ID: 1181887193

View in Genome Browser
Species Human (GRCh38)
Location 22:26030672-26030694
Sequence CTGGGATTCCAGAGAGTTGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 249}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181887188_1181887193 -2 Left 1181887188 22:26030651-26030673 CCTTCTCTATGGCCTTGCTACCT 0: 1
1: 0
2: 1
3: 21
4: 219
Right 1181887193 22:26030672-26030694 CTGGGATTCCAGAGAGTTGATGG 0: 1
1: 0
2: 0
3: 32
4: 249
1181887186_1181887193 12 Left 1181887186 22:26030637-26030659 CCTGGGCATCTGTGCCTTCTCTA 0: 1
1: 0
2: 0
3: 25
4: 275
Right 1181887193 22:26030672-26030694 CTGGGATTCCAGAGAGTTGATGG 0: 1
1: 0
2: 0
3: 32
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181887193 Original CRISPR CTGGGATTCCAGAGAGTTGA TGG Exonic
900546093 1:3230065-3230087 CAGGGATCCCAGAGAGCTGCAGG - Intronic
901038551 1:6350546-6350568 TTGGGATTCCAGAGATTTCGTGG - Intronic
901870282 1:12134823-12134845 CTGGTATTCCAGAGAATTCGGGG + Intronic
902272928 1:15317524-15317546 CAGGGTTTCAAGTGAGTTGATGG + Intronic
904316721 1:29670656-29670678 CTGTGGTCCCAGAGAGGTGAAGG + Intergenic
904350067 1:29899263-29899285 CTGGGCTTCCCCAGAGTAGAGGG + Intergenic
905788498 1:40776676-40776698 CTGGGAGTTCACAGAGATGATGG - Intergenic
906415100 1:45615555-45615577 CTTGGTTTCCAGGGAGTTGGTGG + Intronic
907458916 1:54593786-54593808 CTGGGAGGCCAGAGATCTGAGGG - Intronic
907613057 1:55892312-55892334 CTGGGATTCAAGAGTGTGGTTGG + Intergenic
907749573 1:57249492-57249514 CTGGAATTCCAGATACTTGCGGG - Intronic
908129271 1:61058449-61058471 GTGGGATTCCAAAGACTTGAGGG + Intronic
910065760 1:83148697-83148719 CTGGAATTGCAGAGAGATCAAGG + Intergenic
912957243 1:114164189-114164211 CTGGGATTCCTGAGGGTCCAGGG - Intergenic
913658470 1:120984138-120984160 CTAGTGATCCAGAGAGTTGAGGG - Intergenic
914009837 1:143767247-143767269 CTAGTGATCCAGAGAGTTGAGGG - Intergenic
914648457 1:149675908-149675930 CTAGTGATCCAGAGAGTTGAGGG - Intergenic
914736866 1:150426175-150426197 CTGGGATTCAGGAGAGCTGGTGG - Intronic
915930938 1:160060680-160060702 TTGGGATCCCAGAGACTTGAGGG - Intronic
920963069 1:210681206-210681228 ATGGGATTCCAGATATTTTACGG + Exonic
923677429 1:236092124-236092146 CTGGAATACAAGAGAGCTGATGG - Intergenic
924464802 1:244290362-244290384 CTGGAATTCCAGAGTGCTGGGGG - Intergenic
924493070 1:244558917-244558939 CTGAGAATCCAGAGTGTGGATGG + Intronic
1063131001 10:3176592-3176614 CTGGGTTTCCAGAAAGTAGGAGG - Intergenic
1064379817 10:14831304-14831326 GTGGGAGTCCAGGGGGTTGAAGG - Intronic
1065376516 10:25048743-25048765 CTGGGAGTCCAGAGAGGCAAGGG + Intronic
1066319192 10:34283284-34283306 CTGGGATTTCAGTGAGTTTCTGG - Intronic
1066337450 10:34493397-34493419 CAGGAATTTCTGAGAGTTGATGG + Intronic
1067559830 10:47297348-47297370 CTAGGATTCCAGAGAGGCAATGG + Intergenic
1068578412 10:58710437-58710459 CAGAGATTACAGAGATTTGAAGG + Intronic
1068647364 10:59482418-59482440 CTGCAAGTCCAGAGAGTTGATGG + Intergenic
1068818853 10:61349748-61349770 CTGGGATTAGATAGTGTTGATGG + Intergenic
1070582358 10:77731798-77731820 CTGGGATTCAGGAGACTTGTCGG - Intergenic
1071619449 10:87105840-87105862 CTGGGGTCTAAGAGAGTTGAAGG - Intronic
1071858051 10:89645318-89645340 CTGGGCTTGCAGAGAGGAGATGG + Exonic
1072188596 10:93063353-93063375 CTGGGCTTCCGAAGAGGTGATGG - Intronic
1073446238 10:103582239-103582261 CTGGAATCCCAGAGGGGTGAGGG + Intronic
1074890880 10:117735732-117735754 CTGGGAGGCCAGAGAGGTTAAGG - Intergenic
1076438397 10:130462317-130462339 CTGGGATGCCAGGAAGTTGGAGG + Intergenic
1077032727 11:476949-476971 TTGTGACTGCAGAGAGTTGAGGG - Intronic
1078024831 11:7685113-7685135 CTGGGTTTCCAGTGACTTGGTGG + Intergenic
1078509338 11:11973989-11974011 CTGGGATTCCTGAGAAGTGTGGG - Intronic
1079019311 11:16896120-16896142 CTGGGACTCTAGAGAGTGGACGG - Intronic
1079679208 11:23272562-23272584 CTAGGATGCCAGAGAATTGAAGG + Intergenic
1080201965 11:29682443-29682465 CTGAGATTCCTGAGAATTAATGG + Intergenic
1080414239 11:32054716-32054738 CTTGGATTCCAGGGAGTCCAGGG + Intronic
1082889691 11:58125677-58125699 CTGGGACTCCAGAGAATAGCCGG + Intronic
1083832743 11:65243330-65243352 CTGGGATTACAGAGAGGAGAAGG + Intergenic
1084526876 11:69703512-69703534 CTGGGGTTCCCAGGAGTTGAGGG + Intronic
1086771214 11:90769984-90770006 CAGGGACTCCAGGAAGTTGAGGG - Intergenic
1087791842 11:102414215-102414237 CAGGGATGCCAGTGAGTTGTAGG - Intronic
1087828280 11:102791132-102791154 CTGGGAATCCAGAGAATGTAGGG - Intronic
1087943984 11:104135948-104135970 CCAGGCTTCCAGAGAGTTAATGG - Intronic
1088475636 11:110235885-110235907 CTGGGGGACCAGAGAGTTGTCGG - Intronic
1088617196 11:111642673-111642695 CTGGGAATCTAGAGAGGGGATGG - Intronic
1089261319 11:117225774-117225796 CTGGGAATCTAGAGAAATGAAGG + Intronic
1089524881 11:119090348-119090370 CTGGGAGTCCGGAGAGTGGAAGG + Intronic
1089547044 11:119236145-119236167 CTGGAATTACAGAGGGGTGATGG - Intronic
1090719583 11:129459378-129459400 CTGGGCTGCCAGAGAGCAGACGG + Intergenic
1101345614 12:103883327-103883349 GTGGCATTCCAGAGAGAGGAGGG - Intergenic
1106125646 13:26898153-26898175 CTGGGATTCCGAGGGGTTGAGGG + Intergenic
1108376000 13:49814757-49814779 CTGGCCTCCCAGAGAGGTGAGGG - Intergenic
1109815522 13:67577646-67577668 CTTAGCTTCCAGAGAGTTGTGGG + Intergenic
1114403659 14:22433683-22433705 CTGGGATAACAGAGAAATGAAGG - Intergenic
1116118916 14:40695903-40695925 CTTGAATTCCAAAGAGTGGAGGG + Intergenic
1117730485 14:58717077-58717099 CTGGGATGCCAGACTGTTGCTGG - Intergenic
1120173962 14:81274012-81274034 CCGGGAACCCAGAGAATTGATGG - Intronic
1122104030 14:99437520-99437542 CTGGGATTGCAGAGAGGTGCTGG - Intronic
1122217720 14:100214766-100214788 CTGGGATCACAGGGAGTTGATGG + Intergenic
1125750087 15:42021959-42021981 CTGGCCTTCCAGAAAGTGGAGGG + Intronic
1126753834 15:51904939-51904961 CTGGGAGTCTAGAGAGTTCCCGG - Intronic
1127375420 15:58380294-58380316 CTGAGAATCGAGAGAGTAGATGG + Intronic
1127422091 15:58816207-58816229 CTGGGATTCAGGAGAATGGAAGG + Intronic
1127683610 15:61320564-61320586 CTGGAATTCCCGTGAGTTGTGGG - Intergenic
1130674129 15:85937396-85937418 CTGAGATTTCAGGGAGCTGATGG + Intergenic
1132770003 16:1556529-1556551 CTGGCCTTCTAGCGAGTTGAGGG + Intronic
1133313184 16:4864523-4864545 CAGGGAATCCAGTGATTTGATGG + Intronic
1133622440 16:7539373-7539395 CTGGGAATAGAGAGAGATGAGGG - Intronic
1138983607 16:62299939-62299961 CAGGCACTCCAGAGAGCTGATGG - Intergenic
1139305964 16:65986649-65986671 TTGGCATTACAGAGAGCTGAAGG + Intergenic
1140970119 16:80004531-80004553 CTGGAATTACAGAGACATGAAGG - Intergenic
1143729773 17:8874460-8874482 CTGGGATGCCAGGGACTTCAAGG + Intergenic
1144016919 17:11204981-11205003 CTGGTATTTCAGAAAGTGGATGG - Intergenic
1148063625 17:44853177-44853199 CGGGGTTTCCAGAGAGAGGAGGG + Intronic
1151329846 17:73400333-73400355 CTTGGATTCCAGCGTGTGGAAGG - Intronic
1152263431 17:79279415-79279437 CTGAGATTCCAGTGGGTGGAGGG + Intronic
1152343623 17:79738532-79738554 GTGGGCTTCCAGAGAGTTCCAGG - Intronic
1152343638 17:79738607-79738629 GTGGGCTTCCAGAGAGTTCCAGG - Intronic
1152343656 17:79738682-79738704 GTGGGCTTCCAGAGAGTTCCAGG - Intronic
1152561063 17:81079032-81079054 CTGGGATTCCAGAAAGGAGCTGG + Intronic
1152828695 17:82483965-82483987 CAGGGCTGCCAGGGAGTTGAAGG + Intronic
1154946011 18:21161950-21161972 CTGGGTTTCCAGCTAGTAGATGG - Intergenic
1155608315 18:27633478-27633500 ATGGGGTTTCAAAGAGTTGAGGG + Intergenic
1155749504 18:29403490-29403512 GTGGCATTCAAGAGATTTGAAGG - Intergenic
1157404065 18:47408949-47408971 CATGGACTCCAGAGAGGTGAGGG + Intergenic
1158536324 18:58311442-58311464 CTGGGAGCCCAGGGGGTTGAGGG - Intronic
1158735445 18:60074528-60074550 CTGGGAATCAGGAGAGCTGATGG - Intergenic
1159405046 18:67990354-67990376 CTGGTAATCCAGAGTGTTTATGG + Intergenic
1159729574 18:72008494-72008516 CTGAGATCCAAGAGAGTTGATGG - Intergenic
1159880068 18:73850721-73850743 CTGTGATCCGAGAGAGTTAATGG - Intergenic
1159957616 18:74530773-74530795 GTGGGGTTATAGAGAGTTGAAGG + Intergenic
1161847425 19:6719711-6719733 CTGGAAGTCCAGAGACTTGGAGG - Intronic
1162490539 19:10988680-10988702 CTGCAATTCCAGAGAGTGGCTGG - Intronic
1162648123 19:12064894-12064916 CTGGGAGTCCCGAGACTTGGGGG + Intronic
1162909380 19:13841173-13841195 CTGGGATTGCAGATAGATGGGGG + Intergenic
1163941463 19:20498781-20498803 CTGCTATTCCAGAGACTTGGAGG - Intergenic
1163959972 19:20680352-20680374 CTGCCATTCCAGAGACCTGAAGG - Intronic
1164691726 19:30215813-30215835 CTGGGGTTCCCTAGAGCTGAAGG + Intergenic
1165091956 19:33392360-33392382 CTGGGATTCCACAGAGTCCGGGG - Intronic
1166147399 19:40847052-40847074 CTGGGGTTGCAGAGAGAGGATGG + Intronic
1166151548 19:40878937-40878959 CTGGGGTTGCAGAGAGAGGATGG + Intronic
1166170420 19:41024441-41024463 CTGGGGTTGCAGAGAGAGGATGG + Intergenic
1166178639 19:41091709-41091731 CTGGGGTTGCAGAGAGAGGATGG - Intronic
1167244438 19:48365061-48365083 GGAGGATTCCAGAGAGGTGAGGG - Intronic
1167771548 19:51523370-51523392 CTGGGATCCCAGAAAGGGGAAGG + Intronic
1167958888 19:53090281-53090303 CTGGGTCTCCAGAGAGATGAAGG - Intronic
1168045469 19:53791151-53791173 CTGGGATTGCAGAAAGCTTAAGG + Intergenic
1168642315 19:58038543-58038565 CTAGGATTCCTGAGTGTTGCAGG - Intronic
925182742 2:1827471-1827493 AGGGGATCTCAGAGAGTTGAGGG + Intronic
926013355 2:9425834-9425856 CTGGAATTAGAGAGAGGTGATGG - Intronic
927250628 2:20992235-20992257 CTGGCCTCCCAGAGAGCTGAGGG + Intergenic
927427613 2:22998189-22998211 CTGAGATGGCAGAGAGTTCATGG + Intergenic
927975561 2:27335837-27335859 CTGGGAATTCTTAGAGTTGAAGG - Intronic
930062151 2:47299136-47299158 CTGAGATTCGAGACAATTGAAGG - Intergenic
932451221 2:71812006-71812028 CTGGGAATCCAGCAAGTGGAAGG + Intergenic
933144311 2:78832645-78832667 ATGGGATTCTAGTGAGTTGTTGG - Intergenic
933691483 2:85182366-85182388 CTGGGGTGCCAGGGAGCTGAGGG + Intronic
935061805 2:99615214-99615236 CTGGGAGTCCAGATGGTAGAGGG + Intronic
936149581 2:110007832-110007854 CTGGGATTCAGGAGACTTGTCGG - Intergenic
936195097 2:110363537-110363559 CTGGGATTCAGGAGACTTGTCGG + Intergenic
937432489 2:121851120-121851142 TTGGGCTTCCAGAGAGTTCCTGG - Intergenic
938772006 2:134508744-134508766 CTGGAGTTCAGGAGAGTTGAGGG - Intronic
939836000 2:147130652-147130674 CTGAGATTTCAGAGACTTGAGGG + Intergenic
942035129 2:172003342-172003364 CTGGGATTCCAGTGAAGCGAGGG - Intronic
944376459 2:199049809-199049831 CAGGGATACCAGAGACTTGTGGG + Intergenic
944863874 2:203841449-203841471 CAGGGCTTCCAGAGGGTGGAGGG + Intergenic
946064302 2:216973520-216973542 TTGGGATTCCAGATTGTTGCTGG + Intergenic
946272852 2:218608653-218608675 CTGTGATACGAGAGAGTTTAGGG + Intronic
948045486 2:234940556-234940578 CTGGGAGGGCAGAGAGTGGAGGG - Intergenic
948496456 2:238352917-238352939 CTGACATTTCAGAGAGCTGAGGG - Exonic
1169593531 20:7172032-7172054 CTTGGATTCCAGGGAGGGGAAGG - Intergenic
1170539251 20:17371327-17371349 CTGGGGTTCCAGTGAGCTGCAGG + Intronic
1170572823 20:17642047-17642069 CTGGGACTCCAGATACTTGTGGG + Intronic
1174891694 20:54402230-54402252 CTGTGGGTCCACAGAGTTGAAGG + Intergenic
1177229754 21:18304463-18304485 CATGGATTCCAAAGAGGTGAAGG - Intronic
1178025256 21:28459111-28459133 GTGGGATTCCAGAGAGCTAAAGG + Intergenic
1178107549 21:29336996-29337018 CTGTGATTCCAAAGAGTGGGAGG - Intronic
1178243126 21:30925530-30925552 CTGGAATACCAGGGAGTAGAGGG + Intergenic
1178901598 21:36603391-36603413 CTGGGTTTCCTGAGTCTTGAAGG + Intergenic
1180057189 21:45365068-45365090 CTGGGACCCCAGAGAGTAGGAGG - Intergenic
1180583173 22:16860533-16860555 CTGGGATTCAGGAGACTTGGTGG + Intergenic
1181887193 22:26030672-26030694 CTGGGATTCCAGAGAGTTGATGG + Exonic
1182499142 22:30732871-30732893 CTGTGATTCCAGTGAATTTATGG + Intronic
1183742682 22:39677555-39677577 CTGGGAGACCAGACAGCTGAGGG - Intronic
1183996115 22:41633756-41633778 CTGTAATTTCAGAGAGTTAATGG + Intronic
1184949909 22:47833922-47833944 CTGAGATTGCAGAGAGGAGACGG + Intergenic
949772714 3:7596364-7596386 CTGGAATTCAAGAGAGATGCTGG + Intronic
950196265 3:11011222-11011244 CTGCCAGTCCAGAGAGATGATGG - Intronic
952719639 3:36519025-36519047 CTGGGATTCCAGAAGGAAGAGGG + Intronic
952738768 3:36715862-36715884 CTGCGATTCCAGAGAAATGAAGG - Intronic
955922431 3:63971461-63971483 CTGGGACTACAAAGAGTGGATGG + Intronic
955928749 3:64034107-64034129 CTGGGCTTCCAGAGAGCTAAAGG - Intergenic
956738707 3:72258672-72258694 CTGGGTTTGCAGTGTGTTGAGGG - Intergenic
958457529 3:94350032-94350054 CTGGGATGCAAGATAGTTGAGGG - Intergenic
958643132 3:96834616-96834638 CTGGGATTCAATAGAGGAGATGG + Intronic
960787929 3:121394870-121394892 CTGGGATTACAGGCTGTTGAGGG + Intronic
962120303 3:132554080-132554102 CTGGGATTCTAGTGAATTGATGG - Intergenic
962123978 3:132595097-132595119 CTGGGAGTCCAGATGGATGAGGG + Intronic
962378594 3:134878568-134878590 CTTGGCTTCCAGGGAGCTGATGG + Intronic
963708759 3:148721686-148721708 CTGGGAGTCCAGAGAGGCCAAGG + Intronic
965473920 3:169130623-169130645 CTGGGATGCTAAAGAGATGAAGG + Intronic
965782005 3:172296037-172296059 CTGGGAGTCCACAGAGCAGAAGG - Intronic
966242087 3:177766031-177766053 CAGGGATGCCATGGAGTTGAAGG + Intergenic
967046825 3:185745205-185745227 TTAGGATTGCAGAGAGTTCATGG - Intronic
967052398 3:185796987-185797009 CTGGGAGGCCTGAGAGTGGATGG - Intronic
967340594 3:188392921-188392943 TTGGGGTTACACAGAGTTGAGGG - Intronic
967515041 3:190358214-190358236 CTGGGCTTACAGAAATTTGAGGG - Intronic
967531869 3:190557246-190557268 CTGGGTTTTCAGTGAGTGGAAGG - Intronic
967895245 3:194390106-194390128 CTGGGGTTCCATTGAGTAGACGG - Intergenic
968754705 4:2409294-2409316 CGGGGATTCCAGCGAGAGGATGG - Intronic
969392863 4:6902434-6902456 CAGGGATTCCAGAGAGTTTCGGG + Intergenic
969967566 4:11012975-11012997 CTGGAGTTCCACAGAGTTGGTGG + Intergenic
970960395 4:21864575-21864597 CTGGGATTCCAGAAAATAAAAGG + Intronic
973764485 4:54150668-54150690 CTGGAATTCGATAGAGGTGATGG + Intronic
976351148 4:84061235-84061257 CTGAGATTCCAGACAATTGGAGG + Intergenic
976990711 4:91361596-91361618 TTGGGATTTCAAAGAGTGGAGGG + Intronic
977997549 4:103513643-103513665 CTGGGATGCCAGTGAGTTGTAGG + Intergenic
981701189 4:147609056-147609078 ATGGGATTCCAGAGAGGTAGAGG - Intergenic
982139857 4:152306751-152306773 CTGGGATTTCAGAGGGTGGGAGG - Intergenic
983552703 4:169033590-169033612 CTGGAATTAAAGAGAGGTGATGG + Intergenic
985648819 5:1098140-1098162 CTGGGCTTGCAGAGGGTTGTGGG - Intronic
985648864 5:1098274-1098296 CTGGGCTTGCAGAGGGTTGTGGG - Intronic
986020097 5:3793806-3793828 CTGGGGTTCCCCAGAGTGGAAGG - Intergenic
986830175 5:11568279-11568301 CTGAGAGTCCAGGGAGTTCATGG - Intronic
986963832 5:13246231-13246253 ATGGGATTGCAGAAACTTGAAGG - Intergenic
988866624 5:35342290-35342312 CTGGATTTCCAGAGAGATGTTGG + Intergenic
990029554 5:51240407-51240429 CTGGGATACGGGAGAGGTGAGGG + Intergenic
991290177 5:65025986-65026008 CTGAGATTACAAAGAATTGAGGG + Intergenic
993149996 5:84149127-84149149 CTGGGAGTCTGGAGAGTCGACGG + Intronic
994816897 5:104596364-104596386 CTGGGATTCGAGTGAGATGAAGG - Intergenic
995254254 5:110028390-110028412 CTTTGATTCCAAAGAGTTTAAGG - Intergenic
995313240 5:110738143-110738165 CTGGGCTTCCAACGAGTTGAAGG + Intronic
995412266 5:111872169-111872191 CTGGAGACCCAGAGAGTTGATGG + Intronic
995871502 5:116748249-116748271 CTGGCATTCCAGGTAGGTGATGG - Intergenic
996292390 5:121867438-121867460 CTGGGAATGCTGACAGTTGATGG + Intergenic
997238450 5:132289460-132289482 CTGGAATTGCAGAGACTAGATGG + Intronic
997335633 5:133107242-133107264 CTGTGATTCCAGATACTTGGGGG + Intergenic
998610519 5:143683248-143683270 CTGGCTTTCCAGAGATTTAAAGG + Intergenic
999706274 5:154275068-154275090 GTGGTAGTCCAGAGAGGTGAAGG - Intronic
1000962981 5:167622266-167622288 CTTGGATTTCAGAGGTTTGATGG - Intronic
1001779824 5:174358243-174358265 CTGGGATTCAGGGCAGTTGAGGG - Intergenic
1002261961 5:177999504-177999526 CTGGGAGTCCAGAGCTGTGAAGG - Intergenic
1003950846 6:11114246-11114268 TTGGGATTACAGGCAGTTGAAGG + Intronic
1004956769 6:20736010-20736032 CTTGCATTTCAGAGATTTGATGG + Intronic
1006256444 6:32836251-32836273 CTGGGGCTCCAGAGAATTGTGGG - Intronic
1007788399 6:44295199-44295221 CTGACATTCCAGAGAGGTCAGGG + Intronic
1008713658 6:54261871-54261893 CTTGGATTGCTGAGAGTTGAAGG + Intronic
1010752895 6:79634657-79634679 CTGGGAAGCCAGAGAATAGAGGG + Intronic
1011003988 6:82623147-82623169 TTGGGGTTCAACAGAGTTGAGGG + Intergenic
1011010181 6:82694938-82694960 CTGGGAATCCAGAGTGTAGGAGG + Intergenic
1011686794 6:89830024-89830046 CTGGGAAACCAGAGAGTCGGAGG + Exonic
1014841307 6:126223782-126223804 CAGGGACTCCAAAGAGTTGTAGG + Intergenic
1016015804 6:139184794-139184816 CTGGTATCCCAGACTGTTGAGGG + Intergenic
1018032499 6:159852904-159852926 ATGGGATTCCAGAGAGTGCAAGG + Intergenic
1018948551 6:168364001-168364023 CTGGGACCCCACAGAGCTGATGG + Intergenic
1020292819 7:6735545-6735567 CTGGGATTACAGGGCGTGGACGG - Intergenic
1020504322 7:8964428-8964450 GTGGCATTCCTGAAAGTTGAAGG + Intergenic
1021925764 7:25532194-25532216 CAGGGATTCAAGAGCTTTGAAGG - Intergenic
1022380527 7:29855082-29855104 CTGGGACTTCATAGAGCTGAGGG - Intronic
1024208306 7:47182612-47182634 CTGGGGTTCCAGTGAGTCGTGGG - Intergenic
1024673184 7:51615269-51615291 CTGGCATTCCTGAGAGCTCATGG + Intergenic
1028904241 7:96135316-96135338 CTGGGGTGCAAGAGAGGTGAAGG - Intronic
1035742490 8:1938889-1938911 CTGGGATTCCACAGTGTTTGGGG - Intronic
1035742499 8:1938922-1938944 CTGGGATTCCACAGTGTTCAGGG - Intronic
1035742526 8:1939021-1939043 CTGGTATTCCAGAGTGTTCAGGG - Intronic
1035742533 8:1939054-1939076 CTGAGATTCCACAGTGTTCAGGG - Intronic
1035742540 8:1939088-1939110 CTGGGATTCCACAGTGTTCAGGG - Intronic
1035757070 8:2042610-2042632 CTGGGGTTCCACAGGATTGAAGG + Intergenic
1036223646 8:6940868-6940890 CTGGCATCCCAGAGAGCTGCTGG - Intergenic
1038058744 8:23887697-23887719 CCAGGATCCCAGAGAGCTGACGG - Intergenic
1039893399 8:41699369-41699391 CAGGGATTCCAGAGGGAGGAAGG - Intronic
1040356776 8:46625976-46625998 ACTGGAGTCCAGAGAGTTGAGGG + Intergenic
1040876658 8:52159453-52159475 CAGGGACTACAGAGAGTTTAAGG + Intronic
1041395379 8:57384793-57384815 CTGGGATTCCAGTAAGTTCCAGG - Intergenic
1043613072 8:82090572-82090594 CTAGTAATCCAGAGATTTGATGG + Intergenic
1043613367 8:82093372-82093394 CTAGTAATCCAGAGATTTGATGG + Intergenic
1045055923 8:98368420-98368442 TTAGGATTGCAGAGATTTGAAGG + Intergenic
1047320785 8:123780035-123780057 CTAGTGATCCAGAGAGTTGAGGG - Exonic
1048263988 8:132969123-132969145 GTGGGATTCCAGAGGGCAGATGG + Intronic
1048596154 8:135868617-135868639 CTGGGGTTACTGACAGTTGAGGG + Intergenic
1050684237 9:8148807-8148829 CTGGGATGCCAATGAGTTGTAGG - Intergenic
1052077217 9:24158109-24158131 CTTGGATGGCAGAGAGTTGAAGG - Intergenic
1053323339 9:37119948-37119970 CTAGAATTCCAGAGAGTTGGAGG + Intergenic
1053420194 9:37972445-37972467 CTGGGGCTCCAGAAAGGTGATGG + Intronic
1054961269 9:70972535-70972557 CTGGAATTCGAGAGTGATGAGGG + Intronic
1055909595 9:81332978-81333000 CTGGGATTACACAGTGGTGATGG + Intergenic
1057699818 9:97355790-97355812 TGGGGATTCCAGAGGCTTGAGGG + Intronic
1058786697 9:108394891-108394913 CTGGGATTCCAGAGCCTGGCTGG - Intergenic
1058824795 9:108765611-108765633 ATGGGATTCCGAAGTGTTGAAGG + Intergenic
1059696749 9:116737010-116737032 CTGAGCTTCCAGAAAGTAGAGGG + Intronic
1059818957 9:117950477-117950499 CTAGGATTCCAGTGATTTTAAGG - Intergenic
1060965612 9:127710881-127710903 CTGGGATTCCAAGGAGTAGCAGG - Intronic
1061675606 9:132214012-132214034 CGGGGATTTCAGAGTGTTCACGG - Intronic
1061714400 9:132509851-132509873 CTGGGCTTCCTGGGAGTGGAAGG - Intronic
1185449897 X:276373-276395 CTGGGATTCCAGCGGCTGGAAGG + Intronic
1185998237 X:4977726-4977748 CTGAGACCCAAGAGAGTTGATGG + Intergenic
1187357251 X:18588530-18588552 CTTGGATTCCCCAGATTTGAAGG + Intronic
1188245479 X:27831758-27831780 CTGGGATCACAGAGAGATGAGGG + Intergenic
1189241307 X:39526649-39526671 CTGGGATCCTTGAGAGATGAGGG + Intergenic
1189614384 X:42768630-42768652 CTGGGATTCGGGTGAGTTGAAGG - Intergenic
1193235399 X:79100555-79100577 CTGAGATCCAAGAGAGCTGATGG - Intergenic
1195029422 X:100911886-100911908 CTGGGAATGCAGAGAGTTTAGGG - Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200697963 Y:6377716-6377738 CAGGGATTCCAGAGAGCAAAAGG - Intergenic
1200700945 Y:6402080-6402102 CAGGGATTTCAGAGAGTAAAAGG - Intergenic
1200932177 Y:8706951-8706973 CAGGAATTTCAGAGAGTGGAAGG - Intergenic
1201033167 Y:9762618-9762640 CAGGGATTTCAGAGAGTAAAAGG + Intergenic
1201036149 Y:9786983-9787005 CAGGGATTCCAGAGAGCAAAAGG + Intergenic
1201677567 Y:16604273-16604295 CTGAGACTCAAGAGAGTTGATGG - Intergenic
1202175753 Y:22097537-22097559 CAGGGATTTCAGAGAGTAAAAGG - Intergenic
1202215608 Y:22488846-22488868 CAGGGATTTCAGAGAGTAAAAGG + Intergenic