ID: 1181872433

View in Genome Browser
Species Human (GRCh38)
Location 22:25910695-25910717
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181872420_1181872433 20 Left 1181872420 22:25910652-25910674 CCATGGCTGCAGGAGAGAGGCAT No data
Right 1181872433 22:25910695-25910717 GGGAGGGGGTTTCACAGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type