ID: 1181872430 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 22:25910680-25910702 |
Sequence | CTACTGGGGACCTGGGGGAG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1181872420_1181872430 | 5 | Left | 1181872420 | 22:25910652-25910674 | CCATGGCTGCAGGAGAGAGGCAT | No data | ||
Right | 1181872430 | 22:25910680-25910702 | CTACTGGGGACCTGGGGGAGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1181872430 | Original CRISPR | CTACTGGGGACCTGGGGGAG GGG | Intronic | ||