ID: 1181865057

View in Genome Browser
Species Human (GRCh38)
Location 22:25848271-25848293
Sequence CAGGGATACGGGAGGCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181865047_1181865057 18 Left 1181865047 22:25848230-25848252 CCAGGAGATGATGATATGACTTG 0: 1
1: 0
2: 0
3: 12
4: 145
Right 1181865057 22:25848271-25848293 CAGGGATACGGGAGGCCCTGAGG 0: 1
1: 0
2: 1
3: 19
4: 241
1181865046_1181865057 19 Left 1181865046 22:25848229-25848251 CCCAGGAGATGATGATATGACTT 0: 1
1: 0
2: 0
3: 22
4: 220
Right 1181865057 22:25848271-25848293 CAGGGATACGGGAGGCCCTGAGG 0: 1
1: 0
2: 1
3: 19
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181865057 Original CRISPR CAGGGATACGGGAGGCCCTG AGG Intronic
900316582 1:2060178-2060200 CACGGATGCTGGAGGCCGTGTGG - Intronic
900529313 1:3144940-3144962 CAGGGGTTCCTGAGGCCCTGGGG - Intronic
900641274 1:3689142-3689164 CTGGGATCGGGGATGCCCTGGGG - Intronic
900794553 1:4700271-4700293 CAGGTTTGAGGGAGGCCCTGGGG + Intronic
901949440 1:12730400-12730422 CAGGGAATAGGGAGGCCCTAAGG + Intergenic
902411208 1:16212539-16212561 CAGGGCTCCGGGACACCCTGGGG + Exonic
902481937 1:16716744-16716766 CAGGGGTAGGGGAGGCTTTGGGG + Intergenic
903070938 1:20726768-20726790 GAGGGATTCTGGAGGCCCAGGGG + Intronic
904219123 1:28950603-28950625 AAGGGAGAGGGGAGGCCCTTTGG - Intronic
905863336 1:41364286-41364308 CAGGTACAAGGAAGGCCCTGAGG + Intronic
906165607 1:43683887-43683909 GAGGGATAAGGGTGGGCCTGTGG + Intronic
906295159 1:44645114-44645136 CAGAGAAACAGGAAGCCCTGAGG + Intronic
907069148 1:51518821-51518843 CTGGGATGCGTGCGGCCCTGTGG + Intronic
907792700 1:57682784-57682806 GAGGGATATGGGAAGTCCTGGGG - Intronic
908413139 1:63886469-63886491 CAGGGATCCGGGAAGGTCTGTGG + Intronic
908700812 1:66898017-66898039 CAGGGATGCCCAAGGCCCTGGGG + Intronic
909511826 1:76462026-76462048 CAAGGAAACAGGAGGCCATGTGG - Intronic
913238294 1:116804255-116804277 CAGGGATACTGGAGTCTATGAGG + Intergenic
915916862 1:159945646-159945668 CAGGGCGACGGGAGGCGCTCGGG - Intergenic
916075305 1:161197135-161197157 CAGGGCTGCGGGAGCCCCAGAGG + Intronic
916618288 1:166467881-166467903 CAGGGATTGGGGAAGACCTGTGG + Intergenic
916806935 1:168268700-168268722 CAGGGTTATGGCAGGACCTGGGG + Intergenic
920694344 1:208170481-208170503 CAGGGGAGCAGGAGGCCCTGTGG + Intronic
921601501 1:217111186-217111208 AAGTGATAAGGGGGGCCCTGGGG - Intronic
1062913657 10:1231059-1231081 CAGAGATGTGGGAGGCCCAGTGG + Intronic
1063577162 10:7272536-7272558 CAGGGATCAGGGAGGCTGTGGGG - Intronic
1064605604 10:17035806-17035828 CAGGGAAACAGCAGGCACTGGGG + Intronic
1066479211 10:35779249-35779271 CAGGGATCAGGGAGGCCATGCGG + Intergenic
1067046071 10:42985903-42985925 CAGGGAGACGCCAGGACCTGTGG + Intergenic
1068488078 10:57684782-57684804 CACATATAGGGGAGGCCCTGAGG - Intergenic
1069636590 10:69929048-69929070 CAGGGGGAGGGGAAGCCCTGGGG - Intronic
1069717943 10:70532785-70532807 CAGGGCTGGGGGTGGCCCTGTGG - Intronic
1069915972 10:71787022-71787044 CAGGGGTACTGGAGGTTCTGAGG + Intronic
1069990078 10:72309759-72309781 AAGGGAAGCGGGAGGCACTGGGG - Intergenic
1070841632 10:79491617-79491639 GAGGGAGACTGGAGGCCCAGCGG - Intergenic
1073350291 10:102814664-102814686 CAGCCATCCGGAAGGCCCTGGGG + Exonic
1075207026 10:120457021-120457043 GAGGGATCCGGGAGTCCCTGAGG + Exonic
1075389660 10:122083418-122083440 TAGGGAGATGGCAGGCCCTGAGG - Exonic
1076692893 10:132232783-132232805 CAGGGCTCCGGGTGGCGCTGTGG - Intronic
1076718884 10:132384022-132384044 CAGGGCTGCTGGAGGCCCTGGGG - Intergenic
1077138305 11:1012520-1012542 CTGGGGAACGGGAGGCCCCGTGG + Intergenic
1077147931 11:1054127-1054149 CGGGGATCCGGGAGGCAGTGGGG + Intergenic
1077219072 11:1407423-1407445 CAGGAAGACGGGTGGCACTGTGG - Intronic
1077538762 11:3136665-3136687 CAGGCCCACAGGAGGCCCTGGGG + Intronic
1078156903 11:8807310-8807332 CAGGGAGATGGGAGGCTCTGAGG - Intronic
1078310347 11:10234876-10234898 AAGGGATACGGGTGGCCAGGTGG + Intronic
1079111513 11:17607791-17607813 CAGGGTGAGGGGAGGCACTGGGG - Intronic
1080004788 11:27395164-27395186 CAGGGCTATCTGAGGCCCTGGGG - Intronic
1081666747 11:44921094-44921116 CATGGATTCCTGAGGCCCTGAGG + Intronic
1083492080 11:63020716-63020738 CAGGGACACAGGACGCTCTGAGG + Intergenic
1083775163 11:64891102-64891124 CAGGGATAGGGGAGGGCCGGGGG - Intergenic
1084014628 11:66371370-66371392 CTGGGAGGCGGGAGGGCCTGCGG - Intronic
1085405207 11:76257486-76257508 CAGGGATACCGGGGGCAGTGAGG - Intergenic
1085410713 11:76288782-76288804 CAGGGCTACGGGAGGAGCAGAGG + Intergenic
1085804107 11:79618892-79618914 CAGGGAGACAGGAGGACGTGGGG - Intergenic
1088847783 11:113682322-113682344 CAGGGAAGCTGCAGGCCCTGAGG + Intergenic
1089777781 11:120850682-120850704 CAGGGAGGCTGGTGGCCCTGAGG + Intronic
1090047884 11:123351694-123351716 CAGGGATCAGAGAGGCTCTGAGG - Intergenic
1090392527 11:126398409-126398431 CAGGGCTGCCGGAGGCCTTGGGG - Intronic
1091112979 11:132987793-132987815 CAGGGTGAAGGGAGGCCTTGGGG - Intronic
1094311409 12:29087420-29087442 CAGGGCTAGGGGAGGGGCTGGGG - Intergenic
1096650374 12:53059427-53059449 CAGGGCTACCGGGAGCCCTGCGG + Exonic
1096872717 12:54604181-54604203 CAGGTATACCTGAGGCACTGCGG + Intergenic
1097039162 12:56144141-56144163 CACAGATACAGAAGGCCCTGAGG - Intronic
1100019954 12:90057225-90057247 CAGGGAAAGCGCAGGCCCTGAGG - Intergenic
1101999055 12:109545319-109545341 CTGGGGCACAGGAGGCCCTGTGG - Intergenic
1102025283 12:109711150-109711172 CAGGGGTCCGACAGGCCCTGAGG - Intergenic
1102908356 12:116694453-116694475 CAGGGACTCGGCAGGGCCTGGGG - Intergenic
1103294791 12:119877102-119877124 CAGGGCTGCGGGAGGCCTGGAGG - Intronic
1103798409 12:123520921-123520943 CAGGGCTGCTGGAGACCCTGTGG - Intronic
1104648132 12:130511563-130511585 CAGGGTTAGGGGAGCCACTGGGG - Intronic
1104730177 12:131101070-131101092 CAGGGACACGGGAAGCCCTGAGG - Intronic
1104897560 12:132171788-132171810 CAGGGAGACAGGAGGCCCACGGG - Intergenic
1104951797 12:132444459-132444481 GAGGGCTCCGGGAGGCCCAGAGG - Intergenic
1106192773 13:27468526-27468548 CAGGGACACTGGAGGACCGGAGG - Intergenic
1108664685 13:52617708-52617730 CAGGGATGCCCGAGGACCTGCGG - Intergenic
1110390406 13:74967063-74967085 CAGGAAGTCAGGAGGCCCTGGGG + Intergenic
1110766499 13:79285166-79285188 CAGGGAATAGGGAGGGCCTGAGG - Intergenic
1112212031 13:97387503-97387525 CAGGGGAAGGCGAGGCCCTGGGG - Intronic
1113800559 13:113084309-113084331 CTGGGGTACAGGAGGTCCTGGGG - Intronic
1115642248 14:35342109-35342131 GAGGGACAGCGGAGGCCCTGTGG - Intergenic
1118696429 14:68390687-68390709 AAGGGATATTAGAGGCCCTGTGG + Intronic
1121358316 14:93232884-93232906 GAAGGAGCCGGGAGGCCCTGAGG + Intergenic
1121970892 14:98354873-98354895 GAGGCAGACGGGAGGCCATGGGG + Intergenic
1122779539 14:104137916-104137938 CCGGGAAGCGGGAGGTCCTGCGG - Intergenic
1122849049 14:104516825-104516847 CAGGAAACTGGGAGGCCCTGAGG - Intronic
1123072283 14:105647706-105647728 CAGGGACAGGGGAGGCACAGGGG - Intergenic
1123092290 14:105747224-105747246 CAGGGACAGGGGAGGCACAGGGG - Intergenic
1123097868 14:105774925-105774947 CAGGGACAGGGGAGGCACAGGGG - Intergenic
1124475357 15:30028433-30028455 CAGGGCCAGGGAAGGCCCTGCGG + Intergenic
1124504617 15:30262056-30262078 CAGGGTGACCCGAGGCCCTGGGG + Intergenic
1124738935 15:32276579-32276601 CAGGGTGACCCGAGGCCCTGGGG - Intergenic
1125074220 15:35594194-35594216 CAAGGATGTGGGAAGCCCTGTGG - Intergenic
1126206653 15:46053251-46053273 GAGGGATATGGGCAGCCCTGGGG + Intergenic
1126406856 15:48331340-48331362 CAGGGATGGCGCAGGCCCTGGGG - Intronic
1126686352 15:51251938-51251960 CAGAGATAAGAGGGGCCCTGTGG - Intronic
1128682980 15:69664897-69664919 TAGGGGTAGGGGAGGCACTGAGG + Intergenic
1129784375 15:78299426-78299448 CAGGGATGCTCCAGGCCCTGGGG - Intronic
1132477523 16:148690-148712 TAGGGAAAGAGGAGGCCCTGGGG + Intergenic
1136427706 16:30180263-30180285 CAGGTACTCGGGAGGCTCTGAGG + Intergenic
1137492141 16:48942166-48942188 CAGGGATAGGGAGGGACCTGTGG - Intergenic
1138532388 16:57641498-57641520 CAGGGATTAGGAAGGCACTGGGG - Intronic
1138551893 16:57752963-57752985 GAGGGAGGCGGGTGGCCCTGTGG - Intronic
1141711965 16:85704989-85705011 CAGGGATACGGTGGGCCCCAAGG - Intronic
1141741855 16:85898885-85898907 CAGGAATTCCGGAGGCCCCGCGG - Exonic
1141839262 16:86564157-86564179 CAGGAACACGCGAGGCCCTCTGG + Intergenic
1143408833 17:6696451-6696473 TAGGGATCCAGGAGACCCTGGGG + Intronic
1144435127 17:15233235-15233257 CAAGGGTAAGTGAGGCCCTGAGG + Intronic
1145090259 17:19980153-19980175 CAGGGATCCGAGATGCCCTCGGG + Intergenic
1146553856 17:33806066-33806088 CTGGGACATGGGAGCCCCTGCGG - Intronic
1146922426 17:36722539-36722561 CGGGGACAGGGGAGCCCCTGCGG + Intergenic
1147562790 17:41519406-41519428 CAGGGAGAGTGGAGGCCCTGGGG + Exonic
1147686016 17:42287421-42287443 CAGGCAGAGGGGAGGCCCAGAGG + Intergenic
1148124412 17:45229495-45229517 CGGGGATGTGGGAGACCCTGAGG - Intronic
1148211343 17:45810660-45810682 CAGGCATACGGGAGGCATGGAGG - Intronic
1151707653 17:75779272-75779294 CGGGGAGGCGGGAGGCCCGGCGG - Intronic
1151898968 17:76999123-76999145 CACTGATACGGGATGTCCTGAGG - Intergenic
1152387057 17:79980934-79980956 CTGGGCCCCGGGAGGCCCTGAGG + Intronic
1152720441 17:81921034-81921056 CAGGGATGAGGGAGTCACTGTGG - Exonic
1153056941 18:955188-955210 CAGGGAAAAGGGAAGCCCAGTGG - Intergenic
1154414941 18:14171524-14171546 CAGGGATATGGCAGGACCAGGGG + Intergenic
1157678330 18:49583984-49584006 CAGGGAGACGGGTGGGCCAGTGG + Intronic
1158819606 18:61144383-61144405 CAGGGACAGGGGAAGCTCTGTGG - Intergenic
1160895169 19:1399087-1399109 CTGGGATGCGGGAGGCCCTCGGG - Intronic
1162573370 19:11485132-11485154 CAGCGATAGGGCATGCCCTGAGG - Intronic
1163033835 19:14560682-14560704 CAGGGACTCAGGAGGCCCCGTGG + Intronic
1164320258 19:24137924-24137946 CAGGCAGCAGGGAGGCCCTGGGG - Intergenic
1164637988 19:29805516-29805538 CCTGGATACGGGAGGGCCTCTGG - Intergenic
1165408724 19:35645366-35645388 CAGGGACACAGTAGGCCCTATGG - Intergenic
1166747761 19:45149863-45149885 CCGGGATCCTTGAGGCCCTGGGG - Exonic
1166766096 19:45252562-45252584 CAAGGAAGGGGGAGGCCCTGGGG - Intronic
1166862010 19:45816347-45816369 CTGGGAGACGGGTGGCCCAGAGG + Intronic
1167166674 19:47803657-47803679 CAGGGCCAGGGGAGGGCCTGGGG + Exonic
1167175163 19:47860107-47860129 CAGGGCCAGGGGAGGGCCTGGGG - Intergenic
1167602864 19:50464810-50464832 CAGGTACACTGGAGGCCTTGGGG - Intronic
1168706319 19:58472258-58472280 CAGGGACAAGGGAGGCCCTTTGG + Exonic
925306009 2:2848832-2848854 GAGGGAGAGGGGAGGGCCTGGGG + Intergenic
925560679 2:5190820-5190842 CAGGCACACGAGAGGCACTGCGG - Intergenic
926168250 2:10534906-10534928 CAGTCACACGGGAGGCACTGTGG - Intergenic
927598987 2:24423589-24423611 CAGGGTGCTGGGAGGCCCTGGGG + Intergenic
931653657 2:64490673-64490695 CAGGGATACGGCAGGGCCTCTGG + Intergenic
934978705 2:98823179-98823201 CCGGGATTCGGGGGGCCCTCCGG + Exonic
935673825 2:105577118-105577140 CAGGGCAGCAGGAGGCCCTGAGG - Intergenic
945539656 2:211068762-211068784 CAGGGATGGGGGCTGCCCTGAGG + Intergenic
948484243 2:238270592-238270614 CTGGGGCACAGGAGGCCCTGAGG + Intronic
948694878 2:239728180-239728202 CAGGAAGACGGGAGGCCCACTGG - Intergenic
1168794973 20:605369-605391 CTGGGAAAGGGGACGCCCTGAGG - Intronic
1171365210 20:24618160-24618182 CAGGGAAGGGGGAGACCCTGGGG + Intronic
1172386718 20:34539204-34539226 CAGTGAAACGGGAGGCACTCAGG + Intronic
1173199540 20:40944397-40944419 CAGGGGTTGGGGAGGCACTGAGG + Intergenic
1174401246 20:50277128-50277150 CAGAGATCCTGCAGGCCCTGTGG - Intergenic
1174487440 20:50870339-50870361 CAGGGCAAACGGAGGCCCTGAGG + Intronic
1175268013 20:57714252-57714274 CAGGGGCACGGCTGGCCCTGAGG - Intergenic
1175358782 20:58390466-58390488 CAGTGATGTGGGAGGCTCTGGGG + Intronic
1175517712 20:59579432-59579454 CGGGGAGCAGGGAGGCCCTGAGG + Intronic
1176706388 21:10122240-10122262 CAGGGATACCAGGGTCCCTGGGG - Intergenic
1180038336 21:45262507-45262529 CAGGGATACCGCAGGCACTCAGG + Intergenic
1180147184 21:45928146-45928168 CGGAGATACACGAGGCCCTGCGG - Intronic
1181865057 22:25848271-25848293 CAGGGATACGGGAGGCCCTGAGG + Intronic
1182130248 22:27845237-27845259 CAAGGATACTGGATGCCCTGCGG + Intergenic
1182288023 22:29259461-29259483 CTGAGATGCGGGAGGGCCTGGGG - Exonic
1182466693 22:30521271-30521293 CAGGCATAAGGGAGTCTCTGAGG + Intergenic
1182946936 22:34332952-34332974 CAGGGTTATGGCAGGACCTGGGG + Intergenic
1183233238 22:36596283-36596305 CAGGGATTCGGGAGGCCTCAGGG + Intronic
1183241002 22:36658372-36658394 CAGGCATCAGGGAGGCCATGGGG + Intronic
1183489387 22:38108560-38108582 CAGGGGGATGGGAGGCCCTGAGG + Intronic
1183672312 22:39280262-39280284 CTGAGAAACGGGAGGGCCTGGGG - Intergenic
1184194263 22:42916283-42916305 CAGGTAAAGGGGAGGACCTGGGG + Intronic
1184797599 22:46740991-46741013 CAAGGAGAAGTGAGGCCCTGTGG - Intergenic
1185313674 22:50170027-50170049 CAGGGGTGGGGGCGGCCCTGCGG - Intergenic
950431661 3:12954421-12954443 CAGGGCTGGGAGAGGCCCTGGGG + Intronic
951702190 3:25507725-25507747 CAGGGATAGGGGAGACACTGGGG + Intronic
953790917 3:45947315-45947337 CAGGGTTAAGGCAGGCCCTCAGG - Exonic
953891791 3:46756481-46756503 CCAGGATCCTGGAGGCCCTGCGG + Exonic
953912372 3:46899510-46899532 CAGGGAGAGGGCAGCCCCTGGGG + Intronic
954372311 3:50175272-50175294 GAGGTAGAGGGGAGGCCCTGGGG - Intronic
954410483 3:50368485-50368507 CGGAGAGACGGGAGGCTCTGCGG - Intronic
961174257 3:124821029-124821051 TTGGGATACGGGTGGCCCAGGGG - Intronic
961624160 3:128248000-128248022 CAGGGGTGCGGGAGGCACAGGGG + Intronic
961904309 3:130246688-130246710 AAGGGATAAGGGAGGAACTGGGG + Intergenic
964716956 3:159732630-159732652 CAAGGTTACAGAAGGCCCTGAGG + Intronic
965133428 3:164730962-164730984 CAGAGATACGGCAGCCCCTGTGG - Intergenic
965908457 3:173740522-173740544 CAGGGGTATGGGAGGGCATGAGG - Intronic
968905401 4:3448443-3448465 CAGGGCTCTGGGTGGCCCTGGGG - Intronic
968944547 4:3656745-3656767 AAGGGATGAGGGAAGCCCTGGGG - Intergenic
969307758 4:6335547-6335569 TAGGGAAACGGGAGCCACTGAGG + Intronic
969611000 4:8227779-8227801 CAGGGACTCGGGAGCCCCAGAGG + Exonic
969639329 4:8387642-8387664 CAGGGACACGGGTGGCACGGAGG + Intronic
970524410 4:16916903-16916925 GAGGGAGACAGGAGGCGCTGAGG - Intergenic
970610997 4:17725139-17725161 CAGGCATACGGCAGGTCCTCAGG + Intronic
975464999 4:74698945-74698967 CAGGGATAGGCCAGGCCCAGTGG - Intergenic
976388649 4:84486887-84486909 CAGGCTTATGCGAGGCCCTGAGG - Intergenic
976763439 4:88574225-88574247 CAAGGATAGGGGAAGTCCTGTGG + Intronic
980743745 4:136987939-136987961 CAGAGATTTGGGAGGCCCAGGGG + Intergenic
983503588 4:168528011-168528033 CAGGGATAAGGGATCACCTGGGG - Intronic
985784831 5:1887996-1888018 CAGGGTTAGGGGAGGGCATGGGG + Intergenic
986306306 5:6519596-6519618 CTGGGGTACAGGATGCCCTGGGG - Intergenic
986451299 5:7868787-7868809 CAGACAGACGGGAGGCCCCGCGG + Intronic
987137280 5:14912079-14912101 CAGGGAAACTGGAGCCCCTGAGG - Intergenic
988166066 5:27590823-27590845 GAGGGATATGGGGAGCCCTGGGG + Intergenic
991597318 5:68318931-68318953 AAGGGGTACAGGAGGCCTTGAGG + Intergenic
997582121 5:135024645-135024667 CAGGGACAGAGGAAGCCCTGGGG - Intergenic
999438208 5:151580908-151580930 CAAGGATCCAGCAGGCCCTGTGG + Intergenic
999736869 5:154519358-154519380 CAGGGAGAAGGGAGCACCTGTGG - Intergenic
1001517327 5:172365081-172365103 CAGGGAAATGGGAGGGCCTTTGG + Intronic
1003861463 6:10326067-10326089 CAGGGATACCAGTGTCCCTGGGG + Intergenic
1006083701 6:31581755-31581777 CAGGGAGCTGGGAGCCCCTGAGG + Intronic
1006431540 6:34000319-34000341 CTGGGCTTGGGGAGGCCCTGAGG + Intergenic
1009042464 6:58195693-58195715 CAGGGTTACGGTGTGCCCTGTGG + Intergenic
1010029257 6:71256156-71256178 CAGGGATAGGGGTGGGGCTGGGG + Intergenic
1011243690 6:85299529-85299551 AAGGGATAAGAGAGGCCCTGTGG + Intergenic
1011935398 6:92770401-92770423 CAGGGCTACCTGAGGCACTGGGG + Intergenic
1012506560 6:99953383-99953405 CAGAAATACTGGAGGCCATGAGG + Intronic
1013639600 6:112060169-112060191 CATGGAAATGGGAGGCCATGAGG + Intronic
1017962605 6:159234265-159234287 AAGGGACGTGGGAGGCCCTGGGG - Exonic
1018224581 6:161616003-161616025 AAGAGAGACGGGAGACCCTGAGG - Intronic
1018253013 6:161891206-161891228 CAGGGGAAGGGGAGGCGCTGTGG - Intronic
1018906432 6:168078808-168078830 CAGGGCTCCGGGTGGCCGTGGGG - Intronic
1019175347 6:170156725-170156747 CACGCAGACAGGAGGCCCTGTGG - Intergenic
1019571902 7:1716785-1716807 CAGGGGAACTGGAGGGCCTGGGG + Intronic
1022519355 7:30995936-30995958 CAGGGAGACAGGAAGCCTTGTGG + Intergenic
1024306960 7:47937459-47937481 CAGAGTTACGGGAGGCCAAGTGG + Intronic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1027471023 7:78574181-78574203 CACGGAAACTGGAGGCACTGGGG - Intronic
1029995178 7:105000919-105000941 CAGGGATAGGGGTGGCCGTGTGG - Intergenic
1035749597 8:1987089-1987111 CAGAGACACTGGAAGCCCTGTGG + Intronic
1038427081 8:27470664-27470686 CTGGGATACAGGAGGCACTCGGG - Intronic
1040007300 8:42631216-42631238 CAGTGGTATGGGAGGCACTGAGG - Intergenic
1040007651 8:42633633-42633655 CAGTGGTATGGGAGGCGCTGAGG + Intergenic
1043960892 8:86417100-86417122 CAGGGATTCAGGAGTCCCTGGGG + Intronic
1044164759 8:88967905-88967927 CAGGGATGCTGGAGGCCTTCAGG + Intergenic
1047882961 8:129216833-129216855 CAGGGTTACGGGGGACACTGTGG + Intergenic
1048310420 8:133318331-133318353 GAGGGAGTCGGGAGCCCCTGTGG - Intergenic
1049197650 8:141324483-141324505 GAGAGATACGTGAGGCCCAGAGG - Intergenic
1049291762 8:141807007-141807029 CAGGGGCACGGGTTGCCCTGTGG + Intergenic
1049620112 8:143594364-143594386 CAGGGACAGGGGAGGCTGTGAGG - Intronic
1049861287 8:144901143-144901165 CGGGGGTGCGGGAGGGCCTGAGG + Intronic
1051669141 9:19493151-19493173 CAGGGATAGGGAAGGCCCAGGGG - Intergenic
1053643679 9:40109363-40109385 CAGGGATACCAGGGTCCCTGGGG - Intergenic
1053762474 9:41356127-41356149 CAGGGATACCAGGGTCCCTGGGG + Intergenic
1054324534 9:63706594-63706616 CAGGGATACCAGGGTCCCTGGGG - Intergenic
1054541071 9:66267244-66267266 CAGGGATACCAGGGTCCCTGGGG + Intergenic
1056886524 9:90448725-90448747 CAGGGATTGGCGAGGCCCTAGGG + Intergenic
1058974679 9:110114986-110115008 CAGGGATACGGGGAGCAGTGGGG - Intronic
1059439676 9:114299978-114300000 GAGGGAAAAGGCAGGCCCTGAGG + Intronic
1060304096 9:122394797-122394819 CAGGGATCCAGGCTGCCCTGGGG - Exonic
1060798321 9:126527431-126527453 CAGGGAGATGGCAGGCCCTGTGG - Intergenic
1061004063 9:127918443-127918465 CCTGGATAGGGGAGGCACTGAGG - Intergenic
1061590733 9:131596048-131596070 CAAGGACCCTGGAGGCCCTGGGG + Intronic
1061918291 9:133768645-133768667 CAGTGATCCAGGAGGCCCTTGGG + Intronic
1062001233 9:134216761-134216783 GAGGGCTGTGGGAGGCCCTGGGG - Intergenic
1062048525 9:134435429-134435451 CAGGGATGGGCCAGGCCCTGAGG + Intronic
1062285403 9:135770521-135770543 CAGGCACAGGGGTGGCCCTGGGG + Intronic
1062489805 9:136799617-136799639 GTGGGATACAAGAGGCCCTGGGG + Intronic
1202791426 9_KI270719v1_random:92329-92351 CAGGGATACCAGGGTCCCTGGGG - Intergenic
1186355911 X:8789555-8789577 CAGGAATAAGTGAGTCCCTGTGG - Intergenic
1188961673 X:36500694-36500716 GAGGGAAATGGGAAGCCCTGGGG + Intergenic
1193903215 X:87209400-87209422 AAGGGATAAGGGGGGCCCTCTGG + Intergenic
1195056599 X:101151992-101152014 CTGGGAGGTGGGAGGCCCTGGGG - Intronic
1197444565 X:126534885-126534907 CAGGGATTCTGCAGTCCCTGTGG - Intergenic
1199988829 X:152972423-152972445 CAGGGATCCAGGATGCCCAGAGG - Exonic
1200141371 X:153904568-153904590 CCGGGACCAGGGAGGCCCTGGGG + Intronic