ID: 1181869448

View in Genome Browser
Species Human (GRCh38)
Location 22:25886356-25886378
Sequence CAGAGCTGCCTCAGTCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 274}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181869448_1181869454 6 Left 1181869448 22:25886356-25886378 CCCTGCTGACTGAGGCAGCTCTG 0: 1
1: 0
2: 1
3: 19
4: 274
Right 1181869454 22:25886385-25886407 GTACCATGAGACTGAAGCCATGG 0: 1
1: 0
2: 1
3: 15
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181869448 Original CRISPR CAGAGCTGCCTCAGTCAGCA GGG (reversed) Intronic
901176172 1:7301112-7301134 CAGAGGAGCCACAGCCAGCAGGG + Intronic
901456509 1:9366164-9366186 CAGAGCTGCCTCAGGCCCCAGGG - Intronic
901529996 1:9846787-9846809 CAGAGCTGCCGGAGACAGCAGGG - Intergenic
902129050 1:14242751-14242773 CAGAGCTTTCTGAGACAGCAGGG - Intergenic
902286786 1:15412286-15412308 CAGAGCTGATTCAGACACCACGG + Intronic
902301391 1:15505135-15505157 TTGAGCTGCCTCAGTCAGAGGGG - Intronic
902624316 1:17667753-17667775 CAGAGCTGCCCCTGTGAGCTGGG + Intronic
902711360 1:18242162-18242184 CAGAGATGACACAGGCAGCACGG + Intronic
903967653 1:27100359-27100381 CAGCGCTGCCTCAGTGACCCAGG - Exonic
904113359 1:28143854-28143876 CAGATCTGCCTTAGTAAGCATGG - Intergenic
904769379 1:32872333-32872355 CAGACCTGCCCCACTCGGCAGGG + Intronic
904918604 1:33988218-33988240 CAAAGCTGCATCTGACAGCAGGG - Intronic
905038978 1:34937600-34937622 TTGAGCTACCTCAGACAGCAAGG - Intergenic
905872153 1:41411033-41411055 CAGTGCAGCCTCAGTCTCCAGGG + Intergenic
907677079 1:56528022-56528044 CATTTCTGCCTCAGTCAGCAAGG + Intronic
908466618 1:64402449-64402471 CACAGCACCTTCAGTCAGCATGG + Intergenic
909039278 1:70630194-70630216 TAGAGGTGCCTCAGGCACCATGG - Intergenic
911061270 1:93750212-93750234 CAGGACTGCCTCCTTCAGCAAGG + Intronic
912375430 1:109205785-109205807 CAGACCTGCAGAAGTCAGCACGG - Intronic
913108047 1:115632960-115632982 CAGAGCTGCTTCAGGAATCAAGG + Intergenic
913112015 1:115665427-115665449 CAGAGCAGCCAGAATCAGCAAGG + Intronic
913498286 1:119448129-119448151 CATATCTCCATCAGTCAGCAAGG + Intergenic
913616483 1:120565074-120565096 CACCCCTGCCTCAGTAAGCATGG - Intergenic
914573794 1:148945837-148945859 CACCCCTGCCTCAGTAAGCATGG + Intronic
915201884 1:154236179-154236201 CAGAGCTGCCTCAGCTGGCAGGG + Intronic
915510773 1:156385874-156385896 CAGAGCTGACGCAGACAGGAAGG - Intergenic
915947219 1:160162380-160162402 CAGCACTGCCCCAGTCAGAAGGG - Intronic
916418971 1:164618613-164618635 CAGAGCTGCCAAAATCAGTAGGG + Intronic
916630398 1:166606376-166606398 CAGAACTGCCATAGTCATCATGG + Intergenic
921431683 1:215073200-215073222 TAGAGCTGCCACAGAGAGCAAGG + Intronic
922464426 1:225837287-225837309 CAGGGCTGGTGCAGTCAGCATGG - Intronic
922668226 1:227490633-227490655 AAGAGCAGCCTCAGGCAGCCAGG - Intergenic
922671089 1:227509194-227509216 CTGACCTGCCTCAGTCTGGAGGG + Intergenic
1067067692 10:43112951-43112973 CAGGACTGCCTCCGTAAGCAGGG + Exonic
1067200107 10:44161395-44161417 CAAAGCTGCTTCAGTAAACAAGG + Intergenic
1067935210 10:50605328-50605350 CAGAGCTGCCACAGTGAGACAGG + Intronic
1068241045 10:54300913-54300935 CAGAGCTTCCACAGTGTGCAAGG - Intronic
1070552131 10:77498213-77498235 CAGAGCTGCCTACATCAGTAGGG + Intronic
1071790050 10:88943830-88943852 CAGGGGTGCCTCCGTGAGCAGGG + Exonic
1072234946 10:93445706-93445728 CCCAGCTGCCTCGGTCAGCTGGG - Intronic
1072304913 10:94097813-94097835 CAGAGCTGGGGCAGTCAGAATGG + Intronic
1072433296 10:95392801-95392823 CACAGCTTCCACAGTCAGCTTGG - Intronic
1073218178 10:101848335-101848357 CAGTGTTGCCTGGGTCAGCAGGG + Intronic
1073278165 10:102330989-102331011 CAGGGCAGCCTCACTCAGCAAGG + Intronic
1076045662 10:127292329-127292351 CAGGGCTGCCTGAGTCACTAAGG - Intronic
1076303891 10:129449715-129449737 CAGAGCTGCTCCAGTGAGCACGG - Intergenic
1076438890 10:130465741-130465763 CAGAGATGCCTCCGTGGGCAAGG - Intergenic
1076533747 10:131162403-131162425 CACAGCAGGCCCAGTCAGCAGGG + Intronic
1077276296 11:1711375-1711397 TATGGCTGCCTCAGTCAACAAGG - Intergenic
1077516016 11:3002630-3002652 CAGGGCTGCCTCAGGCTGCTGGG + Intronic
1077887419 11:6395948-6395970 CAGCACTGCCTCTGTCTGCATGG + Exonic
1082922387 11:58509618-58509640 AAGAACTGGCTCAGTCAGCTTGG + Intergenic
1083300014 11:61735335-61735357 CAGGGCTGCCAGAGCCAGCAAGG + Intronic
1084486594 11:69451837-69451859 CTGAGCTGCCACAGTCAAGAAGG - Intergenic
1084581234 11:70024716-70024738 CAGAGCTGCCTCTGTCTGGATGG + Intergenic
1085242837 11:75072874-75072896 CTGAGCTGCAGCAGCCAGCAGGG - Intergenic
1086249260 11:84794796-84794818 CAGAGGGGGCTGAGTCAGCAGGG - Intronic
1089490018 11:118877038-118877060 CACAGCTCACTCAGACAGCAGGG - Intergenic
1089561002 11:119343038-119343060 CAGTGCCCCCTCAGTCAGCCAGG - Intronic
1089887175 11:121838717-121838739 CAAAGCTGCCTCTGCAAGCATGG + Intergenic
1090901244 11:131033556-131033578 CAGGGCAGGCTGAGTCAGCAGGG + Intergenic
1091552535 12:1547452-1547474 CAGAGCTGGCTGAGGCACCACGG + Intronic
1093228688 12:16516125-16516147 CAGAACTGATTGAGTCAGCATGG - Intronic
1095103351 12:38204653-38204675 CTGACCTGCCTCAGTCTGGAGGG + Intergenic
1096573573 12:52539075-52539097 CAAACCTGCCTCAGCCTGCATGG + Intergenic
1097165800 12:57086110-57086132 CAGATCCGACTCACTCAGCAAGG - Intronic
1097924163 12:65109393-65109415 CAGAGCTGCCTCTGTCCAGAGGG - Intronic
1099299943 12:80879958-80879980 CAATGCAGCCTTAGTCAGCAAGG + Intronic
1102195080 12:111019549-111019571 CAGAGCTACATAAGTCAACATGG - Intergenic
1103150882 12:118637573-118637595 AAGAGCTTCCTCTGGCAGCAGGG + Intergenic
1104137506 12:125954411-125954433 CAGAGCTGCCTGAGACAGTGAGG + Intergenic
1104974978 12:132548280-132548302 CAGTGCTGCCCCAGCCAGGAGGG + Intronic
1105696845 13:22897642-22897664 CAAAGCTGCCGAAGTCACCACGG - Intergenic
1105775383 13:23654525-23654547 CAGAGCTGCCCCAGTGTGCATGG - Intronic
1106705352 13:32273699-32273721 CAGAGCTCCTTGAGACAGCACGG - Intronic
1108590348 13:51907306-51907328 CAGACCTGCCAAGGTCAGCAAGG - Intergenic
1111971119 13:94917916-94917938 CAGAGCTACCTCATGCAGGATGG + Intergenic
1113485709 13:110650911-110650933 CACAGCAGCCTCACTCAACAAGG + Intronic
1113750364 13:112772795-112772817 CAGAGCACCCTTAGTCACCAGGG - Intronic
1114536663 14:23427246-23427268 CAGAGCTGACACAGTCTGAAAGG + Exonic
1119266227 14:73264600-73264622 CAGCTCAGCCTCAGACAGCACGG - Exonic
1119774199 14:77238465-77238487 CAGAGCTGCCTGGCTCAGCTGGG + Intronic
1119862168 14:77944081-77944103 CAGAGCTCACCCAGCCAGCAGGG + Intergenic
1121392642 14:93589407-93589429 CAGAGGAGTCTCAGTCAGTATGG + Intronic
1121456059 14:94039527-94039549 CAGAGCTGCCCCTGTCATCTCGG + Intronic
1121856640 14:97276376-97276398 CACCTCTGCTTCAGTCAGCAGGG - Intergenic
1122193568 14:100067745-100067767 TAGAGCTGCCTCTGTCCTCAGGG + Intronic
1123028370 14:105439192-105439214 CAGGGCTGCCTGAGTGACCAGGG - Intronic
1123160799 14:106276486-106276508 CACAGCTGCCTCATTCCTCAGGG + Intergenic
1202833078 14_GL000009v2_random:57757-57779 CAGAGGGGGCTCAGTCAGCTGGG + Intergenic
1202889406 14_KI270722v1_random:141614-141636 CAGAGCTCACTCAGTCATCCAGG + Intergenic
1124341228 15:28890345-28890367 CAGAGCTGACTTTGGCAGCAGGG - Intronic
1125156306 15:36590509-36590531 CAGAATTGCCTCAATTAGCAGGG - Intronic
1125401826 15:39312289-39312311 CAGGGCTGCTTCAGTGGGCAGGG - Intergenic
1126210409 15:46094914-46094936 CAGAGTTGCATAAGTCAGGAAGG + Intergenic
1129013721 15:72446757-72446779 CAGAGCTGCAACAGTCATCTTGG + Intergenic
1130437825 15:83919653-83919675 CAGATCTGCCTCAACCCGCAAGG - Intronic
1132727915 16:1346720-1346742 CAGGGCGGCCTCAGTGACCACGG - Intronic
1133750176 16:8719145-8719167 CAGAGATTCCTCAGTAAACAAGG - Intronic
1137710173 16:50561224-50561246 CAGACATGGCTCAGTCATCAGGG + Intronic
1138643883 16:58408479-58408501 CAGAGCTTGCTCTGTCACCAAGG + Intergenic
1139653023 16:68372006-68372028 CAGAGCAGCTGCAGGCAGCACGG + Exonic
1139667494 16:68467907-68467929 CAGAGCTCCATGTGTCAGCACGG - Intergenic
1139894348 16:70276187-70276209 CAGAGCTTGCTCTGTCAGCTAGG - Intronic
1139968443 16:70758623-70758645 CAGAACTCACTCAGGCAGCATGG + Intronic
1140094000 16:71859897-71859919 CAGGCCTGCCTCTGGCAGCAAGG + Exonic
1141758870 16:86013606-86013628 CATAGCTGCCTCCGTGAGCTGGG - Intergenic
1142270698 16:89088029-89088051 CAGGGCAGCCTCATTCAGTACGG + Intergenic
1142885895 17:2911918-2911940 CTGAGCTGGCTCGGTCAGCTGGG + Intronic
1143220233 17:5255450-5255472 GAGGGCTGTCTCAGGCAGCAAGG - Intergenic
1144855466 17:18264975-18264997 CTGGGCTGCCTCAGGCAGCTTGG + Exonic
1144956824 17:19022917-19022939 CAGAGCTGCCTCAGTCCCCTGGG - Intronic
1145237833 17:21221526-21221548 TATAACTGCTTCAGTCAGCAGGG + Intergenic
1146567495 17:33925648-33925670 CAGAGCTGCCCCAGCCATGAGGG - Intronic
1146660719 17:34663541-34663563 CTGAGCTGCAGCAGCCAGCAGGG + Intergenic
1147180342 17:38680725-38680747 CAGAATTCCCTAAGTCAGCAGGG + Intergenic
1147723051 17:42550401-42550423 CAGATCTGTCTGGGTCAGCAGGG - Exonic
1147934113 17:44001714-44001736 TGGAGCTGATTCAGTCAGCAGGG + Intronic
1149642494 17:58212846-58212868 CAATGCTGCCTAAGTCAGAAGGG + Intronic
1150529085 17:65958586-65958608 CAGAGGTGGCTGAGGCAGCAGGG - Intronic
1151290045 17:73143188-73143210 CTGAGCTGACTCAGACAGGAAGG + Intergenic
1151427695 17:74041710-74041732 CAGAGCCGGCTCATTCAGAATGG + Intergenic
1151472120 17:74325192-74325214 CAGGGCTGCCTCAGACTGCCTGG - Intergenic
1152718895 17:81912918-81912940 CAGGGCTGCCTCCGTCTCCAGGG + Intronic
1152873123 17:82769472-82769494 CAGGGCTGTCGCAGTCAGCGTGG - Intronic
1153931349 18:9882432-9882454 CAGCTCTGCCTCAGTCTGCGGGG + Intergenic
1155175724 18:23299550-23299572 AAGAGCTGCCTGGGTCAGCGTGG - Intronic
1156478566 18:37421836-37421858 CAAGCCTTCCTCAGTCAGCATGG + Intronic
1157162561 18:45327387-45327409 CTGAGCTGTCTCATTTAGCATGG - Intronic
1157434176 18:47654562-47654584 CAGAGCTGCCTCTGTTAGTAAGG + Intergenic
1157869241 18:51214718-51214740 CACAGCTGTCTCAGGCACCAGGG - Intronic
1159963137 18:74571349-74571371 CAGAGCTGGTTCAGAAAGCAAGG - Intronic
1160468863 18:79108156-79108178 CAGAGCAGTCGCAGTCTGCATGG + Intronic
1160535756 18:79590465-79590487 CAGAGATGCCTCTGCCACCACGG + Intergenic
1161071929 19:2266756-2266778 GAGAGCTGCTGCAGTCAGGATGG + Intronic
1162084380 19:8239622-8239644 CACAGGTCACTCAGTCAGCAAGG - Intronic
1162395922 19:10418063-10418085 TCCAGCTGCCTGAGTCAGCAAGG + Intronic
1163557067 19:17998920-17998942 CTGAGATCCCTCAGACAGCATGG + Exonic
1163928752 19:20368854-20368876 CATAGCTCAGTCAGTCAGCAAGG + Intergenic
1166130008 19:40740436-40740458 CAGAGCTGCTGCACTCAGGAGGG + Exonic
1166834038 19:45656176-45656198 AAGAGCTGTCCCAGTCACCAGGG + Intergenic
925229691 2:2221989-2222011 CACACCTGCCTCTGTCAGCTAGG + Intronic
925316735 2:2932392-2932414 CAGAGCTGCTTCGCACAGCAAGG + Intergenic
928169711 2:28995395-28995417 CAGAGCTGCTTCATCCTGCATGG + Intronic
928949336 2:36800476-36800498 CAGAAGAGCCTCAGTCAGAAAGG - Intronic
929983680 2:46704715-46704737 CAGAGCTGCTTCAGGAACCAAGG - Intronic
932303579 2:70685909-70685931 GGGAGCTGCCTCTCTCAGCAGGG + Intronic
932417197 2:71580531-71580553 CAGAGCTGGCACTGTGAGCAAGG + Intronic
932476036 2:72006510-72006532 CAGAGCAGCCTCTGACTGCAGGG - Intergenic
933773022 2:85755570-85755592 CAGAGCTGCCTGCTTCACCACGG - Intronic
933835498 2:86242231-86242253 CAGAGGTGCAGCAGTAAGCAGGG + Intronic
937477657 2:122229526-122229548 AAAAGCTGCCACATTCAGCATGG - Intergenic
937969854 2:127541169-127541191 CAGAGATGCCTCCTTCACCATGG - Intronic
940240127 2:151553666-151553688 CAGAGCTGTCTCTGGAAGCAGGG - Intronic
941600323 2:167535523-167535545 CTGAGCTGCCTCTTTCTGCAAGG - Intergenic
941855700 2:170228206-170228228 AAGAGATGCCTCACTCAGGAAGG + Intronic
942123551 2:172801839-172801861 CAGAGCTGCATCAGACACCCAGG - Intronic
942132470 2:172893814-172893836 CAGAGATGCCTGAGGCAGGATGG - Intronic
943014547 2:182495177-182495199 TGGAGCTGCCTTTGTCAGCAAGG - Intronic
943274718 2:185852115-185852137 CACAGATGCTTCAGTCAGAATGG + Intergenic
944304730 2:198166130-198166152 CAGAGCTGCCTTGGTCTGCTTGG - Intronic
945005410 2:205399854-205399876 CAGAGCTGACTCAGGAAGCTGGG + Intronic
946195239 2:218028797-218028819 CAGAGCTGGGACAGTCAGCAAGG + Intergenic
946364856 2:219242825-219242847 TAGAGCTGCCTCATTCAGAAAGG + Exonic
946437456 2:219667021-219667043 AAGAGCAGCCTCAGTCAGAAGGG - Intergenic
947607065 2:231493266-231493288 CAGACCTGCCACAGTCATCTTGG - Intergenic
947712918 2:232326096-232326118 CAGAGATGACCCGGTCAGCAGGG - Intronic
947841564 2:233211087-233211109 CAGTCCTGCCTCATTCTGCAGGG + Intronic
948279055 2:236732409-236732431 CAGAGCTGCCTTTCACAGCATGG + Intergenic
948431748 2:237923222-237923244 CAGAGATTCCTCACTCAGCTGGG - Intergenic
1169881860 20:10355390-10355412 CAGGGCTGCCTCCGTTAGAATGG - Intergenic
1170713481 20:18812431-18812453 AAGAGCTGCCCCAGACTGCAAGG + Intronic
1170865294 20:20150118-20150140 CATGGCTGCCTCTGTCACCAGGG - Intronic
1171886263 20:30654308-30654330 CAGAGGGGGCTCAGTCAGCTGGG - Intergenic
1172213658 20:33218425-33218447 CTGAGCTGTATCAGTCAGCTAGG + Intronic
1173664218 20:44753577-44753599 CAGTGCAGCCTGAGTCAGCAAGG + Intronic
1174276858 20:49410164-49410186 CAGAGCTACTTCAGGCAACAGGG + Intronic
1176204963 20:63883314-63883336 CAGAGGTCCCTCAGCAAGCAGGG + Intronic
1176647925 21:9367552-9367574 CAGAGGGGGCTCAGTCAGCTGGG - Intergenic
1177484472 21:21739152-21739174 CAGAGCTGCATCACTGATCATGG + Intergenic
1178585408 21:33867013-33867035 CAGATGTGACTCAGCCAGCAGGG - Intronic
1179876061 21:44268122-44268144 CAGAGCTGCCACGGTGAACACGG + Intergenic
1181050942 22:20237943-20237965 CAGAGCTGCCTCAGTCACAGAGG + Intergenic
1181869448 22:25886356-25886378 CAGAGCTGCCTCAGTCAGCAGGG - Intronic
1183831674 22:40421400-40421422 CCGAGCTCCATCAGTCAGCTGGG - Intronic
1184717170 22:46288816-46288838 CAGAGCTGCCTCCATCCCCAGGG + Intronic
1185336718 22:50274221-50274243 CAGAGCTGCCCCAGTCCAAAGGG + Intergenic
949887775 3:8710057-8710079 AAAAGCTGCCTCAGCCTGCAAGG + Intronic
950099369 3:10347664-10347686 CATAGTTCCCTCAGTCAGCCTGG + Intronic
950392832 3:12710170-12710192 CACTGCAGCCTCACTCAGCAGGG - Intergenic
952254652 3:31684741-31684763 CAGAGCTGCCGCAGACAAGAGGG + Intronic
953540414 3:43813073-43813095 CCCAGCTGCCTCAGTCAGGAAGG + Intergenic
954432845 3:50480511-50480533 CAGAGCTGCCTCAGCCTGCTAGG - Intronic
955894558 3:63685619-63685641 CAGAGCTGTCTGCCTCAGCAAGG - Intergenic
956443982 3:69307782-69307804 CAGAGGTCCCTCAGACTGCAAGG - Intronic
956729786 3:72186211-72186233 CAAAGCACCCTCAGTCCGCATGG + Intergenic
958790418 3:98645074-98645096 TATAGCTGCCTCTGTCACCAGGG + Intergenic
965074068 3:163953836-163953858 CAGAGATGCCTGGGTCTGCAGGG + Intergenic
966261353 3:177983107-177983129 CAGAGCTGTCTCAGAATGCAAGG + Intergenic
1202738960 3_GL000221v1_random:37435-37457 CAGAGGGGGCTCAGTCAGCTGGG + Intergenic
968648619 4:1751727-1751749 CAGAGCAGACCCAGACAGCAGGG + Intergenic
969056587 4:4406463-4406485 CAGGGCTGCCTCACTCAGGGTGG - Intronic
969308584 4:6339454-6339476 CAGAGAAGCCTCAGCCAGCCTGG + Intronic
969390914 4:6890814-6890836 CAGAGAGGCCTCCCTCAGCAAGG + Intergenic
969465077 4:7351556-7351578 AAAAGCTCACTCAGTCAGCAAGG - Intronic
970583982 4:17497479-17497501 CAGAGCCTCCTCCGGCAGCAAGG - Intronic
972420601 4:38882826-38882848 CACATTTGCCTCAGGCAGCAAGG + Intronic
973931909 4:55802015-55802037 CAGCTCTGCCCCAGTAAGCAGGG - Intergenic
974396419 4:61341799-61341821 CATAGCTGCAGCAGACAGCATGG + Intronic
978435370 4:108678280-108678302 AAGAGCTGACTAAGTCAACAAGG + Intergenic
980670129 4:135994486-135994508 CAGAGCTGCCCAAGGCAGCGGGG - Intergenic
981107228 4:140894921-140894943 CTGAGCTGCCTGAGTCTCCATGG + Intronic
982245203 4:153344455-153344477 CAGAGCTGCCTCCGTCTCCTCGG - Intergenic
983509177 4:168589097-168589119 CAGAGCTGGCTCCCTTAGCAGGG + Intronic
984090613 4:175369832-175369854 CAGAGCTTGCTCAGTGAGCCGGG - Intergenic
1202766955 4_GL000008v2_random:155808-155830 CAGAGGGGGCTCAGTCAGCTGGG - Intergenic
986071109 5:4284528-4284550 CAGAGCAGCCTCAGTCTCCTGGG + Intergenic
986210333 5:5665629-5665651 CAGGTCTGACTCAGACAGCAAGG + Intergenic
986257397 5:6111561-6111583 CAGAGCTGACTAAGACAGGAAGG - Intergenic
988114340 5:26865516-26865538 CTGAGCAGGCTCAGCCAGCAGGG - Intergenic
990285420 5:54296769-54296791 CAGGGCTGCCTCAGACAGTGAGG - Intronic
991209111 5:64084244-64084266 CACAGGTGCTTCAGTCAGCTTGG + Intergenic
992187866 5:74261162-74261184 CACAGCAGCCTCAGACAACATGG - Intergenic
993791458 5:92216394-92216416 CACTGTTGCCTCAGGCAGCAAGG - Intergenic
995828318 5:116326502-116326524 CAAAGCTGCCTTAGTCAGTTTGG + Intronic
996844509 5:127884520-127884542 CAGAGCTTCCACAGTCTACAAGG + Intergenic
996919239 5:128748198-128748220 CAGAGATGCCGCACACAGCAAGG - Intronic
997823175 5:137084146-137084168 CATAGCTTCCTGAGTCTGCATGG - Intronic
998376515 5:141694552-141694574 CAGAGCTGCCCAAGTCTGCTTGG + Intergenic
999378608 5:151104358-151104380 CAGAGCTGCCTCTGCCCCCAGGG + Intronic
999416052 5:151397044-151397066 CAGAGCAGCATCAGTCCACATGG + Intergenic
1001741292 5:174055089-174055111 CAGGGCTACCCCAGGCAGCAAGG + Intronic
1002465651 5:179407152-179407174 CAGTGCTGCTGCAGTCTGCACGG - Intergenic
1003097658 6:3155396-3155418 CAGAGCAGCCTCAGACTGGAAGG - Intronic
1003101342 6:3178703-3178725 CAGAGCAGCCTCAGACTGGAAGG - Intergenic
1003333123 6:5146114-5146136 CAGACCTGCCTGCCTCAGCACGG + Intronic
1004045238 6:12017498-12017520 CAAAGCTTCCACAGTCTGCAAGG + Intronic
1006576815 6:35052700-35052722 AAGTGCTGCCTCCTTCAGCAGGG - Intronic
1010041988 6:71395696-71395718 CACAGCTGCCCTCGTCAGCAAGG - Intergenic
1010824646 6:80457437-80457459 CAGAGCTCACACACTCAGCAGGG - Intergenic
1011798379 6:90982613-90982635 CACAGGTGCCTCAGACACCAAGG - Intergenic
1011799394 6:90994331-90994353 ATGTGCTGTCTCAGTCAGCATGG + Intergenic
1012905898 6:105065246-105065268 AAGGGCACCCTCAGTCAGCAAGG + Intronic
1013034990 6:106373087-106373109 CAGAGCTGTCTCCCTGAGCAGGG + Intergenic
1013733878 6:113203935-113203957 CAGAGCTGCCCCTCTCAGTACGG - Intergenic
1015588823 6:134803090-134803112 CAGAGAAGCCTCTGTCAGGATGG + Intergenic
1015861945 6:137690611-137690633 CAGTGCTGCCTGAGGCATCATGG - Intergenic
1019170053 6:170128839-170128861 AAGAGCAGCCTCAGGCTGCAAGG + Intergenic
1019652176 7:2165867-2165889 CAGACCTGCCTTTGTCAGCGGGG - Intronic
1019985011 7:4649174-4649196 GAGGACTGCCTCAGTCAGCCTGG - Intergenic
1021794258 7:24237566-24237588 CATTGGTGCCTAAGTCAGCAAGG - Intergenic
1024529429 7:50379167-50379189 CAGAGCCGCCTCAGGCAGCAGGG + Intronic
1030999207 7:116395567-116395589 CAGGGCTGTTTCAGACAGCAGGG - Intronic
1033720101 7:144050264-144050286 GGGTGCTGACTCAGTCAGCAAGG - Intergenic
1034348646 7:150402729-150402751 TAGGGCTTCCTCACTCAGCAGGG - Intronic
1035335239 7:158123836-158123858 CAGCTCTGCCTGGGTCAGCACGG - Intronic
1035697921 8:1614327-1614349 CAGAACTGACTCAGTGAACACGG + Intronic
1037319576 8:17630583-17630605 CAGAGCTGCTGCACTCACCATGG - Intronic
1038010568 8:23472578-23472600 CAGAGGTGCCTCAGTGGCCAGGG + Intergenic
1040681553 8:49816906-49816928 CTAAGCAGCCTCACTCAGCAGGG - Intergenic
1041324299 8:56648656-56648678 CTGAGCTACCTCATTTAGCAAGG - Intergenic
1044316443 8:90754113-90754135 CAGCACTGCCTCAGGCAGCTGGG - Intronic
1044637956 8:94345900-94345922 CAGAGCTACATATGTCAGCATGG + Intergenic
1045343787 8:101276474-101276496 CAGAGGTGCCTCCATCAGCCAGG + Intergenic
1045387974 8:101689577-101689599 CACTGCTGCCTCATTCACCATGG + Intronic
1045987728 8:108268408-108268430 CAGAGCTGGCTCTGTCTGGAGGG + Intronic
1046733262 8:117748763-117748785 CAGAGCTGGCTCACACACCAGGG + Intergenic
1049392567 8:142379761-142379783 CAGGGCTGCCTCAGCCTCCAGGG + Intronic
1050640213 9:7659529-7659551 CAAAAGTGCCTCAGTCAGAAGGG - Intergenic
1051502068 9:17788796-17788818 GACAGCTGCATCAGTCAGCTGGG + Intronic
1053157906 9:35792761-35792783 CACAGCACCCGCAGTCAGCAGGG - Exonic
1053373113 9:37579337-37579359 CATAGCTTTGTCAGTCAGCAAGG - Intronic
1053499175 9:38570324-38570346 CAGAGGGGGCTCAGTCAGCTGGG - Intronic
1053912494 9:42921128-42921150 CAGAGGGGGCTCAGTCAGCTGGG + Intergenic
1055762577 9:79624699-79624721 CAAAGATGCCTTAGGCAGCAGGG - Intronic
1056072954 9:83007808-83007830 CAGAGCTGGGTCAGCGAGCATGG - Intronic
1056777224 9:89522272-89522294 AAGTGATGCCTCAGTCTGCAGGG + Intergenic
1057162225 9:92896657-92896679 CAGAGGGGGCTCAGTCAGCTGGG - Intergenic
1057298870 9:93865141-93865163 AAGAGCTGCCTCAGTGAGGAAGG - Intergenic
1060049019 9:120363665-120363687 GAGAGCTGCCTCTGTCCCCAGGG - Intergenic
1061235339 9:129339082-129339104 CAGAGCTGCCCCACTAGGCAGGG + Intergenic
1061574698 9:131498761-131498783 CAGAGCTGCCAGCGTCAGGAGGG - Exonic
1061743479 9:132723775-132723797 CAGAGCTTCATCACCCAGCATGG + Intergenic
1062051532 9:134449789-134449811 CAGAGCTTAGCCAGTCAGCAGGG - Intergenic
1062333292 9:136053879-136053901 CAGGGCTGACACAGACAGCAAGG + Intronic
1062338682 9:136083893-136083915 CAGAGCTGCCTGGGCCAGCCAGG - Intronic
1062606480 9:137350901-137350923 CAGCACAGCCTCAGTCACCAGGG - Intronic
1203707688 Un_KI270742v1:67879-67901 CAGAGGGGGCTCAGTCAGCTGGG + Intergenic
1186824899 X:13329577-13329599 CACATCTCCCTCAGTCAACACGG - Intergenic
1186947171 X:14581457-14581479 TAGAGCTGCCTGATTCTGCAGGG + Intronic
1191045353 X:56130005-56130027 CACAGCAGCCTCAGTAAGCCAGG + Intergenic
1192218400 X:69179835-69179857 AAGAGCTTCCCCAGGCAGCAGGG - Intergenic
1197147619 X:123186574-123186596 CAGAGCTCTCTCAGTAAGTAAGG - Intronic
1198262096 X:134974051-134974073 CAGCTCTGCCCCAGTAAGCAAGG - Intergenic
1200048262 X:153414019-153414041 CAGACCTGCCTCAGTAATCTTGG + Intergenic