ID: 1181891087

View in Genome Browser
Species Human (GRCh38)
Location 22:26064156-26064178
Sequence CAGAGCACGGAGCATGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 214}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181891084_1181891087 13 Left 1181891084 22:26064120-26064142 CCTGTCTTGTTCATTATTCTATA 0: 1
1: 0
2: 4
3: 53
4: 377
Right 1181891087 22:26064156-26064178 CAGAGCACGGAGCATGAAGCAGG 0: 1
1: 0
2: 0
3: 16
4: 214
1181891083_1181891087 27 Left 1181891083 22:26064106-26064128 CCAGGAAAAATGTGCCTGTCTTG 0: 1
1: 0
2: 2
3: 16
4: 203
Right 1181891087 22:26064156-26064178 CAGAGCACGGAGCATGAAGCAGG 0: 1
1: 0
2: 0
3: 16
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181891087 Original CRISPR CAGAGCACGGAGCATGAAGC AGG Intergenic
900393945 1:2445490-2445512 CAGATCCCTGAGCATGAGGCTGG + Intronic
902545983 1:17190624-17190646 CAGAGAACGGAGAAAGGAGCTGG - Intergenic
902816185 1:18918011-18918033 CAGAGGAAGGGGCAGGAAGCGGG + Intronic
904612544 1:31733354-31733376 CAGAGCAGGGACCAGGAAGGTGG + Intronic
905213210 1:36388679-36388701 CAGAGCACTGAGCTAGATGCTGG + Intergenic
905557466 1:38898632-38898654 CAGAATACAGCGCATGAAGCAGG + Intronic
905899229 1:41570142-41570164 AAGAGCACGGAGCCTGGGGCTGG + Intronic
906267851 1:44447835-44447857 CAGCACAGGCAGCATGAAGCAGG - Intronic
907155066 1:52326102-52326124 CAGAGCACCAACCATGAACCAGG - Intronic
907436847 1:54455372-54455394 CAGAGCAAGTAGCATGGAGGTGG + Intergenic
907761281 1:57363401-57363423 CAGAGCACGGAGGCAGAGGCCGG + Intronic
911624078 1:100101014-100101036 CAGAGCACTTATCATGAACCAGG + Intronic
913060249 1:115197847-115197869 CAGAGCACAGAATTTGAAGCAGG - Intergenic
915108364 1:153547974-153547996 CAGAGCAGGGAGGTTGAAGTCGG - Intronic
916074472 1:161192451-161192473 CAGAGCACTGAGTATGAATCAGG + Intronic
917832457 1:178907257-178907279 AAGTGCAGGGAGCCTGAAGCTGG + Intronic
920848694 1:209613889-209613911 CACAACACTGAGCATGAAGCTGG - Exonic
924107867 1:240667429-240667451 CAGAGGGCAAAGCATGAAGCAGG - Intergenic
1063294653 10:4792546-4792568 CAGAGCAAGGAGGATTTAGCAGG - Intronic
1065303060 10:24341688-24341710 TAGAGCAAAGAGCATGAAACTGG + Intronic
1067278088 10:44851978-44852000 CAGGGCAGGGAGAATGCAGCCGG + Intergenic
1067525187 10:47034225-47034247 CTGAGTGCGGAGCATGAAGGTGG + Intergenic
1067574567 10:47401175-47401197 CAGAGTAAGGAGCTTGAAGGGGG - Intergenic
1068737795 10:60433680-60433702 CAGAGAAGGGAGCAGGAACCAGG + Intronic
1069904002 10:71721705-71721727 CAGAGCGAGGAGCCTGTAGCAGG - Intronic
1070647873 10:78214029-78214051 GAGAGCAAGCAGCATGAGGCTGG - Intergenic
1071027049 10:81127030-81127052 CAAAGCAAGGAGCATTAAGCAGG + Intergenic
1072320687 10:94246693-94246715 CAGAGCTGGGAGCATGAACCTGG - Intronic
1072932602 10:99679930-99679952 CAGAGGACAGTGCATGAAACTGG - Intronic
1074018630 10:109561648-109561670 CAGAGCACCCAGTATGAACCAGG + Intergenic
1074472522 10:113740525-113740547 CAGAGCAGGGTGCTGGAAGCAGG + Intergenic
1075399520 10:122150910-122150932 CAGGGGAAGGAGCATGAAGTTGG + Intronic
1075799093 10:125141578-125141600 AGGAGCACGGAACAGGAAGCAGG + Intronic
1076610899 10:131725427-131725449 CACTGCACGGGGCATGATGCCGG + Intergenic
1076836988 10:133026076-133026098 CAGAGCTCGTAGCCTGATGCAGG + Intergenic
1077449861 11:2634025-2634047 CTGAGCAGGCAGAATGAAGCTGG - Intronic
1078609422 11:12807423-12807445 CAGAGCCAGGAGCAAAAAGCAGG - Intronic
1081773761 11:45664715-45664737 CAGGGCTGGGAGCAGGAAGCAGG + Intronic
1084209297 11:67613657-67613679 CAGAGCACGGAGGCTAAAGGGGG - Intergenic
1084211093 11:67623006-67623028 GAGAGGACAGAACATGAAGCAGG + Intergenic
1084534911 11:69750921-69750943 AAGAGCACCCAGCATGCAGCAGG - Intergenic
1085044764 11:73346460-73346482 CATAGCACTGAGCCTGAAGTTGG + Intronic
1085248928 11:75128735-75128757 GAGAGCACACAGCAGGAAGCTGG - Intronic
1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG + Exonic
1089297310 11:117477887-117477909 CAGAGCACTGAGAAGGCAGCCGG - Intronic
1089589239 11:119529963-119529985 CAGAGCAGGGGTCAGGAAGCTGG - Intergenic
1089709177 11:120302605-120302627 CAGTGCCTGGAGCATGAAGGAGG - Intronic
1089786938 11:120914520-120914542 CAGAGCACTGAGGATCAAGAAGG + Intronic
1091341894 11:134822438-134822460 CAAATCACTGAGCATGAACCAGG + Intergenic
1093778012 12:23099878-23099900 CAGACCAAGAAGCAGGAAGCAGG + Intergenic
1094186194 12:27645502-27645524 CAGAGCACTGAGCCAGATGCTGG + Intronic
1098386133 12:69920722-69920744 GAGAGCATGGAGCGTGAAGAGGG + Intronic
1101287894 12:103334939-103334961 GAGAGGACAGAGCTTGAAGCTGG - Intronic
1103896725 12:124278086-124278108 CAGAGCACGGAGCTGGAGGGAGG + Intronic
1104779997 12:131413779-131413801 CAGGGCCCGGACCATGGAGCGGG + Intergenic
1105280904 13:18962115-18962137 CAGTGCACTGACCATCAAGCAGG + Intergenic
1105290094 13:19048127-19048149 CAGTGCACTGACCATCAAGCAGG + Intergenic
1115582504 14:34775453-34775475 CAGTGGACGGACCATCAAGCAGG + Intronic
1116068470 14:40012420-40012442 CAAAGAACTTAGCATGAAGCTGG + Intergenic
1117166963 14:53045087-53045109 CAGAGAAATGACCATGAAGCCGG - Exonic
1117839765 14:59847783-59847805 AAAAGCATGTAGCATGAAGCAGG - Intronic
1118171169 14:63390167-63390189 TAGAGCATTGAGCATGTAGCAGG - Intronic
1118728417 14:68649164-68649186 CAGAGCTCGGAGCTTGGAGCTGG - Intronic
1119072442 14:71600536-71600558 CAGAGCAAAAAGAATGAAGCTGG - Intronic
1119577161 14:75735302-75735324 CACAGCAGGGAGCCTGAAGGAGG + Intronic
1121168697 14:91835873-91835895 CCGAGCACGGAGCAGGGAGCCGG + Intronic
1122232592 14:100314134-100314156 CAGAGGACAGAGCCCGAAGCAGG - Intergenic
1122889560 14:104726027-104726049 GGGAGCACGGAGGATGCAGCAGG + Intronic
1124006854 15:25801502-25801524 CAGAGCACTGAGAATGAGGGCGG + Intronic
1124082388 15:26513521-26513543 CAGAGCACAGCCCATGAGGCAGG + Intergenic
1124154939 15:27217574-27217596 CACAGCACGGAGCAGGATCCTGG - Intronic
1126292702 15:47099822-47099844 CAGAGCACAGAGCCAGGAGCTGG + Intergenic
1129054956 15:72812676-72812698 CAGAGCATGGAAGAAGAAGCAGG - Intergenic
1131158449 15:90089350-90089372 CAGAGCACTTAGCATGGACCGGG - Intronic
1132978358 16:2721429-2721451 CGGAGCCCGGACCATGAGGCTGG - Intergenic
1133022094 16:2971264-2971286 TAGAGCACGGAGCCTGCAGGGGG - Exonic
1134469761 16:14513594-14513616 CAGGGGAGGGAGCAGGAAGCTGG - Intronic
1135934963 16:26771757-26771779 CAGAGCAAGGAGCAGGATGGAGG - Intergenic
1136066142 16:27760175-27760197 CAGAGCAGGCAGAAGGAAGCAGG - Intronic
1136289903 16:29265265-29265287 CAGAGCCCGGAGCCTGACCCTGG + Intergenic
1136983721 16:35081709-35081731 CAGGGCACAGAGCAAGAGGCTGG - Intergenic
1142642181 17:1290651-1290673 CAGAGCACAGACCATGATGTGGG - Intronic
1143366555 17:6412535-6412557 CAGAGCAGGGTGCAGGAAGGAGG + Intronic
1145066526 17:19765378-19765400 GAAAGAAGGGAGCATGAAGCCGG - Intergenic
1146422647 17:32702890-32702912 CATAGCATGGAACATGGAGCAGG + Intronic
1146926689 17:36750499-36750521 CTGAGGACGGGGCATGAGGCAGG - Intergenic
1147684343 17:42277613-42277635 CAGAGAAGGAAGCAGGAAGCAGG + Intergenic
1149362728 17:55911440-55911462 CTGAGCCTGGGGCATGAAGCTGG - Intergenic
1150943304 17:69717098-69717120 CAGAGCACATAGCATCCAGCTGG + Intergenic
1151180093 17:72321029-72321051 CAGTGCAGGAAGCATGATGCTGG + Intergenic
1151947007 17:77325337-77325359 AAGAGCCCAGAGCATGAGGCTGG - Intronic
1152278175 17:79370076-79370098 CAGAGCAGGGAGCATCAGGAAGG - Intronic
1152662245 17:81547924-81547946 AAGAGGACAGAGGATGAAGCTGG + Intronic
1155108449 18:22689900-22689922 CACTGCAGGGAGCAGGAAGCAGG + Intergenic
1155888804 18:31241042-31241064 CACAGCATGGTGCCTGAAGCAGG - Intergenic
1157484831 18:48079586-48079608 CAAAGCAGAGAGGATGAAGCTGG + Intronic
1159389938 18:67778242-67778264 CACAGTGCTGAGCATGAAGCAGG - Intergenic
1160859388 19:1231209-1231231 GAGAGCACGGAGCAGGAGGAGGG - Exonic
1161572530 19:5038337-5038359 CAGAGGAGGGAACATGAGGCTGG + Intronic
1163872096 19:19830651-19830673 CAGAGCAGGTAGCTTGGAGCAGG + Intergenic
1164677391 19:30110805-30110827 CGGAGGACGGAGGAGGAAGCGGG - Intergenic
1165431872 19:35777520-35777542 CACCGCCCTGAGCATGAAGCAGG - Intronic
1166948271 19:46410464-46410486 CAGAGCCCGGGGCATGAGGATGG + Exonic
1167607532 19:50489456-50489478 CAGAGACCGGGGCAGGAAGCAGG + Exonic
925207128 2:2016279-2016301 CAGAACACAGAGCAAGAAGATGG + Intronic
925991600 2:9259400-9259422 GAGAGCAGGGCGCAGGAAGCGGG - Intronic
926122669 2:10253435-10253457 CAGAGCAAGGAGCGAGAGGCAGG - Intergenic
926149137 2:10415092-10415114 CAGAGCACTGAGACTCAAGCTGG - Intronic
926376406 2:12232482-12232504 AAGACCATGGAGGATGAAGCAGG - Intergenic
926691277 2:15735716-15735738 GAGAGCATGGAGAATGAAGAAGG - Intronic
927725554 2:25419702-25419724 CAGAGGACGAAGCAAGCAGCAGG + Intronic
927907620 2:26872179-26872201 GAGAGCAGGGAGCATGAGTCTGG + Intronic
928452034 2:31386029-31386051 CAGAGCACCGAGCATGAGCCAGG - Intronic
929919125 2:46160168-46160190 ACTAGCACAGAGCATGAAGCTGG + Intronic
932108967 2:68975972-68975994 CAGAGCACAGAGCTTTATGCAGG - Intronic
932356455 2:71071975-71071997 CAGAGCAAGGACCAGGCAGCAGG + Intronic
934523188 2:95032653-95032675 AAGGGCATGGAGCATGGAGCAGG + Intronic
935692892 2:105745744-105745766 CAGGGCGCAGAGCCTGAAGCCGG - Intronic
938192213 2:129293907-129293929 CATAGCAGGGAGCATGTAGGGGG + Intergenic
938701171 2:133881449-133881471 CAGAGACCGGAGCCTGAACCAGG + Intergenic
940798510 2:158105912-158105934 CATAGCACTGAGCATGAAAATGG - Intronic
942813425 2:180023418-180023440 CAGAAAAAGGAGCATGATGCTGG + Intergenic
942912211 2:181257953-181257975 CAGGGCTTGGAGCATGAAGGAGG + Intergenic
944125747 2:196290791-196290813 CAGAACACTGAGCTGGAAGCAGG - Intronic
946186015 2:217980776-217980798 CAGAGCAGGGAGCATGCTGGAGG - Intronic
947910579 2:233798460-233798482 CAGAGCACTGGGCATGAAGTGGG - Intronic
947951342 2:234150193-234150215 CAGAGCACGCAGCCTGGGGCTGG + Intergenic
948028839 2:234800144-234800166 CAGAGCAAGGAGGATGGAGCTGG + Intergenic
1169523726 20:6400734-6400756 GAAAGCAAGGAGCATGAGGCAGG - Intergenic
1169776645 20:9262452-9262474 AAGAGCATGGAGGATGAGGCAGG + Intronic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1172054780 20:32146576-32146598 GAGAGCACAGAGCATGGAGGTGG - Intronic
1172127033 20:32630593-32630615 CACAGCACGGAGGAGGAGGCAGG + Intergenic
1172277067 20:33685788-33685810 CAGAGCACAGAGCAGCAAACAGG + Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1175490792 20:59380049-59380071 CAGAGCTCTGAGGATGAAGTGGG - Intergenic
1175820794 20:61907721-61907743 CAGAGCCCGGAACCTGCAGCTGG - Intronic
1176792923 21:13341610-13341632 CAGAGAAGGGATCATGAAGGAGG + Intergenic
1177080596 21:16634260-16634282 TAGATAACTGAGCATGAAGCTGG + Intergenic
1179175466 21:39005039-39005061 CAGAGCCTTGAGCAGGAAGCGGG + Intergenic
1180941657 22:19663599-19663621 CAGAGCAGGAAGCATGTGGCTGG + Intergenic
1180982501 22:19885461-19885483 CAGAGCACAGAGGCTGGAGCCGG - Intronic
1181349447 22:22244729-22244751 CAGAGCAGGGAGGAGGATGCTGG + Exonic
1181560645 22:23697689-23697711 TAGAGCCCGGAGCCTGAGGCAGG + Intronic
1181891087 22:26064156-26064178 CAGAGCACGGAGCATGAAGCAGG + Intergenic
1183064627 22:35354457-35354479 CAGAGCACGGTGCAGGGTGCTGG - Intergenic
1183569033 22:38638274-38638296 CAGAGGACTGAGCAGGAAGTGGG + Intronic
1184699433 22:46160524-46160546 CAGAGGGCGGATCATGAGGCCGG - Intronic
1184849078 22:47109444-47109466 CAGACCACAGAACATGAAGAGGG - Intronic
951079032 3:18429295-18429317 AAGAGCAGGGAGGAAGAAGCTGG + Intronic
953013889 3:39053850-39053872 CAGTGCACGTAGAATGAGGCAGG + Intronic
953723038 3:45372991-45373013 CAGAGCAAGCAGCAAGAAGTAGG + Intergenic
958556866 3:95690384-95690406 CAGAACAGCGAGCATGAAGGAGG - Intergenic
960858520 3:122127530-122127552 CAGAGTATGGAGCAAGAAGCAGG + Intergenic
961000878 3:123373127-123373149 CACAGCACCTAGCATGCAGCAGG + Intronic
961578792 3:127860645-127860667 CAGAGCACCTTGCATGAAGCAGG - Intergenic
962450285 3:135508266-135508288 CAGACCATGGAGCAAGAAGGAGG + Intergenic
963916352 3:150862115-150862137 CAGAGCCTGGAGCAGGCAGCAGG - Intergenic
965823081 3:172704398-172704420 GAGAGCTCGGAGCATGAGCCTGG - Intronic
968699106 4:2046498-2046520 CAGAGCCCAGAGCCTGTAGCTGG + Intergenic
969453069 4:7285996-7286018 CAGGGCACGGAGCACGGTGCCGG - Intronic
973559919 4:52124923-52124945 CAGAGCACAGAGCAGGGAGAAGG - Intergenic
974806811 4:66891281-66891303 CAGAGCACAGAGCTAGAACCAGG + Intergenic
975849920 4:78561499-78561521 CAAAGCAAGGAGTATGAAACTGG - Intronic
976421896 4:84854533-84854555 AAGAGGATGCAGCATGAAGCTGG + Intronic
977859741 4:101942352-101942374 CAGAGCACAGAGCCTGTAGTGGG + Intronic
981743297 4:148026337-148026359 CAGAAAACCCAGCATGAAGCCGG + Intronic
984888257 4:184470058-184470080 CAGCACACTGTGCATGAAGCTGG + Intronic
985704853 5:1394401-1394423 CAGAGCCGGGAGCAGGGAGCAGG + Exonic
989234593 5:39131708-39131730 CTGAGCATGATGCATGAAGCAGG + Intronic
1000165188 5:158641522-158641544 CAGAGCACGGACACAGAAGCTGG - Intergenic
1001295334 5:170495167-170495189 CGGAGCATGGAGCCTGAAGTGGG + Intronic
1001665936 5:173433819-173433841 CAAAGCACGGAGCAGGAAAACGG - Intergenic
1001776704 5:174334284-174334306 CAGAGCACAGAGGCTGAGGCTGG + Intergenic
1001956931 5:175854101-175854123 CAGGGCACCGGGCATGAAGCTGG - Intronic
1002295751 5:178230237-178230259 CAGAGCAGGGAGAGAGAAGCTGG + Intronic
1002424744 5:179168325-179168347 CAGGACAAGGAGCCTGAAGCTGG + Intronic
1004345996 6:14849924-14849946 GAGAGCAGGGATCATGGAGCAGG - Intergenic
1004659656 6:17698755-17698777 AAGAGCTGGGAGCCTGAAGCAGG + Intronic
1005456579 6:26025542-26025564 CAGAGCACAGAGCATGTAAGTGG + Intergenic
1005487000 6:26310085-26310107 CAGAGAAAAGAGCAAGAAGCGGG + Intergenic
1005987491 6:30884006-30884028 CAGGGCACAGAGGAAGAAGCAGG - Intronic
1006020415 6:31114595-31114617 CAGAGCAGGGAGTGTGAAGATGG + Intergenic
1007766648 6:44164613-44164635 CAGAGGAGGCAGCATCAAGCAGG + Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010373705 6:75141425-75141447 CAGCAGACGGAGCAGGAAGCAGG + Intronic
1015201443 6:130585987-130586009 CAGAGGCAGCAGCATGAAGCAGG + Intergenic
1015471628 6:133612758-133612780 CAGAGAAAGGAGCATGGAGAGGG - Intergenic
1015471633 6:133612785-133612807 CAGAGGAAGGAGCATGCAGAGGG - Intergenic
1015809221 6:137144660-137144682 CAGAGAACTCAGCTTGAAGCTGG - Exonic
1016887503 6:148971644-148971666 CACAGCACGGAGGAAGAACCAGG + Intronic
1019370400 7:660178-660200 CAGAACCCGGAACATGGAGCCGG - Intronic
1022043595 7:26604037-26604059 AAGAGCAAGGAGCAGGAATCTGG + Intergenic
1029530531 7:101122306-101122328 GAGAGAAGGGAGCAGGAAGCGGG + Intergenic
1029839590 7:103347861-103347883 CAGAGCACAGAGCCAGGAGCGGG - Intronic
1030070909 7:105696775-105696797 CACCCCACGGAGGATGAAGCTGG + Intronic
1033426888 7:141252881-141252903 CAGGGCAAGGAGAATGGAGCTGG - Intronic
1034374262 7:150628921-150628943 CAGATGACAAAGCATGAAGCTGG + Intronic
1034670003 7:152850554-152850576 CAGAGCAGGAAGAATGAAACGGG - Intronic
1034983337 7:155491897-155491919 CAGAGCAGGAAGCAGGAAGGAGG + Intronic
1036415634 8:8545317-8545339 CAGAGGAGGTAGCCTGAAGCAGG + Intergenic
1037182233 8:16021576-16021598 CAGAGCACCTAGCATGAACGTGG + Intergenic
1037893719 8:22637809-22637831 CAGAGCACGAAGCCCGAAGCTGG - Intronic
1039890450 8:41682228-41682250 CAGAGCAGGGAGTGTGAAGGGGG - Intronic
1042761263 8:72273839-72273861 ATGAGCACAGAGCAGGAAGCTGG + Intergenic
1042844867 8:73159815-73159837 CACAGCAGGGAGCATAAAGGAGG - Intergenic
1045105388 8:98887760-98887782 CAGAGCAAGGAGCAGTCAGCAGG + Intronic
1048774985 8:137935663-137935685 CAGAGCCTAGAGGATGAAGCTGG + Intergenic
1049037230 8:140086230-140086252 CAGAGTATGGAGGATGAAGAAGG + Intronic
1049392705 8:142380356-142380378 CAGAGCAGGGAGGACGCAGCTGG + Intronic
1049706646 8:144046197-144046219 CAGAGCACGGAGCCAGGAGGAGG + Intronic
1050222791 9:3413619-3413641 CAGAGCAAGGAGAAAGAAACAGG - Intronic
1050406120 9:5310088-5310110 GAGAGCAGGGTGCAGGAAGCAGG + Intergenic
1051469986 9:17427207-17427229 CAGAGCACGGAGCATGTGACTGG - Intronic
1052470110 9:28883142-28883164 CAGAGCACAGAGAGTGAAGGAGG - Intergenic
1055446966 9:76393885-76393907 CGGAGCTCGGAGCCAGAAGCAGG + Intronic
1055545493 9:77368597-77368619 CAGATCACTGAGCATGACTCAGG + Intronic
1056697695 9:88873921-88873943 CAGGACAAGGAGAATGAAGCAGG - Intergenic
1057271951 9:93656441-93656463 CAGTGCACTGACCATCAAGCAGG - Intronic
1058991467 9:110257846-110257868 AGGAGCACGGAGCATGAATATGG + Intergenic
1059433845 9:114265005-114265027 CAAAGCACGGAGCAGGGAGGGGG - Intronic
1060004256 9:119985737-119985759 GGGAACACGGAGAATGAAGCAGG - Intergenic
1060804160 9:126564320-126564342 CAGAGCAGGGAGCAGCAACCAGG + Intergenic
1062029842 9:134357253-134357275 CAGAGCCCGGAGCAGAAACCTGG + Intronic
1062555468 9:137111822-137111844 CAGAGCTCGGGGCAGAAAGCAGG + Intronic
1192528221 X:71866376-71866398 CAGAGCAAGGAGCAGAAGGCTGG - Intergenic
1196578158 X:117345979-117346001 AAGAGCACGTACCATGAAACTGG + Intergenic
1197644585 X:129004030-129004052 TAGAGCATGGAGCATGGAGAGGG - Intergenic
1198373177 X:136011601-136011623 CAGAGCACAGCACATGTAGCAGG - Intronic
1199462368 X:148098754-148098776 CAGAGAACAGAGCAAGAAGCAGG + Intergenic
1200074874 X:153545966-153545988 GAGAGGACGGGGCATGAAGAAGG + Intronic