ID: 1181871890

View in Genome Browser
Species Human (GRCh38)
Location 22:25905985-25906007
Sequence CTGGGGGACCACTTAGTGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 145}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181871883_1181871890 13 Left 1181871883 22:25905949-25905971 CCCTCTTGAAAACTGTGTTAACT 0: 1
1: 0
2: 3
3: 27
4: 257
Right 1181871890 22:25905985-25906007 CTGGGGGACCACTTAGTGCTCGG 0: 1
1: 0
2: 0
3: 8
4: 145
1181871882_1181871890 29 Left 1181871882 22:25905933-25905955 CCAAGAATAAAACAAGCCCTCTT 0: 1
1: 0
2: 1
3: 23
4: 260
Right 1181871890 22:25905985-25906007 CTGGGGGACCACTTAGTGCTCGG 0: 1
1: 0
2: 0
3: 8
4: 145
1181871884_1181871890 12 Left 1181871884 22:25905950-25905972 CCTCTTGAAAACTGTGTTAACTC 0: 1
1: 0
2: 2
3: 24
4: 194
Right 1181871890 22:25905985-25906007 CTGGGGGACCACTTAGTGCTCGG 0: 1
1: 0
2: 0
3: 8
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181871890 Original CRISPR CTGGGGGACCACTTAGTGCT CGG Intronic
901037273 1:6343882-6343904 CTGTGGGGCCTCTCAGTGCTGGG + Intronic
903063165 1:20684251-20684273 CTGAGCGACCCCTGAGTGCTGGG - Intronic
903684398 1:25120221-25120243 CAGGGGGCCCACTTCTTGCTGGG + Intergenic
905541358 1:38763022-38763044 CTGGGGGCCCACTTTATGCCAGG - Intergenic
912405135 1:109431319-109431341 CTGGGTCACCACCTTGTGCTAGG - Intergenic
912776882 1:112511030-112511052 CTTGGGGACCAATTGGTGTTTGG + Intronic
914352142 1:146849695-146849717 CTGGGTTACCACTTGGTGCATGG - Intergenic
921541515 1:216422153-216422175 CTGGGAGTCCACATACTGCTTGG + Exonic
922618646 1:226977735-226977757 CTGGGTGGCCACTTTGGGCTGGG - Intronic
1065272634 10:24050947-24050969 TTGGGGGAACAGTTAGTGTTTGG + Intronic
1067343839 10:45424160-45424182 CTGGGGGCCCAAGTGGTGCTGGG + Intronic
1067730880 10:48810761-48810783 GTGGGGCACCACCTAGTCCTGGG + Intronic
1068894370 10:62183079-62183101 TTGGGGGACCACATGGTGTTTGG + Intronic
1069889489 10:71644190-71644212 CTGGGGAGCCACTTTGGGCTGGG + Intronic
1072515221 10:96175297-96175319 CTGGGCCACCACTTTGTACTTGG + Intronic
1072696942 10:97610995-97611017 CTGGGAGACCATTTAGTGTTAGG + Intronic
1073485058 10:103812032-103812054 CTGGGGCACCAATAAGTGCTGGG + Intronic
1074211347 10:111338220-111338242 CTGAGGCACCACTAAGTACTAGG - Intergenic
1075858910 10:125656871-125656893 CTGGGGGGCAGCTCAGTGCTGGG - Intronic
1076762020 10:132610642-132610664 CGTGGGGACCACCCAGTGCTGGG + Intronic
1079225551 11:18601635-18601657 CTGGGGGACCACTTGAGGCCTGG - Intergenic
1080206410 11:29734640-29734662 TTGGGGGAACAGATAGTGCTTGG + Intergenic
1080642895 11:34168101-34168123 CTGGGGGACCACAGGATGCTCGG - Intronic
1082302373 11:50523950-50523972 CTGAGAGACCACTTTGTGATAGG + Intergenic
1082585752 11:54937507-54937529 CTGGGAAACCACTTTGTGATGGG - Intergenic
1083864255 11:65445223-65445245 CTGTGGGCCCCCTCAGTGCTCGG + Intergenic
1087106076 11:94408500-94408522 CTGGGGGAACACTTAGGGTTTGG + Intergenic
1088035724 11:105311935-105311957 CTGGAGGACCACTTAAAGCCAGG - Intergenic
1089604137 11:119631897-119631919 CTGGGCTACCACTTTGTGCCAGG - Intronic
1090483009 11:127084454-127084476 ATGGAGGAGCACATAGTGCTTGG + Intergenic
1091123554 11:133076933-133076955 GTGGGTGACCACTTTGTGATCGG + Intronic
1093182966 12:15988149-15988171 CTGGGGGAGCCCTGAGTTCTGGG + Intronic
1093229564 12:16527032-16527054 CTGTGGCACCACTTAGCTCTAGG + Intronic
1095708259 12:45261045-45261067 CTGGGGGATCACTTAAGGCCAGG - Intronic
1096476610 12:51912816-51912838 CTGGGAGAGCACTCAGGGCTGGG + Intronic
1100143560 12:91649358-91649380 CTGTGGGACTAATTAGAGCTGGG - Intergenic
1103786298 12:123435898-123435920 CTGGGGGATCACTTGGAGCCAGG + Intronic
1109340352 13:61050523-61050545 CTGGGGACTCTCTTAGTGCTGGG - Intergenic
1114417534 14:22554517-22554539 TTGGGGGACCAGTGACTGCTGGG - Intergenic
1115910666 14:38254321-38254343 CTGGGGGACCGGGTAGTGCTGGG - Exonic
1119046337 14:71321175-71321197 CGCGGGGACCACTTACCGCTCGG - Intronic
1122287031 14:100658351-100658373 CTGAGGGGCCACATGGTGCTGGG + Intergenic
1122692510 14:103537969-103537991 CTGGGGAACCACTTATGGCCAGG - Intergenic
1122861939 14:104586669-104586691 CAGGGGGATCACTGAGGGCTGGG + Intronic
1126985148 15:54297579-54297601 TGGGAGGACCACTTAATGCTAGG - Intronic
1129314064 15:74730601-74730623 CTGGAAGACCAACTAGTGCTAGG + Intergenic
1134654960 16:15941284-15941306 CTGGGGGATCACTTGAAGCTAGG - Intergenic
1134792367 16:17000771-17000793 CAGGGGGATCACTTAAGGCTGGG - Intergenic
1139981888 16:70865837-70865859 CTGGGTTACCACTTGGTGCATGG + Intronic
1141252436 16:82370542-82370564 CTGGATGATCACTTTGTGCTGGG + Intergenic
1203012294 16_KI270728v1_random:307264-307286 CTGGGGAACTACTTTGTGATGGG + Intergenic
1203030629 16_KI270728v1_random:580423-580445 CTGGGGAACTACTTTGTGATGGG + Intergenic
1203041092 16_KI270728v1_random:754008-754030 CTGGGGAACTACTTTGTGATGGG - Intergenic
1144639863 17:16931330-16931352 CTGGAGGGCCACGTAGAGCTTGG + Intronic
1145270535 17:21402372-21402394 CTGGGGGCCCACATGCTGCTGGG - Intronic
1145308744 17:21689768-21689790 CTGGGGGCCCACATGCTGCTGGG - Intergenic
1145743604 17:27296193-27296215 GTGGGGGAACACTTAGTGGATGG - Intronic
1147175639 17:38654597-38654619 CTGTGGGGCCACTGAGGGCTGGG - Intergenic
1148354930 17:46969307-46969329 CTGGGGGGCCACTGAGAGCCGGG + Intronic
1148716615 17:49720336-49720358 CTAGGGGACCACGCAGTGCGGGG - Exonic
1149237187 17:54606191-54606213 CTGAGTGTCCACTAAGTGCTAGG - Intergenic
1152853222 17:82649285-82649307 CTGGGGGACCTCTGTGTCCTGGG - Intergenic
1156491298 18:37498051-37498073 CTGGGGGAGAACTCAGTGCAGGG + Intronic
1158742286 18:60156594-60156616 CGGGTGGACCACTTGGGGCTGGG + Intergenic
1161588503 19:5118180-5118202 CTTGGTGACCACTTGGTCCTTGG + Intronic
1163025253 19:14507245-14507267 CTGAGGGACACCTCAGTGCTAGG - Intergenic
1163247123 19:16103461-16103483 CTGGCGGACCGCTTAGGGCCAGG + Intergenic
1163364692 19:16869401-16869423 CTGGGGGTCCTCTGGGTGCTGGG + Intronic
1164742868 19:30589681-30589703 CTGGGGGACAAGGTAGAGCTGGG + Intronic
1165219129 19:34300587-34300609 CCAGGGGAGCACTCAGTGCTCGG - Exonic
1166751016 19:45164065-45164087 CTGGGGCACCCCTTAGGCCTGGG + Intronic
1167143498 19:47668203-47668225 CTGCGGGCCCACTATGTGCTGGG - Intronic
1167588145 19:50386691-50386713 CTGGGGGCCCACCCTGTGCTGGG + Intronic
929576359 2:43055259-43055281 CTGGGGGAAAACTGAGTACTGGG - Intergenic
933777057 2:85777469-85777491 CTGGGGGCCCCCTTAGTGTCAGG + Intronic
935315604 2:101830753-101830775 CTGAGCGATCACTTAGTGATTGG + Intronic
935562065 2:104569484-104569506 CTGGGGAACCACTCAGTCCTGGG + Intergenic
935570896 2:104659391-104659413 AGGGGGGACCACCTAGCGCTCGG - Intergenic
947331425 2:229033322-229033344 CTTGGGTTCCACTTACTGCTGGG + Intronic
948864101 2:240766806-240766828 CTCGCGACCCACTTAGTGCTGGG + Intronic
948942946 2:241205016-241205038 CGGGGGGACCCCTAGGTGCTAGG + Intronic
1168819180 20:761789-761811 CTGGGGGTCCTCTCCGTGCTTGG - Exonic
1169957431 20:11120427-11120449 ATGGGGAACTACTAAGTGCTAGG + Intergenic
1173105162 20:40126995-40127017 CTAGGTGACCTCTAAGTGCTAGG - Intergenic
1173738738 20:45380660-45380682 CTGGGGAATCACTGTGTGCTAGG + Intronic
1174005997 20:47411286-47411308 CTGGTGCCCCACTTCGTGCTTGG + Intergenic
1174294390 20:49534566-49534588 CTGGGGAAGCAATCAGTGCTAGG + Intronic
1174753835 20:53138807-53138829 CTGTGGGATTCCTTAGTGCTGGG - Intronic
1174817940 20:53702708-53702730 CTGGCGGATCACTTGATGCTAGG + Intergenic
1175707172 20:61188294-61188316 CTGGGAGAACACAGAGTGCTAGG - Intergenic
1176103200 20:63373840-63373862 CTGGGGTACAACTGAGGGCTGGG - Intronic
1179810999 21:43869683-43869705 CTGGGGGTCCACTTGGCACTGGG - Intronic
1179929828 21:44559875-44559897 CCAGGGGTCCACTGAGTGCTTGG + Intronic
1180352977 22:11819099-11819121 CTGGGGGACCCCTGGGTGCATGG - Intergenic
1180385267 22:12173258-12173280 CTGGGGGACCCCTGGGTGCATGG + Intergenic
1181385767 22:22544583-22544605 CTGGAGGACCACTTGAGGCTAGG - Intergenic
1181610843 22:24010881-24010903 CTTGGGGAACACTTAGAGCGGGG - Intergenic
1181871890 22:25905985-25906007 CTGGGGGACCACTTAGTGCTCGG + Intronic
1183308335 22:37095922-37095944 CTCGGGGTCCACTTCGTACTCGG + Exonic
1183417574 22:37691339-37691361 CTGGGGCACCGCTTCGTTCTCGG - Exonic
1183665465 22:39243753-39243775 CTGGGTGACCTCTTCGGGCTGGG - Intronic
1183669513 22:39264266-39264288 CTGAGGGCCCACTGTGTGCTGGG + Intergenic
1184204229 22:42991057-42991079 CTGGTGGAACTCCTAGTGCTAGG + Intronic
950789493 3:15461262-15461284 CTGTGGGACCAGATGGTGCTGGG - Intronic
953767182 3:45752502-45752524 CTGGGGGACCAATTAGTAAGGGG + Intergenic
956404025 3:68909423-68909445 CTGAGGGACTACTTGGTGCCAGG - Intronic
961615453 3:128175697-128175719 TTGGGGGAACTCATAGTGCTGGG + Intronic
968133560 3:196207188-196207210 CTGGGGGCCTACTGTGTGCTAGG - Intronic
971255703 4:25011502-25011524 CTGGGAAGCCACTTGGTGCTTGG + Intronic
973376014 4:49287082-49287104 CTGGGGGACTCCTGAGTGCATGG + Intergenic
976562218 4:86514871-86514893 TTGGGGGAACAGGTAGTGCTTGG + Intronic
979274524 4:118800128-118800150 CTGGGGGTCCACGTGGTGGTGGG + Intronic
981697471 4:147573452-147573474 ATGGGGGGCCACTTTGTGCTAGG + Intergenic
982280827 4:153682425-153682447 CTGGTGGATCACTTGGTGCCAGG + Intergenic
984656170 4:182321293-182321315 CTGGGTGACTACTATGTGCTAGG - Intronic
985036712 4:185847734-185847756 CTAGGGTACAACTTACTGCTTGG - Intronic
986197277 5:5549614-5549636 ATGGGGAACCAATTAGGGCTTGG + Intergenic
997457654 5:134029096-134029118 CTAGGGAACCTCTTAGTCCTAGG + Intergenic
997918223 5:137950624-137950646 CAGGAGGACCACTTAGGCCTAGG - Intronic
997985703 5:138499838-138499860 CGGGAGGATCACTTAGAGCTAGG + Intergenic
1000217854 5:159181051-159181073 CTGGGGGAACACATGGTGTTTGG - Intronic
1006154870 6:32008555-32008577 CGGGGCGACCCCTCAGTGCTCGG + Intergenic
1006161183 6:32041290-32041312 CGGGGCGACCCCTCAGTGCTCGG + Exonic
1011637060 6:89384434-89384456 CTGGAGGACCACTTAGGCCCAGG - Intronic
1011928972 6:92685915-92685937 GTGGAAGACCACTTAGTTCTTGG - Intergenic
1016934143 6:149436407-149436429 CTGGGGGACCCCTCAGTCCCAGG - Intergenic
1022275050 7:28847072-28847094 CTGGGGGACACCTCAGTGTTTGG - Intergenic
1022953374 7:35359899-35359921 CTGGGGGAACAGGTGGTGCTTGG + Intergenic
1024533799 7:50413491-50413513 CTGGGGGAACACCGAGAGCTAGG + Intergenic
1025528850 7:61850650-61850672 CTGGGAAACCACTTTGTGATGGG - Intergenic
1029812544 7:103064120-103064142 ATGGGGAAGCACTTAGTCCTGGG - Intronic
1032389668 7:131547773-131547795 CTTGGGGGCCACTGAGGGCTTGG - Intronic
1034450267 7:151133480-151133502 ATGGGGGGCCACTTTGTGCTTGG - Intronic
1034459600 7:151191197-151191219 TTGGGGGTCCTATTAGTGCTGGG + Intronic
1035990849 8:4488727-4488749 CTGAGGGCCCATTTGGTGCTGGG - Intronic
1036423348 8:8618590-8618612 CTGGGCCACCACTCAGAGCTTGG - Intergenic
1039199351 8:35071419-35071441 CAGGAAGACCACTTAGAGCTAGG + Intergenic
1040425890 8:47285875-47285897 CTGGGTGCCCACTGTGTGCTAGG - Intronic
1043734140 8:83723574-83723596 CTGAGGGACCTCCTAGTTCTGGG + Intergenic
1044412717 8:91902059-91902081 CTAGGCCACCACTGAGTGCTGGG - Intergenic
1047148552 8:122233767-122233789 CTGGGAGACCACTAAGTTCCAGG - Intergenic
1047530167 8:125667282-125667304 CTGGGGGATCACTTGATGCCAGG - Intergenic
1049029262 8:140022269-140022291 CTTGGGGACCACTTAGACTTAGG + Intronic
1052286413 9:26790823-26790845 CTGAGGGCCTACATAGTGCTGGG + Intergenic
1052729210 9:32265573-32265595 CTCCAGGACCACTTAGTGGTTGG + Intergenic
1052845698 9:33334225-33334247 CTGGGGGATCACTTAAAGCCAGG + Intronic
1057437248 9:95052982-95053004 CTCGGTGCACACTTAGTGCTAGG + Intronic
1061417056 9:130452754-130452776 CTGGGGGATCACCTGGTTCTGGG + Intronic
1203568557 Un_KI270744v1:111321-111343 CTGGGGGACTCCTGAGTGCATGG + Intergenic
1185767426 X:2736990-2737012 CTGGGGAAGCTCTTAGTGCTCGG + Intronic
1187153256 X:16700955-16700977 CTGGGAGCCCTCTTAGTCCTGGG - Intronic
1187387364 X:18860912-18860934 TTGGGGGGTCACTTAGTGTTTGG - Intergenic
1192947573 X:75982842-75982864 CTGGGGGACCACACAGGGCCAGG - Intergenic
1193789040 X:85796661-85796683 CTGGGGCAAGGCTTAGTGCTGGG + Intergenic