010-100511032 CACCCTCTGCATCTTCATGTGGG - Intronic
1074104012 10:110375540-110375562 CACCACCTGCTGTGTGATCTTGG - Intergenic
1074934094 10:118160315-118160337 CATCATCTGAAGCTTGTTCTTGG + Intergenic
1076042973 10:127267189-127267211 CACCATCTGCAACCATATCTAGG - Intronic
1076657602 10:132035407-132035429 CCCCATCAGCACCTTGATCTTGG + Intergenic
1077533508 11:3108116-3108138 CACAATCTGCAGCTGGATGTGGG - Intronic
1078258805 11:9684753-9684775 TACCATCTTCATCTAGATCTGGG - Intronic
1080638740 11:34145966-34145988 CACCGTCTGAAACTTGATGTAGG - Intronic
1084922912 11:72486054-72486076 AACGTTCTGCATCTTGATCTGGG + Intergenic
1085402891 11:76245067-76245089 CTCTGTCTGCACCTTGATCTTGG + Intergenic
1086498934 11:87432414-87432436 CACCATCTTCCTCTTGATCTGGG - Intergenic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1088617746 11:111648341-111648363 CACCATTGGCACCTTGATCTAGG - Intronic
1088798126 11:113282019-113282041 CACCATTTGCAGCCTCACCTTGG + Intergenic
1089489433 11:118872575-118872597 CCGCATCTGCACCTTGATCACGG - Intergenic
1091749999 12:3016381-3016403 CACTGTCTGCAGCTTTATCGGGG - Intronic
1095737210 12:45570503-45570525 GACCATCTGCAGCCTGGTCAAGG + Intergenic
1096673518 12:53214198-53214220 CACCGCGTGCAGCTGGATCTGGG - Exonic
1098893233 12:76030899-76030921 CACCATCTGCAGCGTGATCTCGG + Exonic
1106705597 13:32275742-32275764 CATCATTTGCAGTTTGAGCTGGG - Intronic
1107542796 13:41408738-41408760 CAGCAGCTGCAGCTTCACCTGGG + Intergenic
1108530132 13:51320789-51320811 CCCCATCCACACCTTGATCTTGG - Intergenic
1109586297 13:64409197-64409219 CACCCTCTGCAACCTTATCTTGG + Intergenic
1114271381 14:21102425-21102447 CAACACCTTCAACTTGATCTTGG + Exonic
1119069892 14:71572006-71572028 CACCAGCAGCAGCTGGACCTTGG - Intronic
1119455153 14:74748863-74748885 CACCATGCCCAGCTTAATCTAGG - Intergenic
1121537022 14:94697928-94697950 CACCACCTGCTGTGTGATCTTGG + Intergenic
1123757202 15:23406183-23406205 CATCATCTGAAGGTTAATCTGGG - Intergenic
1124110410 15:26780193-26780215 CACCCTCTGCACCCAGATCTTGG + Intronic
1124338878 15:28876995-28877017 CAGCATCTGCTGTTGGATCTGGG + Intergenic
1124515245 15:30362334-30362356 CACCATCGGCATCCTGATGTCGG - Exonic
1124727677 15:32168395-32168417 CACCATCGGCATCCTGATGTCGG + Exonic
1125200440 15:37097504-37097526 CACTAACAGCAGCTTGAGCTGGG - Intronic
1126218442 15:46184225-46184247 CTCAATATGCAGCTTGAACTAGG + Intergenic
1127054585 15:55118477-55118499 CACTATCTACATCTAGATCTGGG + Intergenic
1127321204 15:57848230-57848252 CCAGATCTGCACCTTGATCTTGG - Intergenic
1129182815 15:73887666-73887688 CACCATCTGCAGCATGCTGTAGG - Exonic
1130133196 15:81160667-81160689 CACCATCTCCAGCTCCTTCTGGG - Intronic
1130777136 15:86996258-86996280 AAGAATCTGCTGCTTGATCTGGG - Intronic
1132700025 16:1218397-1218419 CGCCATCTCCAGCTCGATCTCGG - Exonic
1134459120 16:14416525-14416547 CATCATCTGAAGGTTAATCTGGG + Intergenic
1135087369 16:19486229-19486251 CCCCACCCGCACCTTGATCTTGG - Intronic
1137927774 16:52557687-52557709 AACCTGCTGCACCTTGATCTGGG - Intergenic
1139279508 16:65758165-65758187 CACCAACTTCAGCTTCACCTGGG + Intergenic
1141785249 16:86195337-86195359 CAACATCTGCAGCTCGATTTTGG - Intergenic
1141920382 16:87131849-87131871 CAGCCTCTGCAGCCTGACCTCGG - Intronic
1142217347 16:88836195-88836217 CATCACCTGCAGGTAGATCTGGG + Exonic
1143615398 17:8046483-8046505 CTCCACCAGCAGCTTGTTCTGGG - Intronic
1143711953 17:8741567-8741589 CACCATCTCCTGCTTGCGCTTGG + Exonic
1144803408 17:17947568-17947590 CCAAACCTGCAGCTTGATCTTGG + Intronic
1146264769 17:31445118-31445140 CACCATCTGCAGCAGGAGCTTGG - Intronic
1147042499 17:37729569-37729591 CTCCATCTGCAGCTGGTTCTGGG + Intronic
1148160227 17:45445595-45445617 CACCATCTGCAGGTTGATGAGGG + Exonic
1148475322 17:47924985-47925007 TTCCATTTGCAGCTGGATCTGGG - Exonic
1149866254 17:60152585-60152607 CACCCTTTGCAGCTGGCTCTTGG + Intronic
1150391519 17:64792474-64792496 CACCATCTGCAGGTTGATGAGGG + Intergenic
1150588652 17:66541249-66541271 CACAATCTGCAGCTAACTCTTGG - Intronic
1150650855 17:67009187-67009209 CCCCATCAACACCTTGATCTTGG + Intronic
1150784530 17:68151929-68151951 GATGATCTGCAGCCTGATCTAGG + Intergenic
1152327774 17:79651544-79651566 CATCTTCTGTAGCTTAATCTCGG - Intergenic
1152342153 17:79731225-79731247 CACCAGGAGCAGCTTGTTCTGGG - Exonic
1153502446 18:5762908-5762930 CAACATCTGCAGATTGGTTTGGG - Intergenic
1154272291 18:12930777-12930799 CACCAAATCCATCTTGATCTTGG - Intergenic
1158508947 18:58073168-58073190 CTCCATCTGCAGCTCAATCTGGG - Intronic
1159598177 18:70403448-70403470 CTTCATCTGCAGCTTACTCTGGG - Intergenic
1159818859 18:73114191-73114213 CAGCATTTGCAGCTCTATCTAGG - Intergenic
1160348000 18:78150798-78150820 CACCATCCACACCTTGATTTTGG + Intergenic
1160604467 18:80039024-80039046 CACCATGTCCAGCCTCATCTGGG - Intronic
1162361807 19:10224887-10224909 CACCATGGGCAGCTTGTACTCGG - Exonic
1164240651 19:23385222-23385244 CTCCCCCTGCAGCTTGATATTGG + Intronic
1164578290 19:29418830-29418852 CACCATGTGCAGCTTCTCCTGGG - Intergenic
1164790491 19:30973493-30973515 CACCCTCTGAAGCTTGACCCAGG - Intergenic
1168348979 19:55665127-55665149 GACATTCTGCAGCTTGATCGGGG - Intronic
926921096 2:17940950-17940972 CACCATCTGCCTCTGCATCTTGG + Intronic
928177675 2:29046155-29046177 CACCAGCTGAAGCTTGAGCAAGG - Intronic
929030439 2:37645872-37645894 CTCTCCCTGCAGCTTGATCTTGG - Exonic
929220818 2:39463352-39463374 AGCCATCTGAAGCTTGACCTGGG + Intergenic
929958809 2:46480592-46480614 CACCTTCTCCAGCTCCATCTCGG - Exonic
932842696 2:75098665-75098687 CACCACATCCAGCTTGCTCTAGG + Intronic
933591606 2:84239209-84239231 AACCATCTGGACCATGATCTAGG - Intergenic
935450083 2:103199549-103199571 CCACATCTGCATCTTCATCTGGG + Intergenic
935542324 2:104363107-104363129 CACGTTCTGCATCTGGATCTTGG - Intergenic
936133777 2:109871290-109871312 CACCCTCTGCTGCTTGAGCCAGG - Intergenic
936210920 2:110500195-110500217 CACCCTCTGCTGCTTGAGCCAGG + Intergenic
936435447 2:112501298-112501320 CACCCTCTGCTGCTTGAGCCAGG + Exonic
937707954 2:124942916-124942938 CCCTATCTGCAGCTTCTTCTAGG + Intergenic
938289453 2:130141715-130141737 CACCTTCTGCAGAGTGAACTGGG - Intronic
939619707 2:144403940-144403962 CACCATATGCCGCTCGAGCTGGG + Exonic
942248618 2:174029163-174029185 CACCTTCTGCAGGTTGAATTTGG - Intergenic
945181078 2:207091841-207091863 CAACAGCCACAGCTTGATCTTGG + Intronic
945372937 2:209043383-209043405 CCCCATCAGCACCTTGATTTTGG - Intergenic
946131728 2:217611775-217611797 CACCATCTGGAGATTCATCCAGG + Intronic
946213004 2:218162514-218162536 CCCCATCTGAAGCTTGATCTAGG + Intergenic
948238017 2:236404868-236404890 CAGAATCTGCACCTTGATCTAGG - Intronic
1172213668 20:33218525-33218547 CCCTATTTGCATCTTGATCTTGG - Intronic
1181864739 22:25846264-25846286 CACCATCTGCAGCTTGATCTGGG - Exonic
1182869749 22:33635597-33635619 CACCTTCTTCAGCTTGAATTTGG - Intronic
1183490038 22:38111240-38111262 CACAATCTTCAACTTCATCTTGG - Intergenic
1184204235 22:42991120-42991142 CTCCATCTGCTTTTTGATCTGGG - Intronic
949396505 3:3620045-3620067 CATCATCAGCAGCATCATCTAGG + Intergenic
950146872 3:10656374-10656396 CAACATCTGCAGAGTGCTCTGGG - Intronic
954138625 3:48593885-48593907 CACCATCTGCAGGTGGGCCTGGG + Intronic
959622219 3:108410825-108410847 CACCAGCTGCAGCTGGAGCTCGG - Exonic
960203220 3:114863351-114863373 CACAATCTGAAGCTTCATCTGGG + Intronic
962987983 3:140553109-140553131 CACCCTCTGGTGCTAGATCTTGG - Intronic
963564098 3:146906102-146906124 TACCATTGGCACCTTGATCTTGG - Intergenic
964428235 3:156575849-156575871 CACCATCTGCAGCATGAGGCTGG - Intergenic
964431274 3:156608794-156608816 AACCTGCTGCACCTTGATCTTGG + Intergenic
965553985 3:170000777-170000799 CACAATCTGAAGCTTGAAGTTGG - Intergenic
966957731 3:184901100-184901122 CTCCTTCTGCAGCTTGATTATGG - Intronic
968058139 3:195708759-195708781 CACCATCTGCAGCACCATCTTGG - Intergenic
968607735 4:1543411-1543433 CACCATCTGCAGCTGGCCCTTGG - Intergenic
969110339 4:4840409-4840431 CCCCATCAGCACCTTGGTCTTGG - Intergenic
969993688 4:11290412-11290434 CTCCAGCAGCAGCTTGGTCTGGG + Intergenic
971259913 4:25046723-25046745 CACCACTTGGATCTTGATCTTGG - Intergenic
972805045 4:42520950-42520972 AACCATCTGCAGCTAGAACATGG + Intronic
973978462 4:56286017-56286039 CAACCACTGCAGCTTTATCTGGG + Intronic
978469987 4:109054908-109054930 CAACAGCTGCAGCTGGCTCTTGG + Intronic
982018211 4:151176844-151176866 CATCATCTGCAGCAGGCTCTTGG - Exonic
982693693 4:158575678-158575700 CTCCACCAGCACCTTGATCTTGG + Intronic
983785306 4:171722202-171722224 CAGTATCTGCAGCTTCATCAGGG + Intergenic
988339098 5:29946187-29946209 AACCATCACCAGCTTGCTCTTGG - Intergenic
988623855 5:32850238-32850260 GACCAGCAGCACCTTGATCTGGG + Intergenic
988739805 5:34059174-34059196 CACCCTGTACACCTTGATCTTGG - Intronic
988989020 5:36651278-36651300 CACCATCTGCACCCTAGTCTGGG + Intronic
994885193 5:105551233-105551255 CACTGTCAACAGCTTGATCTTGG + Intergenic
996507290 5:124282169-124282191 CACCAATAGAAGCTTGATCTTGG + Intergenic
997695225 5:135856300-135856322 GACAGTCTCCAGCTTGATCTTGG + Intronic
1000231980 5:159324438-159324460 CACCATCAGCAGCATCACCTTGG + Intronic
1001034184 5:168285435-168285457 CACCATCTCCACCCTGATCCAGG - Intergenic
1001697037 5:173678566-173678588 CCCCACCAGCACCTTGATCTTGG - Intergenic
1011930904 6:92711272-92711294 CAGCATCTGCAACTTGTACTGGG - Intergenic
1014051191 6:116956791-116956813 CAATATCTGCCTCTTGATCTTGG - Intergenic
1014108088 6:117589801-117589823 CCCCATCTCCAGTTTGATCATGG - Intronic
1014222608 6:118813171-118813193 GACCAGCTGAATCTTGATCTGGG - Intergenic
1016471489 6:144379368-144379390 CATCATCTGAAGCTTGACCGAGG + Intronic
1019059790 6:169248780-169248802 CTCCTTCTGCCGCATGATCTTGG + Exonic
1023180145 7:37474309-37474331 AACCATCTGCATCCTGGTCTTGG - Intergenic
1025000844 7:55313341-55313363 GAGCATCTGCAGCTGGATCTAGG + Intergenic
1026955572 7:74374378-74374400 CTCCAAATGCATCTTGATCTAGG + Intronic
1028978079 7:96936157-96936179 CCCCAACAGCACCTTGATCTTGG + Intergenic
1029562883 7:101315254-101315276 CACCAGCTTCAGCTTGTTCAAGG + Exonic
1030610126 7:111680141-111680163 CACCATCTCCATCTTGAACAGGG - Intergenic
1030967682 7:116013892-116013914 CACCATATGCTGCAAGATCTAGG + Intronic
1033137977 7:138800558-138800580 AACCATCAACACCTTGATCTTGG - Intronic
1035108436 7:156460999-156461021 CTCCACCTGCACCCTGATCTGGG - Intergenic
1035314571 7:157990135-157990157 CCCCAGCTGCAGCTTCACCTGGG - Intronic
1035635254 8:1139393-1139415 CACCTGCTGCACCTTGATCACGG - Intergenic
1039558101 8:38491343-38491365 CCTCATCAGCACCTTGATCTTGG - Intergenic
1044771558 8:95641015-95641037 CACCCTCTGCAGCTGGAAGTGGG - Intergenic
1045575483 8:103415442-103415464 CAGCATCTTCACCTTCATCTCGG - Exonic
1046097953 8:109582671-109582693 CACCATCATCACCATGATCTAGG + Intronic
1048313584 8:133345251-133345273 CACCTTCTGCAGAGTGATCCTGG - Intergenic
1049653925 8:143789512-143789534 CCCCACCTGCAGCGTGAGCTTGG - Intergenic
1051911918 9:22162490-22162512 CCCCAGTTGCAGCTTTATCTAGG - Intergenic
1056423319 9:86451682-86451704 AACCTGCTGCACCTTGATCTTGG - Intergenic
1057925718 9:99146252-99146274 CACTATCTGCCTCATGATCTTGG - Intronic
1059250786 9:112886425-112886447 CAGCATCTGCTGCTTGGGCTGGG - Intronic
1060001463 9:119962594-119962616 CACCATCTGTAGCTTTTTCCTGG + Intergenic
1061188540 9:129069110-129069132 CACCATCAGCAGCCTCCTCTTGG - Exonic
1061319772 9:129821250-129821272 CACCATCTGGATCTTGATCTCGG - Intronic
1062070621 9:134553292-134553314 CAGCAGCTGCAGTTTGATTTGGG + Intergenic
1062376360 9:136263619-136263641 CACCTGCTGCAGCTTGGCCTGGG + Intergenic
1185895671 X:3856444-3856466 CACAATGTGTACCTTGATCTAGG + Intergenic
1185900790 X:3894868-3894890 CACAATGTGTACCTTGATCTAGG + Intergenic
1185905905 X:3933307-3933329 CACAATGTGTACCTTGATCTAGG + Intergenic
1186397240 X:9222465-9222487 CAGCATCTGCAGCTCGCTCCAGG - Intergenic
1186606415 X:11097653-11097675 AACCACTTGCACCTTGATCTTGG - Intergenic
1188666256 X:32824907-32824929 CATCATCTGCATCATCATCTGGG + Intronic
1192550107 X:72046790-72046812 CTCCATCTGAATCTTGCTCTGGG - Intergenic
1195973335 X:110498117-110498139 CACCACCGGCACCTTGATCTTGG - Intergenic
1196021735 X:110997939-110997961 CACCACCAGCACCTTGATCTTGG + Intronic
1197778573 X:130137398-130137420 CACCATCTGAAGCTTAATCTGGG - Intronic
1199971026 X:152861311-152861333 CACCATCTGCAGCATGTCTTAGG + Intronic
1200066183 X:153505124-153505146 CACCATCACCAGCATGAACTTGG - Intronic
1200179075 X:154139430-154139452 CTCCATCTGCAGCTGCATCCCGG + Intergenic
1201372322 Y:13278858-13278880 CACCATCTGCTAATTGATGTAGG + Intronic