ID: 1181866016

View in Genome Browser
Species Human (GRCh38)
Location 22:25855982-25856004
Sequence GAGGGTAAAGAGTGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5588
Summary {0: 6, 1: 46, 2: 436, 3: 1553, 4: 3547}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181866016_1181866022 -10 Left 1181866016 22:25855982-25856004 CCCTCCTCCCACTCTTTACCCTC 0: 6
1: 46
2: 436
3: 1553
4: 3547
Right 1181866022 22:25855995-25856017 CTTTACCCTCCAGTAGGCCCTGG 0: 1
1: 5
2: 55
3: 245
4: 595
1181866016_1181866029 16 Left 1181866016 22:25855982-25856004 CCCTCCTCCCACTCTTTACCCTC 0: 6
1: 46
2: 436
3: 1553
4: 3547
Right 1181866029 22:25856021-25856043 GACCCTGCTTTCAGTTTTTTGGG 0: 4
1: 59
2: 272
3: 816
4: 1533
1181866016_1181866028 15 Left 1181866016 22:25855982-25856004 CCCTCCTCCCACTCTTTACCCTC 0: 6
1: 46
2: 436
3: 1553
4: 3547
Right 1181866028 22:25856020-25856042 AGACCCTGCTTTCAGTTTTTTGG 0: 3
1: 15
2: 86
3: 220
4: 596
1181866016_1181866030 17 Left 1181866016 22:25855982-25856004 CCCTCCTCCCACTCTTTACCCTC 0: 6
1: 46
2: 436
3: 1553
4: 3547
Right 1181866030 22:25856022-25856044 ACCCTGCTTTCAGTTTTTTGGGG 0: 1
1: 9
2: 82
3: 347
4: 1266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181866016 Original CRISPR GAGGGTAAAGAGTGGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr