ID: 1181866570

View in Genome Browser
Species Human (GRCh38)
Location 22:25861929-25861951
Sequence CCACAGATACATATGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 156}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181866570_1181866578 23 Left 1181866570 22:25861929-25861951 CCACCCTCCATATGTATCTGTGG 0: 1
1: 0
2: 2
3: 10
4: 156
Right 1181866578 22:25861975-25861997 AACAACTGACTGAAAATATTTGG 0: 1
1: 1
2: 8
3: 96
4: 702

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181866570 Original CRISPR CCACAGATACATATGGAGGG TGG (reversed) Intronic
908912762 1:69091606-69091628 ACACAGAGACAGAGGGAGGGAGG - Intergenic
911000414 1:93159242-93159264 CCAGGGATACACATGCAGGGTGG - Intronic
912209423 1:107542452-107542474 CCAAAGATAAATAGGGAGAGAGG - Intergenic
912413582 1:109493889-109493911 ACACAGATACAAATGAAGGTGGG + Intergenic
912744285 1:112232249-112232271 CCACAGCTGCAAATGGAGAGTGG + Intergenic
912786395 1:112607919-112607941 CCACAGACATATATGCTGGGGGG - Intronic
913377177 1:118165391-118165413 ACACAGACACACATGGAGTGAGG - Intronic
918203779 1:182291296-182291318 CAGGAAATACATATGGAGGGGGG + Intergenic
920363821 1:205437585-205437607 CAACAGACATATCTGGAGGGTGG - Intronic
922637164 1:227185644-227185666 CTACAGAGACAGAGGGAGGGGGG - Intronic
1064321494 10:14309674-14309696 CCACTGTTAGATATGGAGGCAGG - Intronic
1067190515 10:44064139-44064161 CCACAGAGGCACATGGAGAGGGG - Intergenic
1072010551 10:91299368-91299390 CCACAGATCCATGGGGTGGGGGG - Intergenic
1073922391 10:108473919-108473941 CCCCAAATACATATGTATGGCGG - Intergenic
1078584459 11:12570073-12570095 ACACAGATATATATGTATGGTGG + Intergenic
1079611781 11:22441725-22441747 CCACTGAAACAAAAGGAGGGAGG + Intergenic
1080922876 11:36726367-36726389 GCACAGAGACAGAGGGAGGGAGG + Intergenic
1083581007 11:63825382-63825404 CCACAGACACAGAGGGAGTGAGG - Intronic
1085528948 11:77180360-77180382 CCACAGATACTGAGGGAAGGGGG - Exonic
1089807724 11:121106439-121106461 CTACAGACCCATATTGAGGGTGG - Intronic
1090659213 11:128870082-128870104 CCACAGAGAGTTATGGAGGCTGG - Intergenic
1091350872 11:134892975-134892997 TCACAGTTCCATATGGCGGGGGG - Intergenic
1091770658 12:3149042-3149064 CCAGAGAGACAAATGGCGGGGGG - Intronic
1092490416 12:8939920-8939942 CCACAGCTACACTGGGAGGGGGG - Exonic
1094200996 12:27794357-27794379 CCACAGATACATACAGAGGCAGG - Intronic
1100523760 12:95400949-95400971 ACACAGATACATAGGTAGGTAGG - Intergenic
1100748575 12:97672417-97672439 CCACAGATACTTCTGGAGAAAGG + Intergenic
1101842620 12:108339332-108339354 CCAGAGAAACAGCTGGAGGGAGG + Intronic
1101855916 12:108442673-108442695 GCACAAATACATATGGAGAAGGG + Intergenic
1107215392 13:37911831-37911853 CCACAGCCAAATATGGAGGGTGG - Intergenic
1108924838 13:55728990-55729012 CGACAGAGAAATATTGAGGGTGG + Intergenic
1113705602 13:112430751-112430773 CCACACATACATAGGGAACGGGG + Intronic
1114820016 14:26007321-26007343 CAAAAGATACATATTGAAGGTGG - Intergenic
1114995651 14:28348840-28348862 CCACATATATATATGGTGGGTGG + Intergenic
1202869295 14_GL000225v1_random:145365-145387 CCAGAGGTACATAGAGAGGGTGG + Intergenic
1124044225 15:26133532-26133554 CCAAAGAAAAATAGGGAGGGAGG + Intergenic
1127100835 15:55563293-55563315 TAAAAGATACATTTGGAGGGGGG - Intronic
1127633438 15:60847578-60847600 CGACAGCTACATATGGTTGGTGG - Intronic
1129117610 15:73373907-73373929 GCACAGCTACACATGGATGGAGG + Intergenic
1130609137 15:85344731-85344753 CCACAGTAACATGTGGAGAGAGG + Intergenic
1131979024 15:97977834-97977856 ACACAGATACACAAGGAGTGAGG + Intergenic
1132173793 15:99691188-99691210 CAACAGAGACAGAGGGAGGGGGG + Intronic
1132614294 16:832576-832598 CCACAGCTAAACCTGGAGGGGGG - Intergenic
1132933393 16:2469761-2469783 CCACAGATGCACAGGGATGGGGG - Intergenic
1134236584 16:12471027-12471049 GCACAGCTACATAGGGAGGGAGG - Intronic
1138701037 16:58863901-58863923 CCAAAGATTCATAAGGAGGTAGG - Intergenic
1139572602 16:67822539-67822561 GCACAGATGCATAAGGAGGGAGG + Intronic
1143355811 17:6327638-6327660 CCACGGATACAGATGCAGAGTGG - Intergenic
1144439567 17:15269305-15269327 CCACAGATGCAAGTGGAGGGGGG + Intergenic
1150187072 17:63194013-63194035 CCTCATCTACAGATGGAGGGGGG - Exonic
1150827926 17:68493083-68493105 CCACATAGACATGTGGTGGGGGG + Intergenic
1152695802 17:81794318-81794340 ACACAGATACATATAGAGACAGG + Intergenic
1153034436 18:746887-746909 ACACACATACATATGTAGAGAGG - Intronic
1153774603 18:8441565-8441587 CCCCAGATACAGATACAGGGAGG + Intergenic
1157440508 18:47708030-47708052 ATATAGATACATATGTAGGGAGG - Intergenic
1162642455 19:12022428-12022450 ACACAGAGAAATATGGAGTGTGG - Intronic
1163347399 19:16752265-16752287 CCACAAATTCATCTAGAGGGTGG + Intronic
1164872431 19:31657056-31657078 CCACAGTTCCACAGGGAGGGAGG + Intergenic
1165779724 19:38425530-38425552 CCACAGAGGCAGATGGTGGGTGG - Intronic
925616505 2:5748870-5748892 CCACAGCTTCATAGGGTGGGTGG - Intergenic
926940600 2:18132203-18132225 ACGCAGATACATATGGGAGGTGG + Intronic
928716369 2:34065493-34065515 CCACAGATACGTTTTGGGGGTGG - Intergenic
928755277 2:34517081-34517103 ACATACATACATATGGAGAGGGG + Intergenic
935245990 2:101219256-101219278 CCAGAGAAACAAAGGGAGGGAGG - Intronic
935795073 2:106633071-106633093 CCATAGATACATAGGTAGGTAGG - Intergenic
937554331 2:123134316-123134338 CAACATATACATTTGGCGGGAGG + Intergenic
937577082 2:123436849-123436871 CCACAGATAAATAAGGAAGATGG - Intergenic
938566669 2:132525000-132525022 CCACACAGACAAATGTAGGGAGG - Intronic
939364057 2:141209808-141209830 ACACAGACACGGATGGAGGGAGG + Intronic
939885284 2:147674789-147674811 ACACATATACATATGGTGGCTGG + Intergenic
940610213 2:155980490-155980512 CCCCAGATCCATATGGACAGAGG + Intergenic
940994076 2:160128364-160128386 CCAAAGTTGCATATGGAGTGTGG + Intronic
942241656 2:173967798-173967820 TAAGAGATACATATGGAGGTAGG + Intergenic
942546557 2:177070678-177070700 CCACAGACACAAGAGGAGGGTGG - Intergenic
945174952 2:207034423-207034445 CCAAATAAACATATGGAAGGTGG + Intergenic
948054308 2:235000050-235000072 CCACTGATCCATCTGGAGAGGGG + Intronic
1170491856 20:16885666-16885688 CCACAGATACATTTTCAGGAAGG - Intergenic
1172166646 20:32903610-32903632 GCACATATACGTGTGGAGGGAGG + Intronic
1172699401 20:36843637-36843659 ACACAGATCCATCTGGAGGCTGG - Intronic
1173508744 20:43609312-43609334 CCAAAAACATATATGGAGGGTGG + Intronic
1179107305 21:38413893-38413915 CCAAAGATACATATGGAGAGAGG - Intronic
1179773902 21:43646972-43646994 CCATATAGACATTTGGAGGGTGG - Intronic
1181523168 22:23460791-23460813 CCACAGATACACAGGGCGAGTGG - Intergenic
1181866570 22:25861929-25861951 CCACAGATACATATGGAGGGTGG - Intronic
1183192367 22:36329827-36329849 ACACAGTCACATATGGAGGTAGG + Intronic
1184597064 22:45520415-45520437 ACACAGACACATACAGAGGGAGG - Intronic
950663424 3:14480982-14481004 TCAGAGATAGACATGGAGGGTGG + Intronic
951016090 3:17734255-17734277 CTACATATATATGTGGAGGGCGG + Intronic
952197923 3:31095517-31095539 ACACAGAAACATATGATGGGTGG + Intergenic
952528659 3:34240825-34240847 GCACACATACACATGCAGGGAGG + Intergenic
955066522 3:55537952-55537974 CCAGAGAGACAATTGGAGGGTGG - Intronic
956568511 3:70667087-70667109 ACACAGACACATACAGAGGGAGG + Intergenic
957717038 3:83941890-83941912 CAACATATGCATTTGGAGGGAGG + Intergenic
958574244 3:95927060-95927082 CTACAGAAACAGAGGGAGGGGGG + Intergenic
960019803 3:112935986-112936008 ACACATGGACATATGGAGGGTGG - Intronic
962327527 3:134448031-134448053 CCCCAGAAACATCTGGAGAGCGG + Intergenic
962458906 3:135591058-135591080 CTACAGAGACAGAGGGAGGGTGG - Intergenic
963004619 3:140714814-140714836 CTACCGATTCATATGAAGGGGGG + Intergenic
965909764 3:173758688-173758710 CTACAAATATACATGGAGGGGGG - Intronic
967116300 3:186342342-186342364 CCACAGGAAGAAATGGAGGGTGG + Intronic
970716397 4:18930639-18930661 CCATAGTTACCTAAGGAGGGGGG + Intergenic
974155755 4:58070043-58070065 CCACAGAGACAGAAGGAGGGAGG + Intergenic
975477764 4:74843064-74843086 CCACTGAGGCATATGGAGCGAGG + Intergenic
976316522 4:83664494-83664516 ACACAGACACATGTGGAGTGAGG - Intergenic
977331329 4:95641123-95641145 CCATAGATACATAAAGAGGCAGG + Intergenic
977409265 4:96640521-96640543 CCACATATAAATTTGCAGGGCGG + Intergenic
984293666 4:177827190-177827212 CCACAGATACTTGGAGAGGGGGG - Intronic
986556630 5:9016449-9016471 TCACATATATATGTGGAGGGTGG + Intergenic
987418559 5:17691397-17691419 CCACAGAGAAAGATGGAGGCAGG + Intergenic
987574000 5:19703106-19703128 ACACAGAGAAATATGGAGTGCGG - Intronic
988099391 5:26658091-26658113 CCCCAGATACATAGGGATTGTGG + Intergenic
991098169 5:62761760-62761782 CCATAGATACATGTGGCTGGTGG + Intergenic
994040300 5:95251539-95251561 CCATAAATACATGTGGATGGTGG + Intronic
995837065 5:116409597-116409619 ACACAGATACACATGGGGGAAGG + Intronic
997302585 5:132816688-132816710 TCACTGATACATATGGGGGTGGG - Exonic
998100020 5:139424988-139425010 CCTCAGGTACCTAGGGAGGGAGG - Exonic
1000715431 5:164637876-164637898 CCACAGGTACCTAGGGAAGGAGG + Intergenic
1002764306 6:226202-226224 CCACAGAGACACAGGGTGGGTGG - Intergenic
1003382490 6:5637803-5637825 ACACAGACACATACGGAGCGGGG - Intronic
1004081786 6:12402078-12402100 CCCCAGAGGCATATTGAGGGAGG - Intergenic
1004652998 6:17630183-17630205 CCACAGTTACATTTGGAAGTGGG + Intronic
1005062000 6:21785346-21785368 CCACAGCTAGAAATGGAAGGTGG - Intergenic
1006577662 6:35057989-35058011 GCACAAATGCATATGAAGGGCGG - Intronic
1007421329 6:41721567-41721589 GCACAGATACTTTTGGAGGGAGG - Intronic
1009830838 6:68931302-68931324 TTACAGATATATTTGGAGGGAGG - Intronic
1013046577 6:106491647-106491669 CCACATATGGAAATGGAGGGAGG - Intergenic
1013253340 6:108357651-108357673 TCACAGATACATATGTTGTGAGG - Intronic
1013400807 6:109794534-109794556 CCACAGATACTGATGGAGGGAGG - Intronic
1014540016 6:122663910-122663932 CCTCAGAGAAATATGGAGGTGGG + Intronic
1017305917 6:152918205-152918227 ACACAGATACACACAGAGGGAGG + Intergenic
1017333780 6:153230485-153230507 CCAAAGATACATGAGAAGGGTGG + Intergenic
1019588163 7:1815767-1815789 CCACAGATACACAGGGCGAGTGG + Intergenic
1021423429 7:20471495-20471517 CCTTAGATGTATATGGAGGGTGG - Intergenic
1021921333 7:25488445-25488467 AGACAGATAGAGATGGAGGGAGG - Intergenic
1022535848 7:31097801-31097823 CAACAGATACAGTTGGGGGGGGG + Intronic
1023134658 7:37039002-37039024 CAAAATATACATTTGGAGGGAGG + Intronic
1024530324 7:50386401-50386423 CAACAGCTACATATGGCTGGTGG + Intronic
1026177786 7:68013107-68013129 CCACATATTCATATGCAGAGAGG + Intergenic
1027173260 7:75887805-75887827 CCACAGATGCCCAGGGAGGGTGG - Intronic
1028586289 7:92455087-92455109 CAACATATAAATTTGGAGGGTGG + Intronic
1028631522 7:92939838-92939860 CCAGAGACACATATGGAGAAAGG - Intergenic
1034829893 7:154299954-154299976 ACTCAGACACATCTGGAGGGGGG + Intronic
1035823254 8:2617411-2617433 CCACAGAGAAATACGGAGAGGGG - Intergenic
1036574570 8:10014794-10014816 TCACAGATACACACAGAGGGAGG - Intergenic
1038795589 8:30706567-30706589 CCACAAAGACAAATGAAGGGTGG + Intronic
1039000519 8:32974543-32974565 CCACAGATCTATTTGGTGGGGGG + Intergenic
1039842189 8:41302088-41302110 CTATAGATACAGATTGAGGGTGG - Intronic
1041333147 8:56750401-56750423 ACACAGATAAGTACGGAGGGAGG - Intergenic
1041608946 8:59820960-59820982 TCACAGAGACATACTGAGGGAGG + Intergenic
1041893854 8:62901744-62901766 CCACAGACACATATGGATAGAGG + Intronic
1042736565 8:71996025-71996047 ACACACATACATATAGAGGAGGG - Intronic
1045057933 8:98385211-98385233 CCCTAGATAGATTTGGAGGGTGG + Intergenic
1054804358 9:69383714-69383736 CCACAGCTTCATATGGCGGCGGG - Exonic
1055717932 9:79138917-79138939 CCACAGTTACATGTGAATGGTGG + Intergenic
1058175320 9:101729200-101729222 CCACACAGACTTATGCAGGGAGG - Intronic
1059518626 9:114918933-114918955 ACACCCAAACATATGGAGGGGGG - Intronic
1059634176 9:116155422-116155444 CCACAGATTCATTTAGAGGGGGG - Intronic
1060927382 9:127464442-127464464 CCATAGATACATATGGCCAGCGG - Intronic
1203735577 Un_GL000216v2:135777-135799 CCAGAGGTACATAGAGAGGGTGG - Intergenic
1194011502 X:88567869-88567891 TCACAGATATATCTGGGGGGAGG - Intergenic
1195702858 X:107717704-107717726 CTACAGATGCATATGTATGGAGG + Intronic
1198383311 X:136104547-136104569 ACACAGATACATATGTCAGGTGG - Intergenic
1198861736 X:141078202-141078224 GTACACATAGATATGGAGGGTGG + Intergenic
1198900955 X:141509174-141509196 GTACACATAGATATGGAGGGTGG - Intergenic
1199066158 X:143421222-143421244 CCACAGAGAGAAATAGAGGGAGG - Intergenic
1199440597 X:147863760-147863782 ACACAGACACATACAGAGGGAGG + Intergenic
1199467395 X:148154417-148154439 CCAGAGAAACGTATGGAGGCAGG - Intergenic
1202380276 Y:24270888-24270910 CCACAGTAACATGTGGAGAGAGG + Intergenic
1202490507 Y:25399237-25399259 CCACAGTAACATGTGGAGAGAGG - Intergenic