ID: 1181873031

View in Genome Browser
Species Human (GRCh38)
Location 22:25917229-25917251
Sequence AAACTACCTCCTGTTAACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 134}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181873030_1181873031 20 Left 1181873030 22:25917186-25917208 CCATAAAGGAAAAGTTTTAAAAT 0: 1
1: 0
2: 12
3: 123
4: 1069
Right 1181873031 22:25917229-25917251 AAACTACCTCCTGTTAACTTTGG 0: 1
1: 0
2: 0
3: 14
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181873031 Original CRISPR AAACTACCTCCTGTTAACTT TGG Intronic
903039189 1:20515765-20515787 AAAATAACTTCTGGTAACTTGGG + Intergenic
905401697 1:37708371-37708393 AAAGTCCATCCTGTCAACTTTGG - Exonic
906197895 1:43940435-43940457 AAAAGACATCCTGTTAAATTTGG + Intergenic
907921726 1:58920121-58920143 AAACTTCCTCTTGTTAGCATTGG + Intergenic
908148216 1:61270245-61270267 ACACAACATCCTGTTAAGTTAGG + Intronic
909325102 1:74341593-74341615 AAACTAACTCTTGCTAATTTAGG + Intronic
909440936 1:75695241-75695263 AAACTAGTTCCTGTTGACTTTGG + Intergenic
909968575 1:81950467-81950489 AAAATACCTCTTGTTCCCTTAGG - Exonic
910253193 1:85219794-85219816 AAACTATCACCTGGTAATTTTGG + Intergenic
910352994 1:86321089-86321111 AAACTACAGCATGTTAACTCAGG + Intergenic
911798680 1:102107065-102107087 ACACTATCACCTGTTCACTTTGG + Intergenic
912408070 1:109458654-109458676 AAACTAGCTCCTGTTAAGATAGG + Intergenic
914812231 1:151037375-151037397 AGATTACCTGCTGTTAAGTTTGG - Intronic
915991606 1:160522973-160522995 CTACTACCTCCTCTCAACTTTGG - Intronic
916317673 1:163468458-163468480 AAACAACTTCATGTTAACTGAGG + Intergenic
917329375 1:173866576-173866598 AAACAACTTCATGTGAACTTAGG + Intergenic
919359592 1:196575237-196575259 TAACTACCCCCTTTTAAATTTGG + Intronic
919372290 1:196742926-196742948 ATTCTTCCTCCTTTTAACTTGGG + Intronic
921330889 1:214034305-214034327 ACACTACTTCCTTTTTACTTTGG + Intronic
923607399 1:235456884-235456906 AAAGAACCTCCTTTTAATTTGGG - Intronic
1063074166 10:2698228-2698250 AAAATACTTCCTGTTAATTGAGG - Intergenic
1063829097 10:9931716-9931738 AAGCTGCCTCCTGTTCACATAGG - Intergenic
1065178336 10:23100145-23100167 AAACACCCTCCTCTTAGCTTTGG - Intronic
1066247938 10:33602525-33602547 TTCCTTCCTCCTGTTAACTTCGG - Intergenic
1066629989 10:37449859-37449881 CAACTACCTCCTGGTCACTTCGG + Intergenic
1068039400 10:51804026-51804048 AAACTACCACGTGGCAACTTTGG + Intronic
1072521562 10:96234455-96234477 AAACTACCACCTGTGCACTTTGG - Intronic
1072886018 10:99274804-99274826 AAACTTCCTCCAGTTTACTCTGG - Intergenic
1075410226 10:122222300-122222322 ATACTTCCTCCTGTCATCTTGGG - Intronic
1078870132 11:15335773-15335795 AGGGTACCTCCTCTTAACTTGGG + Intergenic
1086413725 11:86568547-86568569 AAATTTCATCCTGGTAACTTGGG - Intronic
1087242928 11:95800351-95800373 AGACTACCTACTGTTACCGTAGG - Intronic
1087289082 11:96299988-96300010 TCCCTACCTCCTCTTAACTTTGG - Intronic
1087575881 11:99988881-99988903 AAACAACTTCCTCATAACTTAGG + Intronic
1087744897 11:101932503-101932525 AAAATACCACCTCTTAGCTTTGG + Intronic
1088062745 11:105676309-105676331 AAACTGCCTCCTGTGTACTTGGG - Intronic
1088751108 11:112842911-112842933 ATACTGCCTCCTGTTTCCTTAGG + Intergenic
1089038438 11:115421632-115421654 AAGCTCCCTGCTGTTAACATTGG - Intronic
1089412313 11:118256050-118256072 AAACTCCCTAATGTTAATTTTGG + Intronic
1092717191 12:11402628-11402650 CATTTACCTCCTGTTATCTTTGG + Intronic
1093036711 12:14338702-14338724 AAACTACCTGTGCTTAACTTTGG - Intergenic
1097315765 12:58169944-58169966 AAACTACTTCCTGCTGTCTTGGG + Intergenic
1097786183 12:63762444-63762466 AATCTACTTCAAGTTAACTTTGG + Intergenic
1098335053 12:69395538-69395560 AAAATTCTTCCTGTTAAGTTTGG - Intergenic
1100372701 12:93983130-93983152 CAACTTGCTTCTGTTAACTTGGG - Intergenic
1107116911 13:36756754-36756776 TGACTACCACCTGTTCACTTTGG + Intergenic
1111625822 13:90785389-90785411 TAACTTCCTTCTGCTAACTTTGG + Intergenic
1112491115 13:99865059-99865081 ACACTACTTCCTGATAATTTAGG + Intronic
1113533616 13:111046859-111046881 AAACAGCCCCCGGTTAACTTAGG + Intergenic
1114845990 14:26322572-26322594 AAAGAACCACCTGTTACCTTTGG - Intergenic
1115584317 14:34794835-34794857 AGACTACCTCCTGAAATCTTTGG - Exonic
1117410899 14:55450105-55450127 ATATTACCTCCTGTTAGCTCAGG - Intronic
1120644048 14:87050864-87050886 AAACTGCATCCTGCTATCTTGGG - Intergenic
1127306590 15:57711859-57711881 AAATTACTTACTGTTACCTTTGG + Intronic
1128510103 15:68308219-68308241 AAACTAGATCCTGTTCACATAGG - Intronic
1131901873 15:97096419-97096441 AAACTAGCTCCTTTAAACTAAGG + Intergenic
1133665101 16:7959385-7959407 AAACTGCCTCTTGTTAATTTTGG + Intergenic
1137578182 16:49617671-49617693 CAAATACTTCCTGTTACCTTTGG + Intronic
1143241215 17:5444727-5444749 AAACTACCGCCTGTGAAGGTAGG + Intronic
1149671308 17:58414736-58414758 AACCTGCCTCCTGATCACTTTGG - Intronic
1156067716 18:33164827-33164849 AAACTACCTCTTGCTGAGTTGGG - Intronic
1156277424 18:35596960-35596982 AAATTAACTCCTGCTAAGTTAGG - Intronic
1157744927 18:50127083-50127105 AAACTGCCCCCAGTTAACATAGG + Intronic
1159744982 18:72222003-72222025 CAGCTACCTCCAGTTAATTTTGG - Intergenic
1163357821 19:16825869-16825891 AAAATACCACCTGTTACCTAGGG - Intergenic
930344598 2:50164284-50164306 AAACTAAATCATTTTAACTTGGG - Intronic
934510887 2:94941845-94941867 GATCTCCCTCCTGTTTACTTGGG - Intergenic
935201166 2:100857676-100857698 AAACACGCTCCTGTTAACCTGGG + Intronic
935534270 2:104274599-104274621 AATCCACCTCCTGTAAACATAGG + Intergenic
935853171 2:107245073-107245095 AAAATATCTGCTGCTAACTTTGG - Intergenic
935941356 2:108242705-108242727 AAACTATCTACTTTTAATTTTGG + Intergenic
939201658 2:139043267-139043289 AGACTACCTTCTGTTAGCCTGGG + Intergenic
942239858 2:173951702-173951724 AAACTGCCACCTGTTAAGTTTGG - Intronic
942813880 2:180028624-180028646 AAACTACCACATGAAAACTTTGG - Intergenic
943459927 2:188159938-188159960 AAACTACCCTCTTTTAACATGGG + Intergenic
944184472 2:196931640-196931662 AAACTAACTCCAGTTAAAATGGG + Intergenic
947225983 2:227840494-227840516 AAACTACCTATCGTTAACTATGG + Intergenic
1177014875 21:15774087-15774109 AAATTACCATCTGTTAAGTTTGG - Intronic
1180690680 22:17712798-17712820 AAAATAGCTACTGTTTACTTAGG - Intronic
1181094635 22:20496675-20496697 AAACTAGCACCTGTTCACTCTGG - Intronic
1181873031 22:25917229-25917251 AAACTACCTCCTGTTAACTTTGG + Intronic
1182014030 22:27024002-27024024 CAACCCCTTCCTGTTAACTTGGG + Intergenic
949557331 3:5166700-5166722 AGTCTTCCTGCTGTTAACTTTGG + Intronic
951170842 3:19540047-19540069 AAGCTATTTCCTTTTAACTTGGG + Intergenic
952059329 3:29488745-29488767 AAATTACCTCCTAACAACTTTGG + Intronic
953638399 3:44683160-44683182 ATACTTCATCTTGTTAACTTTGG + Intergenic
955697232 3:61649028-61649050 AAAAAACCTAGTGTTAACTTTGG + Intronic
956938755 3:74133125-74133147 AAACTACCACCTGAAAACATTGG + Intergenic
957140713 3:76352153-76352175 AGACTACCTCTTCTCAACTTGGG - Intronic
957634443 3:82762057-82762079 AAATTGCCACCTGTTCACTTTGG + Intergenic
958750157 3:98186061-98186083 GAACTACCTGCTTTTAATTTTGG + Intronic
958910245 3:99986027-99986049 AAACTTCTTGCTGTTGACTTGGG - Intronic
960734865 3:120767776-120767798 TAAGTAACTCCTGTTAAGTTTGG + Intronic
962024286 3:131530934-131530956 AAACTACCACTTGTTGAGTTTGG + Intergenic
964491861 3:157244931-157244953 AAACTACCACTTGTTAGTTTTGG - Intergenic
964631338 3:158813846-158813868 AAATTACCTCCTGTTCAATTTGG + Intronic
964631743 3:158817908-158817930 AAATTATCTCCTGTTCAATTTGG + Intronic
966029436 3:175327036-175327058 AAACTACCTCCTTGTATTTTGGG - Intronic
966120979 3:176519880-176519902 AAACTACCTCCCTTTAATATTGG - Intergenic
971194585 4:24459921-24459943 AAACTACCTCATCTTATATTTGG - Intergenic
972439255 4:39069643-39069665 AAAATACCAACTGTTAATTTGGG + Intronic
972595064 4:40522531-40522553 AAACTACCTCTTGTAGAGTTTGG + Intronic
974151391 4:58014488-58014510 AAAATACATCATGTTATCTTTGG - Intergenic
974970351 4:68817185-68817207 AGACAACCTCCTGGTAACATGGG - Intronic
974985437 4:69019194-69019216 AGACAACCTCCTGATAACATGGG + Intronic
977211301 4:94221409-94221431 AAATTACCACCTGTCAAGTTTGG + Intronic
979358453 4:119733049-119733071 CAACAACCTCATGTTCACTTTGG - Intergenic
980393397 4:132175607-132175629 AAACTACCTAATAATAACTTTGG - Intergenic
980630059 4:135419370-135419392 AAACTGCCTCCTGGCGACTTTGG + Intergenic
982575555 4:157105063-157105085 ATTCTACCTTCTGCTAACTTTGG + Intronic
984447891 4:179860384-179860406 GAATTACCACCTGTTATCTTTGG - Intergenic
990647070 5:57857020-57857042 AAATTACTTCTTGTTAAGTTAGG + Intergenic
992896327 5:81248266-81248288 AACATACTTCCTGTTAGCTTAGG + Intronic
994385778 5:99129855-99129877 TTACTATTTCCTGTTAACTTTGG - Intergenic
995986573 5:118183060-118183082 AAACTACTTCCTATTTACTAGGG + Intergenic
996923662 5:128798040-128798062 AAACTACCTCCTCCAATCTTGGG + Intronic
999072207 5:148756629-148756651 TCTCTTCCTCCTGTTAACTTTGG + Intergenic
1000866728 5:166523457-166523479 AAAGTATCTCATGGTAACTTGGG + Intergenic
1002915275 6:1523848-1523870 AAAATACTTAATGTTAACTTAGG + Intergenic
1004938177 6:20528561-20528583 AATCAACCTCCTGTTGTCTTTGG - Intergenic
1009818901 6:68774169-68774191 AAATTACCTTGTGTGAACTTAGG + Intronic
1009966037 6:70579500-70579522 AAACGACCTTCTGGTAACTTCGG - Exonic
1013146377 6:107398083-107398105 AAACTACCACCTGTCAAATTTGG + Intronic
1014562820 6:122912163-122912185 TTACTTCCTCCTATTAACTTTGG + Intergenic
1018026155 6:159807801-159807823 AAACTACCACTTGTTGAGTTTGG + Intronic
1018332765 6:162749160-162749182 TAACCACCTGCTGTTGACTTGGG + Intronic
1019829926 7:3317652-3317674 AAACCAGCTCCTGTGAACATGGG - Intronic
1021229715 7:18071543-18071565 AAACCTTCTGCTGTTAACTTTGG - Intergenic
1024864584 7:53890392-53890414 AAAGTACCACATGTTAACTATGG + Intergenic
1026384514 7:69832836-69832858 AAACTGCCTCCTGTTATCTGAGG + Intronic
1028728047 7:94111418-94111440 AAAATACTTCTTGTTAACTAAGG - Intergenic
1028869514 7:95753117-95753139 TTACTTCCTTCTGTTAACTTTGG + Intergenic
1037229372 8:16636741-16636763 AAACTACCTCCTTTTATGCTGGG + Intergenic
1041790704 8:61693475-61693497 TAATTCTCTCCTGTTAACTTTGG - Intronic
1043300869 8:78729894-78729916 AACCTACCACCTGTTATCTCTGG - Intronic
1047302096 8:123622315-123622337 AAATTACCACCTATTAACTCTGG + Intergenic
1047549210 8:125851473-125851495 TAACTTCCTCCTGTGAAATTTGG - Intergenic
1048036290 8:130680400-130680422 AAACTATCTTCTGTTAAGTAAGG - Intergenic
1051058158 9:13012492-13012514 ACACTACCTCCTCTTCAATTAGG - Intergenic
1053334724 9:37256793-37256815 AAACTATCACCTGTTAATTTTGG + Intronic
1053904889 9:42831694-42831716 GATCTCCCTCCTGTTTACTTGGG + Intergenic
1054900599 9:70364895-70364917 AAACTAACTCATATTTACTTAGG - Intergenic
1056802919 9:89706271-89706293 CAAATGTCTCCTGTTAACTTAGG + Intergenic
1056955714 9:91079436-91079458 AAACTACATCCTGGTCACTTTGG + Intergenic
1060016217 9:120088558-120088580 AAATTCCCTCCTATTAGCTTGGG + Intergenic
1060563570 9:124568763-124568785 AAACTACCTCCTGTGAAGGTGGG + Intronic
1194493862 X:94585393-94585415 AAATTACCTCCTGGGAACTATGG - Intergenic
1196460516 X:115924368-115924390 AAACTTCCTCTTTTTAAATTTGG - Intergenic
1201567465 Y:15381965-15381987 AACCTTTCTCCTGTTCACTTAGG - Intergenic