ID: 1181890340

View in Genome Browser
Species Human (GRCh38)
Location 22:26057157-26057179
Sequence CCTAGGGCCCCTTGTTCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 83}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181890331_1181890340 20 Left 1181890331 22:26057114-26057136 CCTTTTCCACATCAGAAGACTCT 0: 1
1: 0
2: 2
3: 27
4: 212
Right 1181890340 22:26057157-26057179 CCTAGGGCCCCTTGTTCTAAAGG 0: 1
1: 0
2: 1
3: 7
4: 83
1181890332_1181890340 14 Left 1181890332 22:26057120-26057142 CCACATCAGAAGACTCTTTGATA 0: 1
1: 0
2: 1
3: 9
4: 140
Right 1181890340 22:26057157-26057179 CCTAGGGCCCCTTGTTCTAAAGG 0: 1
1: 0
2: 1
3: 7
4: 83
1181890329_1181890340 25 Left 1181890329 22:26057109-26057131 CCCGGCCTTTTCCACATCAGAAG 0: 1
1: 0
2: 2
3: 10
4: 175
Right 1181890340 22:26057157-26057179 CCTAGGGCCCCTTGTTCTAAAGG 0: 1
1: 0
2: 1
3: 7
4: 83
1181890330_1181890340 24 Left 1181890330 22:26057110-26057132 CCGGCCTTTTCCACATCAGAAGA 0: 1
1: 0
2: 1
3: 17
4: 240
Right 1181890340 22:26057157-26057179 CCTAGGGCCCCTTGTTCTAAAGG 0: 1
1: 0
2: 1
3: 7
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181890340 Original CRISPR CCTAGGGCCCCTTGTTCTAA AGG Intergenic
903922821 1:26813235-26813257 CCTAGAGCCCCTTGATTGAAAGG + Intergenic
904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG + Intronic
906660094 1:47575813-47575835 CCTAGGGCCCCCTGCACTGATGG + Intergenic
907869026 1:58426185-58426207 CCTAGGGCCCCATGGTAAAATGG + Intronic
910399816 1:86827303-86827325 CCTTGGGCCTCTTTTTATAAGGG - Intergenic
918059723 1:181050511-181050533 CCAAGGGCACCTTGTTTTTAGGG + Intronic
920367405 1:205455420-205455442 CCTGGGGCCCTCTGTTCCAAGGG + Intronic
922483859 1:225958223-225958245 CCTTTGGCCCCTTAATCTAATGG + Intergenic
924249180 1:242114498-242114520 AATAGGGACCCTTGTTCTATAGG - Intronic
1076703718 10:132289727-132289749 TCTGGGGTCCCTTGTTATAAAGG + Intronic
1085804710 11:79624638-79624660 CATAGGCCCCCAAGTTCTAATGG + Intergenic
1090938683 11:131368625-131368647 CCCAGGGCCCCTTCCTCTCAAGG + Intergenic
1091020368 11:132094338-132094360 CCTAGGGCACCTTGCTCTTGTGG + Intronic
1093539461 12:20264553-20264575 CCTAGGGCCCATTGTTTTTGTGG + Intergenic
1095628347 12:44344420-44344442 CATGGAGCCCCTTGTTCAAAAGG - Intronic
1097612559 12:61842323-61842345 ACTAAGCGCCCTTGTTCTAAAGG + Intronic
1098758154 12:74390489-74390511 CCTGGGGCCCCTTGTTAACATGG - Intergenic
1104514774 12:129414947-129414969 CCTAGAGCACATTGTGCTAAGGG - Intronic
1114188669 14:20423827-20423849 CTTAGGGCTCCTTGATCTCAAGG + Intergenic
1115175993 14:30562470-30562492 CAGAGGGCTCCTTGTTCTAGCGG + Intronic
1115864062 14:37723239-37723261 CCCAGGGCTCCTTGTTGAAATGG - Intronic
1120308947 14:82805859-82805881 CCTATCACCTCTTGTTCTAAGGG + Intergenic
1121798644 14:96755522-96755544 CCTGGGGCCCGTGGTTCTGATGG + Intergenic
1129923225 15:79338784-79338806 CAGAGGGCTCCTTGGTCTAACGG + Intronic
1132874655 16:2130964-2130986 CTCAGGGCCCCCTGCTCTAAAGG - Intronic
1132879843 16:2157261-2157283 CCTCGGGCCCCGTGTCCTGAGGG + Intronic
1134553597 16:15149797-15149819 CTCAGGGCCCCCTGCTCTAAAGG - Intergenic
1152683795 17:81683860-81683882 CTTAGGGCTCATTGTTCCAAGGG + Exonic
1153168808 18:2292340-2292362 CCAAGGGCCCCAGGTTGTAAAGG - Intergenic
1154999481 18:21672911-21672933 CCTGGGGCCCTTTGTTTTATGGG - Intronic
1158326780 18:56321362-56321384 CCTATTGCCTCTTGTTCAAAAGG + Intergenic
1158521052 18:58171516-58171538 CCTACGGCCCCTTGTCTTAGCGG + Intronic
1161129180 19:2578272-2578294 CCGAGGGCCCCCGGCTCTAACGG - Intronic
1162419156 19:10556051-10556073 CCTAGGCCCCCTGGTTCCAGAGG + Intronic
1162775209 19:12975171-12975193 CCCAAGGCCCCTTGCTCGAAGGG + Intergenic
1168247095 19:55117752-55117774 CCAAGGGCCACTTCTGCTAATGG - Intergenic
928833648 2:35518272-35518294 CCTAGGTCCCCTTGTTAACAAGG - Intergenic
929989957 2:46778555-46778577 CCTAGATCCCCTTCCTCTAAAGG + Intergenic
937631680 2:124109115-124109137 CATAAGGCCCCTTGCTCCAAAGG + Intronic
946232756 2:218302773-218302795 CCTTGGGCCACGTGTTCTCAGGG - Intronic
947885733 2:233569225-233569247 CTTATGACCCCTTGATCTAAGGG - Intergenic
948976108 2:241464732-241464754 TCTGGGGAACCTTGTTCTAATGG - Intronic
1169761527 20:9100303-9100325 ACTAGTCTCCCTTGTTCTAATGG + Intronic
1173300235 20:41796058-41796080 CCTAGAGGTCCTGGTTCTAAGGG - Intergenic
1176993202 21:15522554-15522576 CCTTGGGCCTCTTTTTTTAAGGG + Intergenic
1181890340 22:26057157-26057179 CCTAGGGCCCCTTGTTCTAAAGG + Intergenic
1182982819 22:34687581-34687603 GCTAGGGCCCCTAATTCTATAGG + Intergenic
950847456 3:16028740-16028762 CCCAGGGCTCCCTGTTATAAAGG - Intergenic
951398369 3:22200117-22200139 CCTATGGCCCTGTGTTGTAATGG - Intronic
951791610 3:26491657-26491679 CCTGGGGCCCCTTCTTCAAGTGG - Intergenic
954098091 3:48347100-48347122 CATAGGGCCCATTGTTTGAATGG - Intergenic
962829793 3:139130097-139130119 CCTGGGGCCTGATGTTCTAAAGG - Intronic
965125947 3:164629010-164629032 CCTTGAGTCCCTTGTTCTCAAGG + Intergenic
965544732 3:169903890-169903912 CCTGGGGCCCGTTGTTCTCCAGG + Intergenic
968016731 3:195341854-195341876 ACTAGGGGCCCTTATCCTAAAGG + Intronic
971290326 4:25331701-25331723 CATAGGGCCCTTTCTTCTACTGG + Intronic
975312502 4:72918281-72918303 CCTTGGGCCTCTTTTTGTAAGGG + Intergenic
975632240 4:76415760-76415782 CAAAGGGCTCCTTGGTCTAACGG + Intronic
978232691 4:106419632-106419654 TCTAGGGCCCCTTCTTATAAGGG - Intergenic
980966009 4:139521811-139521833 CCTAGGGCATATTCTTCTAATGG - Intronic
980968974 4:139551661-139551683 CGTAGGGTCTCTGGTTCTAAGGG - Intronic
983748336 4:171230200-171230222 GCTAGGGTGCCTTGTTATAAGGG - Intergenic
984248444 4:177303538-177303560 CCTAGGGCCCCCACTTCTGATGG + Intergenic
988113705 5:26855665-26855687 CCTAGGGCCCTTTGAGCTAAGGG + Intergenic
989225710 5:39025713-39025735 CCTGGGGTCCCTTTTTATAAGGG + Intronic
989314927 5:40066994-40067016 CCTGGGGTCCCTTCTTCTACAGG - Intergenic
993468124 5:88272480-88272502 TCTAGGGTCTCTTGTTGTAAAGG - Intergenic
995171315 5:109116147-109116169 CCTTGGCCACCTTGCTCTAATGG + Intronic
995215320 5:109588649-109588671 CCTAGGGTCCCTTCTTCTCCAGG - Intergenic
996345484 5:122483943-122483965 TCTAGGGCCCCTTGTTAAAAAGG - Intergenic
996764319 5:127020548-127020570 CCTAGGGTCTCTTTTTATAAGGG - Intronic
998506093 5:142674074-142674096 CCTGGTGCCCCTTGTTCTACTGG + Intronic
1005752616 6:28897200-28897222 TCTAGGGGCTCTTGTTCTAGTGG - Intergenic
1006130802 6:31868315-31868337 CCTAGGGCTCTGTGTTCCAAGGG + Intronic
1007032409 6:38640097-38640119 CCTGGGGCCCCCTGTTCTGGAGG - Intronic
1013392693 6:109702705-109702727 CAAAGGGCCCCTAGTTCAAATGG - Intronic
1016858434 6:148695000-148695022 CCTAGGCCCTATTGTTCTTATGG - Intergenic
1034053173 7:148005255-148005277 GTTAGGGCCCCTTTTTATAAGGG + Intronic
1035483040 7:159202547-159202569 CTTAGGGCCCCTTGTTCCACTGG - Intergenic
1036977279 8:13427687-13427709 CCTTGGGCCCCTTGTTCTCATGG + Intronic
1038040296 8:23718536-23718558 CCTTGGGTCCCTTGCTCAAAGGG - Intergenic
1045766897 8:105683066-105683088 CCTTGGGCCCCTTTTTATAAGGG + Intronic
1046832015 8:118756664-118756686 CCTCAGGCCCCTAGTTTTAAGGG + Intergenic
1056274101 9:84975915-84975937 CCTATGCCCCCTTGGTCTGAAGG + Intronic
1057739514 9:97699265-97699287 CCTGGGGTCCCTTCTTCTACAGG - Intergenic
1058014582 9:100015995-100016017 TATGGGGACCCTTGTTCTAAAGG + Intronic
1062137449 9:134937208-134937230 CCTTGGTCCTCTTGTCCTAAGGG - Intergenic
1188735689 X:33712175-33712197 ACTAGAGGCCGTTGTTCTAAGGG + Intergenic
1191954159 X:66625620-66625642 TCTAGGGCCCCGTGTACTACTGG + Intronic
1197807957 X:130415594-130415616 CCCAGGGCTCCTTGGTCTATTGG - Intergenic
1199205476 X:145144389-145144411 TCTAGGGCCTCTTTTTATAAGGG - Intergenic
1201707553 Y:16953971-16953993 CATAGGGCTCCTTGTTCTAGTGG + Intergenic