ID: 1181879112

View in Genome Browser
Species Human (GRCh38)
Location 22:25963495-25963517
Sequence CTGGTGTCCTTGAGGACACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181879112_1181879115 -8 Left 1181879112 22:25963495-25963517 CCATGTGTCCTCAAGGACACCAG No data
Right 1181879115 22:25963510-25963532 GACACCAGTCATTGAATTCAGGG 0: 2
1: 9
2: 94
3: 310
4: 655
1181879112_1181879114 -9 Left 1181879112 22:25963495-25963517 CCATGTGTCCTCAAGGACACCAG No data
Right 1181879114 22:25963509-25963531 GGACACCAGTCATTGAATTCAGG 0: 3
1: 13
2: 130
3: 435
4: 857

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181879112 Original CRISPR CTGGTGTCCTTGAGGACACA TGG (reversed) Intronic
No off target data available for this crispr