ID: 1181872424

View in Genome Browser
Species Human (GRCh38)
Location 22:25910672-25910694
Sequence CATCTCTTCTACTGGGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181872420_1181872424 -3 Left 1181872420 22:25910652-25910674 CCATGGCTGCAGGAGAGAGGCAT No data
Right 1181872424 22:25910672-25910694 CATCTCTTCTACTGGGGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181872424 Original CRISPR CATCTCTTCTACTGGGGACC TGG Intronic