ID: 1181882717

View in Genome Browser
Species Human (GRCh38)
Location 22:25993680-25993702
Sequence CTCTCTTAAGGGCTGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 208}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181882710_1181882717 -7 Left 1181882710 22:25993664-25993686 CCTTTGCCATTCACACCTCTCTT 0: 1
1: 0
2: 1
3: 30
4: 306
Right 1181882717 22:25993680-25993702 CTCTCTTAAGGGCTGGAGGCAGG 0: 1
1: 0
2: 1
3: 16
4: 208
1181882709_1181882717 -2 Left 1181882709 22:25993659-25993681 CCAGACCTTTGCCATTCACACCT 0: 1
1: 0
2: 1
3: 30
4: 207
Right 1181882717 22:25993680-25993702 CTCTCTTAAGGGCTGGAGGCAGG 0: 1
1: 0
2: 1
3: 16
4: 208
1181882707_1181882717 3 Left 1181882707 22:25993654-25993676 CCTACCCAGACCTTTGCCATTCA 0: 1
1: 0
2: 0
3: 18
4: 163
Right 1181882717 22:25993680-25993702 CTCTCTTAAGGGCTGGAGGCAGG 0: 1
1: 0
2: 1
3: 16
4: 208
1181882708_1181882717 -1 Left 1181882708 22:25993658-25993680 CCCAGACCTTTGCCATTCACACC 0: 1
1: 0
2: 1
3: 25
4: 202
Right 1181882717 22:25993680-25993702 CTCTCTTAAGGGCTGGAGGCAGG 0: 1
1: 0
2: 1
3: 16
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181882717 Original CRISPR CTCTCTTAAGGGCTGGAGGC AGG Intronic
902283361 1:15390455-15390477 CTTTCTAAGGGGCTGGAAGCTGG - Intronic
902862782 1:19257962-19257984 CTCTCTTGAGGGCGGTGGGCAGG - Exonic
903276109 1:22222867-22222889 CTATCTTAATGGCTTGTGGCGGG + Intergenic
904019468 1:27451501-27451523 CTCTGTTAAGTGCTGTAGCCCGG - Intronic
905699196 1:39999257-39999279 CTCGGTTAGGGGCTGGAGACCGG - Intergenic
905889576 1:41510857-41510879 CTCTCCTCAGAGCTGGAGGGCGG - Exonic
912422000 1:109548835-109548857 CTCGGTGAGGGGCTGGAGGCGGG + Exonic
915010302 1:152679117-152679139 ATCTCTCAAGGGCAGGAGGAGGG + Intergenic
916193201 1:162198798-162198820 CACTCCTAAGCTCTGGAGGCAGG - Intronic
917023323 1:170614073-170614095 CTCTCTTCAGAGCTGGAAGTCGG + Intergenic
919240954 1:194915024-194915046 CAGTCTTCAGGGCTGTAGGCTGG + Intergenic
920534963 1:206731428-206731450 CTGTGTGGAGGGCTGGAGGCAGG + Intronic
922582819 1:226711376-226711398 CACCCTCTAGGGCTGGAGGCAGG - Intronic
924172337 1:241356279-241356301 CTCTCTGATGGGCTGCAGGTGGG - Intronic
1062921204 10:1281235-1281257 GGCTCTTCAGGCCTGGAGGCAGG + Intronic
1063209330 10:3864562-3864584 CTGTCTCAAGTTCTGGAGGCTGG - Intergenic
1064141385 10:12793537-12793559 ATTTCTTACGGTCTGGAGGCTGG + Intronic
1064993317 10:21275392-21275414 CCCACTTAAGGTCTGGAAGCTGG - Intergenic
1066479918 10:35785866-35785888 CACAGTTAAGGGGTGGAGGCAGG - Intergenic
1069558037 10:69410591-69410613 CTCTCTGATGAGCTGCAGGCTGG + Intronic
1069822363 10:71235668-71235690 CAGTCCTCAGGGCTGGAGGCTGG - Intronic
1069951185 10:72019343-72019365 ATCTCTCAAGTTCTGGAGGCTGG - Intergenic
1070499109 10:77053768-77053790 CTTTCTTAAGAGATGGAGGTAGG - Intronic
1071842198 10:89484066-89484088 CTCTCTTAAGGCCAGGAGTTTGG + Intronic
1073347663 10:102796442-102796464 CTGTCTACAGGGCTAGAGGCTGG - Intronic
1075005967 10:118830363-118830385 CTCTCTGTTGGGCTGGAGACTGG - Intergenic
1076081780 10:127588883-127588905 CTCAGTTAGGAGCTGGAGGCAGG + Intergenic
1076536151 10:131179022-131179044 CTGTCAGAGGGGCTGGAGGCTGG - Intronic
1078611408 11:12822614-12822636 CTTTTTCCAGGGCTGGAGGCTGG + Intronic
1079104554 11:17561849-17561871 CTCTCTTGGGGGCAGTAGGCAGG - Intronic
1079164598 11:18027643-18027665 ATCTCTTAGGGTCTGGAGCCTGG - Intronic
1079228864 11:18632114-18632136 CTGTCGTCCGGGCTGGAGGCTGG - Intronic
1080366554 11:31580741-31580763 ATCTCTTGAGTCCTGGAGGCAGG - Intronic
1083214397 11:61209452-61209474 CGCTCTTAAGGACTTGAGGGTGG - Intronic
1083217281 11:61228281-61228303 CGCTCTTAAGGACTTGAGGGTGG - Intronic
1083220269 11:61248029-61248051 CGCTCTTAAGGACTTGAGGGTGG - Intronic
1083418819 11:62542344-62542366 CTCTCCTAAGGGCAGGGAGCAGG - Intronic
1083708829 11:64534913-64534935 CTCTCCTTAGTGCTGCAGGCAGG + Intergenic
1084515648 11:69636938-69636960 GTGCCTTAAGGGCTGGGGGCAGG - Intergenic
1085262895 11:75218468-75218490 CTCTCTAAAGGCCTGGGGTCTGG - Intergenic
1085281690 11:75335159-75335181 CTGTCTGTTGGGCTGGAGGCAGG - Intronic
1085399003 11:76224413-76224435 CACTGGTAAGAGCTGGAGGCTGG + Intergenic
1086282044 11:85201016-85201038 ATCTGCTATGGGCTGGAGGCTGG - Intronic
1087089014 11:94248660-94248682 CTCTCTTCAGAGCTGTAGACAGG - Intergenic
1087095474 11:94313646-94313668 CTATCTCAAGGGCTGGAGCTGGG - Intergenic
1088358341 11:108966402-108966424 GCCTCTAAAGGGCTGGAAGCAGG - Intergenic
1088494637 11:110420786-110420808 CTCTTTTAAGAACTGGAGCCAGG + Intergenic
1089898879 11:121960686-121960708 CACTCTTAAGGGCTGTGGGGAGG + Intergenic
1094208985 12:27870589-27870611 CTCTCTGAAGTGCTGGAGCCCGG - Intergenic
1094481239 12:30883864-30883886 ATTTCTTAAGTTCTGGAGGCTGG + Intergenic
1094558231 12:31524295-31524317 CTCTCTTAAGGGCTGAACCTAGG - Intronic
1095752337 12:45727404-45727426 CCCACTTAAGGGATGGAGCCTGG - Intergenic
1097065194 12:56315691-56315713 ATCACTTACGGGCTGGAGGTGGG - Intronic
1097152663 12:56991184-56991206 CTGGCTTATGGGGTGGAGGCAGG - Intergenic
1097357314 12:58616182-58616204 ATCTGTTAAGTCCTGGAGGCTGG + Intronic
1097636696 12:62131363-62131385 CCCTATTAAGGGCTGGATGCCGG + Intronic
1100277730 12:93086667-93086689 CTCAGTTAAGGGTTGGAGCCGGG - Intergenic
1101157464 12:101941190-101941212 GTCTCTTAAGGGCTTGAGACTGG - Intronic
1102007614 12:109598517-109598539 ACCTCCTAAAGGCTGGAGGCTGG - Intergenic
1102814933 12:115858127-115858149 ATGTCCTAAGGCCTGGAGGCAGG - Intergenic
1104681499 12:130755102-130755124 CTTTCTCAAGGGCAGGAAGCAGG - Intergenic
1104963844 12:132500409-132500431 CTCAGGCAAGGGCTGGAGGCTGG + Intronic
1105034075 12:132905566-132905588 CTATCTTAAGGGAGGGAGGGAGG + Intronic
1105773767 13:23637881-23637903 CTTTCACAGGGGCTGGAGGCCGG + Intronic
1108992921 13:56686023-56686045 CTCTCTAAAGGACTTCAGGCTGG + Intergenic
1110380229 13:74841741-74841763 CTCAATTGAGGGTTGGAGGCGGG - Intergenic
1111886541 13:94028705-94028727 GTCTCTAGAGGGCAGGAGGCAGG + Intronic
1113964386 13:114144437-114144459 CTCTGTCAAGGGCTGGGGACAGG + Intergenic
1115764173 14:36605711-36605733 CTTGCTTAAGAGTTGGAGGCTGG + Intergenic
1118722624 14:68605046-68605068 CTCCCTTGAGGGCTGGAGCGAGG - Intronic
1119635804 14:76272292-76272314 TTCTCTACAGTGCTGGAGGCTGG + Intergenic
1119744779 14:77036326-77036348 TTCTCTTAAGAGATGAAGGCTGG - Intergenic
1119960205 14:78847398-78847420 CTCTCTTAAGTGCTGGGGAAAGG - Intronic
1120578675 14:86217827-86217849 TTTTCTTAAGGGCGGGAGGCCGG - Intergenic
1121836967 14:97101144-97101166 CTCTCCTAAGGCCAGGAGGCAGG + Intergenic
1122042153 14:98996422-98996444 CTCCCCTAAAGGATGGAGGCAGG + Intergenic
1122214616 14:100194614-100194636 CTGTCTTCAAGGTTGGAGGCTGG + Intergenic
1130639041 15:85653772-85653794 CACTCTTACGGGATGGGGGCAGG - Intronic
1130835356 15:87644803-87644825 CTGTGTTAAGGGATGCAGGCAGG - Intergenic
1131575023 15:93580190-93580212 TTCTGTTAAGGGCTTCAGGCTGG + Intergenic
1131661737 15:94524648-94524670 CTCCCTGAAGGCCTGGAGGGAGG + Intergenic
1133322574 16:4923420-4923442 CTCTCCTGGGGGCAGGAGGCCGG - Intronic
1134645897 16:15865583-15865605 CGCTGTTGAGGGGTGGAGGCGGG - Intergenic
1135771424 16:25221142-25221164 ATCTCTGAAGGGCTGGAGGGAGG + Intronic
1137008472 16:35300270-35300292 CTCTCTTATTGGCTGGGTGCAGG + Intergenic
1137015174 16:35367198-35367220 CTCTCTTATTGGCTGGGTGCAGG + Intergenic
1140488105 16:75310219-75310241 CTCTCTTATGGCATGGAAGCTGG - Intronic
1141389485 16:83652638-83652660 CTCACTCAGGAGCTGGAGGCTGG + Intronic
1141869826 16:86777499-86777521 CTCTCCTGAGAGCAGGAGGCAGG + Intergenic
1141886952 16:86898833-86898855 CTCACTGCAGGGCTGGAGGGTGG - Intergenic
1142266885 16:89068047-89068069 CTCTCCCCAGGGCTGGAGGCTGG + Intergenic
1143278950 17:5736141-5736163 CTCACCTAATGGCTGCAGGCAGG + Intergenic
1144077109 17:11729332-11729354 CTCTGTTAAGGGCAGGATGGGGG - Intronic
1144726330 17:17504415-17504437 CTCCTTGGAGGGCTGGAGGCGGG - Intergenic
1146565380 17:33908545-33908567 CTCTCACAAGGGCTGGAATCAGG - Intronic
1147743217 17:42680317-42680339 GGCTCTTCAGGGCTGGAGTCTGG - Exonic
1148554961 17:48572984-48573006 CTCACTTAGGGTTTGGAGGCGGG - Intronic
1148749896 17:49939591-49939613 CTCTCTTGAGGGCAGTGGGCAGG - Intergenic
1151023742 17:70652102-70652124 TTCTCTTAAGAATTGGAGGCCGG - Intergenic
1152643794 17:81459799-81459821 CTCTCTGCTTGGCTGGAGGCCGG - Intronic
1153837009 18:8972342-8972364 CTGTCCTCAGGGCTGGAGGCTGG + Intergenic
1157947479 18:51997096-51997118 CTCACTCAAGGGATGGAGCCAGG - Intergenic
1160013469 18:75124108-75124130 CACTGATAAGGACTGGAGGCAGG - Intergenic
1160632279 18:80254856-80254878 CTCTCTCAAGGTCTTGAGACAGG - Intergenic
1162006936 19:7787241-7787263 CTCTCTTATGGGCCTGGGGCTGG - Intergenic
1167639504 19:50673009-50673031 GATTCTTAAGGGCTGCAGGCAGG - Intronic
1168078712 19:53993887-53993909 CTCTCTCTAGAGCTGTAGGCTGG - Intronic
925723213 2:6847811-6847833 CTCCCTTAACAGCTGGAGGTGGG - Intronic
928102793 2:28449271-28449293 CACTGGTAAGGGCTGGAGCCAGG + Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
935634836 2:105242353-105242375 CTCGCTCACGGGCTGGACGCTGG + Exonic
937150770 2:119684071-119684093 GTCTCTAAAGGGCTTTAGGCAGG - Intronic
937905407 2:127050559-127050581 CTCTGTGCAGGGCTGGAGGTGGG - Intronic
938137647 2:128772269-128772291 TTGTCTTAAGGGCTGAATGCAGG + Intergenic
940988568 2:160074640-160074662 TGCTCTTAAGGGTTGGAGACAGG + Intergenic
944583904 2:201156984-201157006 CTCTCTTAGGACCTGGAGGGAGG - Intronic
946196167 2:218034030-218034052 CTGTCGCAAGGGCTGGGGGCGGG - Intergenic
947481003 2:230499907-230499929 CTCTCATAAGGCCTGGAGGTGGG + Intronic
947559448 2:231134499-231134521 CTTTCTTAAGACCTGGTGGCTGG - Intronic
948299119 2:236888765-236888787 CTCTCTCAAGGACTGGAGTGGGG - Intergenic
1169067916 20:2704973-2704995 CTCTCCCAAAGCCTGGAGGCAGG + Intronic
1169636320 20:7696029-7696051 CTATCATTAGTGCTGGAGGCAGG - Intergenic
1172670854 20:36633617-36633639 CTCTCTCCAGGGATGGAGACTGG - Exonic
1172940430 20:38650174-38650196 CTCTCTGGAGGGCTGGAGGGTGG - Exonic
1173360273 20:42337965-42337987 CTCTGTTCAGGTCTGGAGGCTGG - Intronic
1176282715 20:64323724-64323746 TTCTCATACTGGCTGGAGGCTGG - Intergenic
1176292996 21:5056076-5056098 CTCCCTCCAGGGCTGGGGGCAGG - Intergenic
1177157287 21:17512757-17512779 TTAGCTTAAGGGATGGAGGCGGG + Exonic
1178838981 21:36123412-36123434 ATTTCTTACGGTCTGGAGGCTGG + Intergenic
1179864264 21:44207574-44207596 CTCCCTCCAGGGCTGGGGGCAGG + Intergenic
1180018653 21:45104665-45104687 CCCTGTGAAGGGCTGGAAGCAGG + Intronic
1180856358 22:19048383-19048405 CCCTATTTGGGGCTGGAGGCTGG - Intronic
1181882717 22:25993680-25993702 CTCTCTTAAGGGCTGGAGGCAGG + Intronic
1184296633 22:43529222-43529244 CTCCCTGAGGGGCTGAAGGCTGG + Intronic
1184341084 22:43886302-43886324 CTCTCACCAGAGCTGGAGGCTGG - Exonic
1184790429 22:46696447-46696469 CTCTCTCAAGTGCAGGGGGCAGG + Intronic
1185129963 22:49033281-49033303 CTGTCTCCAGGGCTGGAGCCAGG - Intergenic
1185294554 22:50046781-50046803 CTTTGTGCAGGGCTGGAGGCCGG + Intronic
952267756 3:31802656-31802678 CCCTACTAAGAGCTGGAGGCAGG - Intronic
954249896 3:49359096-49359118 CTCTCTCCAGGGCTGGGGGTAGG - Intergenic
954326528 3:49867097-49867119 CTCTCTCAAGGGCTGGGGCTGGG + Intronic
956539811 3:70323901-70323923 ACTTCATAAGGGCTGGAGGCAGG + Intergenic
959596297 3:108132554-108132576 AACTCCTAAGAGCTGGAGGCAGG + Intergenic
959892820 3:111575650-111575672 TTCTCTCAAGTTCTGGAGGCTGG + Intronic
960007457 3:112794680-112794702 ATCTCTTATGGGGTGGAGACTGG - Intronic
960999006 3:123359748-123359770 CTGTCTTTAGGGCTGGGGCCAGG - Intronic
961795149 3:129403761-129403783 CTCTCGAAAGGGCTGGAGGCAGG + Intronic
963080544 3:141389284-141389306 CTCTCTAATGGGCTGAAGGGTGG + Intronic
964546883 3:157844116-157844138 TTCTCTTAAGAGGTGGGGGCAGG + Intergenic
966875436 3:184319194-184319216 CTTTGTAAAGGGCTGGAGACAGG + Intronic
966933441 3:184690596-184690618 CCCTATGAAGGCCTGGAGGCTGG - Intergenic
968062692 3:195738431-195738453 CCCTCTCAAGGGATGAAGGCAGG - Intronic
970803893 4:20007267-20007289 CTCTTTTAAGGGCTGGAAGTAGG - Intergenic
971066568 4:23039376-23039398 CTCTATTAAAGACTAGAGGCAGG + Intergenic
972926572 4:44015946-44015968 CTCTCTTTGGGTCTGGAGACAGG - Intergenic
975718643 4:77229236-77229258 CTATGTTAATGGGTGGAGGCAGG - Intronic
981195593 4:141916345-141916367 CTCTCTTAAGGTCTGGATTGGGG + Intergenic
981567477 4:146115982-146116004 CCCTCTCCAGGGCAGGAGGCTGG - Intergenic
985967173 5:3346524-3346546 CTCTCCCACGGGATGGAGGCTGG - Intergenic
987062656 5:14257306-14257328 CTCCCTTAAAGGATGGAGGTGGG - Intronic
992552051 5:77868328-77868350 CTCTCTCAGGGCCTGCAGGCCGG + Intronic
995652964 5:114391931-114391953 CTCTATTTAGGGCTGGAGGAAGG + Intronic
996987447 5:129584442-129584464 CTCTCTTCAGAGCCGCAGGCAGG + Intronic
997465279 5:134083951-134083973 AGCTCATAAGGGCTGGAGCCAGG - Intergenic
998385114 5:141753127-141753149 CTCTGTCAAGGGCTGGGAGCTGG + Intergenic
998386318 5:141759013-141759035 CTGTCTGAGGGGCTGCAGGCTGG - Intergenic
999372786 5:151066325-151066347 CTATTTGGAGGGCTGGAGGCTGG - Intronic
1000879500 5:166680992-166681014 CTCTCTTAAGAGGTGGGAGCAGG - Intergenic
1001283353 5:170404062-170404084 ATCTCTTGTGGGCAGGAGGCAGG + Intronic
1002136341 5:177110164-177110186 CTCTGCAAAGGTCTGGAGGCAGG + Intergenic
1004564629 6:16784520-16784542 TTCTCTCAAGCTCTGGAGGCTGG - Intergenic
1006094646 6:31648395-31648417 CTCTCTTAACTTGTGGAGGCTGG - Intronic
1006831437 6:36970558-36970580 CCCTGGTAATGGCTGGAGGCAGG - Intronic
1010733903 6:79420387-79420409 CTCACTTAACAGTTGGAGGCAGG - Intergenic
1012233836 6:96790047-96790069 CTCTCTTAAGTCCAGGAAGCAGG + Intergenic
1013298621 6:108781958-108781980 CTCTGTGAAGGGCTGGGGGAGGG + Intergenic
1013796915 6:113898550-113898572 CTCTCTTCAGAGTTGGAGGATGG + Intergenic
1015211362 6:130702213-130702235 CTCTCTTCAGAGCCGTAGGCAGG - Intergenic
1018193861 6:161337498-161337520 CCTTCTTAAAGGCTGGAGCCTGG + Intergenic
1024666042 7:51548236-51548258 CTCTCAGAAGGGCTGGAGCTGGG - Intergenic
1025621005 7:63170785-63170807 TTCTCATAACGGCTGGATGCTGG - Intergenic
1026338781 7:69417708-69417730 CGATCTTCAGGGCTGGAGGAGGG + Intergenic
1028567148 7:92246025-92246047 GTCTCTCAGGGGCTGGTGGCAGG + Exonic
1029446685 7:100616970-100616992 CTTTCTGAGGGGCTGGGGGCAGG + Intergenic
1029457629 7:100679048-100679070 CCCTCTGGAGGGCCGGAGGCAGG + Exonic
1029473652 7:100770004-100770026 CTCCCTGAAGGACAGGAGGCTGG + Intronic
1029853562 7:103489958-103489980 CTCTCCCAGAGGCTGGAGGCAGG - Intronic
1031945102 7:127831339-127831361 CTCTCTGAAGGGCTGCAGCTAGG + Intronic
1031997158 7:128240622-128240644 CTCTCTGGAGGGCTCCAGGCGGG - Intergenic
1034745081 7:153516931-153516953 CTCTTATAAAGGCTGGAGACAGG - Intergenic
1035302340 7:157905883-157905905 CTCCCTTATGGGGTGGAGCCTGG + Intronic
1040531139 8:48267350-48267372 TTCTGTTAAGGGCTGGAGACAGG + Intergenic
1042303412 8:67310311-67310333 CGCGGTTAAGGGCTGGAGACCGG - Intronic
1043882783 8:85564218-85564240 CTCTCTTTAGGCCTGAGGGCTGG + Intergenic
1049051483 8:140200377-140200399 CACACTCTAGGGCTGGAGGCAGG - Intronic
1049192625 8:141296978-141297000 CTTTCTCAAGTTCTGGAGGCTGG - Intronic
1049309619 8:141926693-141926715 CTGTCCCAGGGGCTGGAGGCTGG + Intergenic
1049387910 8:142353608-142353630 CTCTCTGCAGGGCTGGGGGTGGG + Intronic
1049867964 8:144950925-144950947 CTCTCTAGATGGCGGGAGGCCGG + Intergenic
1051307933 9:15735763-15735785 CTCTCTGAATCGCTGCAGGCTGG - Intronic
1051448322 9:17165608-17165630 CTCTCATTAAGGCAGGAGGCAGG + Intronic
1052052670 9:23866150-23866172 CTCTCTTCAGAGCTGCAGGCAGG + Intergenic
1052422385 9:28259833-28259855 CTCTAATCAGGGCTGGTGGCTGG - Intronic
1053281598 9:36823733-36823755 TTCTCTCTAGGGCTCGAGGCCGG + Intergenic
1054190497 9:61982851-61982873 CGCTGCTCAGGGCTGGAGGCTGG + Intergenic
1054758517 9:68983217-68983239 CTCTTTTAAAGGCTGGAGGTGGG - Intronic
1054899796 9:70356923-70356945 CTCCTTTAGGGGCTGGGGGCCGG - Intergenic
1057280932 9:93711110-93711132 CTCTGTGCAGGGCTGGAGTCAGG - Intergenic
1059992365 9:119877270-119877292 CTCTCTGAAGGCCTTGTGGCTGG - Intergenic
1061991714 9:134163040-134163062 CTCTCCTAAGGGATGCAGCCAGG + Intergenic
1062017386 9:134297662-134297684 CCCTCTGAGGGGCTGGGGGCTGG - Intergenic
1062715967 9:138010214-138010236 GTCACTCAGGGGCTGGAGGCTGG + Intronic
1186155296 X:6719143-6719165 TTCTCTTATGCTCTGGAGGCTGG + Intergenic
1187093266 X:16119683-16119705 CACACTTAAGGGGTGGAGGTGGG + Intergenic
1187361094 X:18628444-18628466 AGCTGTTAAGGGCTGGAAGCGGG - Exonic
1187410969 X:19050243-19050265 CTCTAGGAAGGGCTGGAGACTGG + Intronic
1190944470 X:55077503-55077525 CTCACTAAAGTGCTGGAAGCAGG + Exonic
1190945714 X:55091436-55091458 CTCACTAAAGTGCTGGAAGCAGG + Exonic
1192078334 X:68022815-68022837 CTCTATTAAGAGCTGTAGCCAGG - Intergenic
1194645868 X:96457375-96457397 TTCTCTTATAGTCTGGAGGCTGG - Intergenic
1194975996 X:100396492-100396514 CTCCCCAAGGGGCTGGAGGCAGG - Intronic
1195948240 X:110238641-110238663 CTCTCTTCAGAGCTGGCAGCAGG - Intronic
1196545596 X:116961483-116961505 CTCTCTTAAAGCCTGTCGGCTGG + Intergenic
1200018450 X:153182362-153182384 CTCTCGTCAGGGCAGCAGGCAGG - Exonic
1200104406 X:153704316-153704338 CTCTCAGAGGGGCTGGAAGCAGG + Intronic
1201359088 Y:13127027-13127049 CTCTCTTCAGAGCTGGAAGGTGG + Intergenic