ID: 1181872420

View in Genome Browser
Species Human (GRCh38)
Location 22:25910652-25910674
Sequence ATGCCTCTCTCCTGCAGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181872420_1181872430 5 Left 1181872420 22:25910652-25910674 CCATGGCTGCAGGAGAGAGGCAT No data
Right 1181872430 22:25910680-25910702 CTACTGGGGACCTGGGGGAGGGG No data
1181872420_1181872426 -1 Left 1181872420 22:25910652-25910674 CCATGGCTGCAGGAGAGAGGCAT No data
Right 1181872426 22:25910674-25910696 TCTCTTCTACTGGGGACCTGGGG No data
1181872420_1181872428 3 Left 1181872420 22:25910652-25910674 CCATGGCTGCAGGAGAGAGGCAT No data
Right 1181872428 22:25910678-25910700 TTCTACTGGGGACCTGGGGGAGG No data
1181872420_1181872424 -3 Left 1181872420 22:25910652-25910674 CCATGGCTGCAGGAGAGAGGCAT No data
Right 1181872424 22:25910672-25910694 CATCTCTTCTACTGGGGACCTGG No data
1181872420_1181872422 -10 Left 1181872420 22:25910652-25910674 CCATGGCTGCAGGAGAGAGGCAT No data
Right 1181872422 22:25910665-25910687 AGAGAGGCATCTCTTCTACTGGG No data
1181872420_1181872429 4 Left 1181872420 22:25910652-25910674 CCATGGCTGCAGGAGAGAGGCAT No data
Right 1181872429 22:25910679-25910701 TCTACTGGGGACCTGGGGGAGGG No data
1181872420_1181872423 -9 Left 1181872420 22:25910652-25910674 CCATGGCTGCAGGAGAGAGGCAT No data
Right 1181872423 22:25910666-25910688 GAGAGGCATCTCTTCTACTGGGG No data
1181872420_1181872434 21 Left 1181872420 22:25910652-25910674 CCATGGCTGCAGGAGAGAGGCAT No data
Right 1181872434 22:25910696-25910718 GGAGGGGGTTTCACAGTCAAGGG No data
1181872420_1181872436 27 Left 1181872420 22:25910652-25910674 CCATGGCTGCAGGAGAGAGGCAT No data
Right 1181872436 22:25910702-25910724 GGTTTCACAGTCAAGGGCAAGGG No data
1181872420_1181872427 0 Left 1181872420 22:25910652-25910674 CCATGGCTGCAGGAGAGAGGCAT No data
Right 1181872427 22:25910675-25910697 CTCTTCTACTGGGGACCTGGGGG No data
1181872420_1181872437 28 Left 1181872420 22:25910652-25910674 CCATGGCTGCAGGAGAGAGGCAT No data
Right 1181872437 22:25910703-25910725 GTTTCACAGTCAAGGGCAAGGGG No data
1181872420_1181872425 -2 Left 1181872420 22:25910652-25910674 CCATGGCTGCAGGAGAGAGGCAT No data
Right 1181872425 22:25910673-25910695 ATCTCTTCTACTGGGGACCTGGG No data
1181872420_1181872435 26 Left 1181872420 22:25910652-25910674 CCATGGCTGCAGGAGAGAGGCAT No data
Right 1181872435 22:25910701-25910723 GGGTTTCACAGTCAAGGGCAAGG No data
1181872420_1181872431 6 Left 1181872420 22:25910652-25910674 CCATGGCTGCAGGAGAGAGGCAT No data
Right 1181872431 22:25910681-25910703 TACTGGGGACCTGGGGGAGGGGG No data
1181872420_1181872433 20 Left 1181872420 22:25910652-25910674 CCATGGCTGCAGGAGAGAGGCAT No data
Right 1181872433 22:25910695-25910717 GGGAGGGGGTTTCACAGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181872420 Original CRISPR ATGCCTCTCTCCTGCAGCCA TGG (reversed) Intronic