ID: 1181893074

View in Genome Browser
Species Human (GRCh38)
Location 22:26081816-26081838
Sequence CAGGATAAGCGTGAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 271}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181893070_1181893074 -4 Left 1181893070 22:26081797-26081819 CCCTCTTTAAGATTGCTAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 91
Right 1181893074 22:26081816-26081838 CAGGATAAGCGTGAAGAGGAAGG 0: 1
1: 0
2: 0
3: 17
4: 271
1181893072_1181893074 -5 Left 1181893072 22:26081798-26081820 CCTCTTTAAGATTGCTAGCAGGA 0: 1
1: 0
2: 1
3: 6
4: 95
Right 1181893074 22:26081816-26081838 CAGGATAAGCGTGAAGAGGAAGG 0: 1
1: 0
2: 0
3: 17
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181893074 Original CRISPR CAGGATAAGCGTGAAGAGGA AGG Intergenic
901567767 1:10132905-10132927 CTGGAGAAGAGTGAACAGGAGGG + Intronic
902783236 1:18717468-18717490 CTGGCTAAGCGAGGAGAGGAGGG - Intronic
902795159 1:18796128-18796150 CAGAATAAGGGTGAAGAAGGGGG - Intergenic
902839340 1:19065346-19065368 CAGGGTAACCGGGAGGAGGACGG + Intergenic
903149852 1:21398968-21398990 CAGGAGAAGGGTGGAGAGAAAGG - Intergenic
904565471 1:31425803-31425825 CTGGATGAGGATGAAGAGGAAGG - Exonic
904972796 1:34432262-34432284 CTGGTTAAACTTGAAGAGGAGGG + Intergenic
906049369 1:42857795-42857817 CAGGCTAAGGGGGAAGAGGGAGG - Intergenic
907347676 1:53796684-53796706 CAGAATAAACGTGAACAGGTAGG - Exonic
908971919 1:69845939-69845961 AAAGATAATCCTGAAGAGGATGG - Intronic
909460820 1:75911440-75911462 CAAGAAAAGCTTGAATAGGATGG - Intronic
909678105 1:78260257-78260279 CAAGATAAGCGTGAAACTGAAGG + Intergenic
909788399 1:79643170-79643192 CAGGATAAGGGAGAAGAAGGAGG + Intergenic
911656459 1:100449443-100449465 AAGGACAAGGGTGGAGAGGAAGG - Intronic
913182407 1:116334876-116334898 CAGCATAAGAATGAAGAGGAGGG + Intergenic
915086314 1:153391242-153391264 TAGGAGAAGCGGAAAGAGGAAGG + Intergenic
915677022 1:157541448-157541470 TAGGATAAGGTTGGAGAGGAAGG - Intronic
917647981 1:177047594-177047616 GAAGACAAGAGTGAAGAGGATGG + Intronic
918380996 1:183955104-183955126 TAGGATAATGGTTAAGAGGAAGG + Intronic
919645074 1:200087268-200087290 GAGAATAAGCTTTAAGAGGAAGG - Intronic
920502885 1:206496584-206496606 CATGAAACGCTTGAAGAGGAAGG - Exonic
922046246 1:221948838-221948860 CAGGCTAAGGGGGAAGAGGGAGG - Intergenic
922363698 1:224844942-224844964 CAGGCTAAGGGAGAAGAGGGAGG + Intergenic
1062975027 10:1676834-1676856 CAGGGGAAGCATGAAGAGGATGG + Intronic
1064040788 10:11961495-11961517 CAGCAGAAGAGGGAAGAGGAGGG + Intronic
1064325205 10:14343910-14343932 CAGGAAAAACTGGAAGAGGAAGG - Intronic
1064708964 10:18103489-18103511 CAAGAAAACCTTGAAGAGGAGGG + Intergenic
1064940765 10:20732959-20732981 CATGATAAGGATGAAGAGAACGG - Intergenic
1065961082 10:30734864-30734886 CATGATAAGGGTGATTAGGATGG + Intergenic
1069369702 10:67734127-67734149 CAGGAAAAGAGAAAAGAGGAAGG - Intergenic
1070056460 10:72939760-72939782 CAAGATAATGGTGGAGAGGAAGG + Intronic
1070281256 10:75050677-75050699 CAGGCTCAGCGTGGAGCGGAGGG - Intronic
1070607497 10:77909228-77909250 CATGAGAAGCCTGAAGATGAGGG + Intronic
1072478000 10:95781956-95781978 CTGGATAAGGGTGAACAGAAAGG + Intronic
1073146382 10:101284510-101284532 CAGGATGAGGGTGTCGAGGAGGG + Intergenic
1073394433 10:103206453-103206475 CAGGCTAAGGGAGAAGAGGGAGG - Intergenic
1073683389 10:105728598-105728620 CAGGCTAAGGGAGAAGAGGGAGG - Intergenic
1073709632 10:106022054-106022076 CAGGCTAAGGGAGAAGAGGGAGG + Intergenic
1074348518 10:112712139-112712161 CAGGATATATCTGAAGAGGATGG - Intronic
1075360785 10:121831461-121831483 CAGGACACGAGTGCAGAGGAGGG - Intronic
1076100565 10:127774384-127774406 CAAAATAAGCAGGAAGAGGAAGG - Intergenic
1076545232 10:131240752-131240774 CAGGAAAAGTGAGAAGGGGAAGG + Intronic
1077581942 11:3422654-3422676 CAGGATGAGCGTTATGAGGCGGG + Intergenic
1081868107 11:46370745-46370767 TAAGATAAGCCTGAAGAGCAGGG - Intronic
1081919098 11:46756220-46756242 GATGATAATGGTGAAGAGGAAGG - Intronic
1083243461 11:61407298-61407320 TGGGATAAGAGTGAACAGGAAGG - Intronic
1084101158 11:66950527-66950549 CAGGAGAAAGCTGAAGAGGAGGG + Intronic
1084238857 11:67805471-67805493 CAGGATGAGCGTTATGAGGCGGG + Intergenic
1086424872 11:86673147-86673169 TAGGATAAGTCTGAAGAGGCTGG - Intergenic
1086426058 11:86683323-86683345 CAGGATGAGGGGAAAGAGGAAGG + Intergenic
1088542118 11:110923947-110923969 CAGCCTAAGCCAGAAGAGGAGGG + Intergenic
1089777231 11:120846866-120846888 CTGGAAAACCGTGAAGAGGAGGG - Intronic
1089984163 11:122797359-122797381 GAGGACAAGAGTGAAGAAGATGG + Intronic
1091512390 12:1141686-1141708 CAGGATATGGCTGAAGAGAAGGG + Exonic
1091545879 12:1501010-1501032 CAGGGGTAGCGTGAAGAGGCCGG - Intergenic
1091956832 12:4651746-4651768 AATGATAAGAGTGAAGAGTAAGG - Intronic
1093024179 12:14231839-14231861 CAGGCTAAGGGGGAAGAGGGAGG - Intergenic
1094723581 12:33089831-33089853 CAGGCTAAGGGAGAAGAGGGAGG + Intergenic
1094872318 12:34605264-34605286 CAGGAGAAGCGTAAAGCGGCAGG + Intergenic
1095965637 12:47865158-47865180 CAGGCGAAGCATGAAGCGGAAGG - Exonic
1096828873 12:54299554-54299576 CAGGCTAAGAGTAAGGAGGATGG - Intronic
1097269534 12:57765661-57765683 CAGGAAATGAGTAAAGAGGAAGG - Intronic
1097592240 12:61588138-61588160 CAGGCTAAGGGAGAAGAGGGAGG - Intergenic
1098101875 12:67026608-67026630 CAGGATAATGAAGAAGAGGAAGG - Intergenic
1098568227 12:71959078-71959100 CAGTATAAGCAGGAAGAGGAGGG - Intronic
1098653968 12:73006429-73006451 CAGGCTAAGGGAGAAGAGGGAGG + Intergenic
1099836249 12:87911844-87911866 CAGGCTAAGGGAGAAGAGGGAGG + Intergenic
1101129386 12:101673049-101673071 CAGGATAATTGTTAAGAGCATGG - Intronic
1103117349 12:118347637-118347659 TAGGATAAGCCAGAAGAGGTGGG - Intronic
1103381554 12:120497421-120497443 CCGGATAGATGTGAAGAGGACGG + Intronic
1106242224 13:27921117-27921139 CAGGATAGGAGTAAAGAGGAAGG + Intronic
1106825589 13:33517199-33517221 CAGGATGAGCTTGAATAGGGTGG - Intergenic
1106943303 13:34799937-34799959 CAGGCTAAGGGAGAAGAGGGAGG - Intergenic
1107242507 13:38253586-38253608 CAGAACAAGCATGAAGAGTAGGG - Intergenic
1107718556 13:43224885-43224907 CAGGAGCAGGGAGAAGAGGAAGG - Intronic
1108202551 13:48057657-48057679 CAGGCTAAGGGAGAAGAAGAGGG - Intronic
1110894365 13:80730681-80730703 CAGGTTAAGGGTGAAAAGAAGGG + Intergenic
1111073315 13:83199161-83199183 GAGGAGAAGGTTGAAGAGGAGGG - Intergenic
1112484791 13:99810554-99810576 CAGGATGAGCCTAGAGAGGAAGG + Intronic
1112887852 13:104195411-104195433 CAGGATGAGGCAGAAGAGGAAGG - Intergenic
1113386869 13:109857071-109857093 CAGGGTAAGCAGGAAGATGATGG + Intergenic
1115633327 14:35267098-35267120 CAGGATAAAGGAGAAGTGGAGGG + Intronic
1115891713 14:38037730-38037752 TAAGATAAGCCTGAAGAGGTAGG - Intronic
1116701399 14:48247870-48247892 CAGGATAAGGATGAGGATGAAGG - Intergenic
1119893150 14:78198054-78198076 CAGGATGAGTGTGGAGAGCAGGG - Intergenic
1121546688 14:94768519-94768541 CCGGAGAAGAGGGAAGAGGAAGG - Exonic
1124129195 15:26970121-26970143 CTGGATAGGCATGAAGTGGAGGG - Intergenic
1124363105 15:29053356-29053378 TGGGATAAGCCTGAAGGGGAAGG + Intronic
1124876755 15:33601996-33602018 GAGGATCAGGGTGAAGAGCAGGG + Intronic
1125183680 15:36906817-36906839 CAGGATAATTTGGAAGAGGAAGG - Intronic
1126269075 15:46791564-46791586 CAGGAAAATCGTGAGGAGGAGGG + Intergenic
1126530298 15:49703579-49703601 CAGGCTAAGGGAGAAGAGGGAGG + Intergenic
1127007071 15:54582565-54582587 CAGAATGAGGGTGAAGATGAGGG + Intronic
1127604826 15:60576020-60576042 AAGGATGGGAGTGAAGAGGAAGG - Intronic
1129259288 15:74355169-74355191 CAGGCTAAGGGAGAAGAGGGAGG - Intronic
1130061855 15:80576166-80576188 CAGGGTAACAGCGAAGAGGATGG - Intronic
1130965610 15:88695500-88695522 CGGAATAAGTGTCAAGAGGAAGG - Intergenic
1130975328 15:88769342-88769364 CAGGTAAAGGGTGAAGAGGGAGG - Intergenic
1131031057 15:89186258-89186280 CAGGACAAGCATGAAGAATAAGG - Intronic
1131300429 15:91194967-91194989 CAGGATCAGAATGAAGATGAAGG + Intronic
1131335635 15:91546081-91546103 GAGTATAAGCGTGTAGGGGAAGG + Intergenic
1132116297 15:99138687-99138709 CAGGACATGGGTGAGGAGGATGG + Intronic
1132992724 16:2805356-2805378 CTGGACATGAGTGAAGAGGAGGG - Intergenic
1133322451 16:4922770-4922792 CAGGATCAGCGTGAACAGTGTGG - Intronic
1136604679 16:31325355-31325377 CAGGTCAAGCGGGAAGAAGAAGG - Exonic
1138073374 16:54016198-54016220 TAGCATAATGGTGAAGAGGAGGG - Intronic
1138178467 16:54926917-54926939 CAGAATAAGTCTGTAGAGGAGGG - Intergenic
1138509595 16:57500682-57500704 CAGGAGGGGCGTGGAGAGGAAGG + Intergenic
1138515145 16:57531795-57531817 CAGGAGAAGCCAGAACAGGAGGG - Intronic
1143410194 17:6704047-6704069 CAGCATCAGCCTGCAGAGGAGGG + Exonic
1144025322 17:11271959-11271981 CAGGAAGAGTGTGAAAAGGAGGG - Intronic
1144595648 17:16568461-16568483 CTGGAAAAGAGTGAAGAGGTTGG + Intronic
1145915232 17:28569947-28569969 CAGGTTAAGTGGGAAAAGGAGGG - Intronic
1147873113 17:43601788-43601810 CAGGGTAATCGTGAGGAGGCAGG - Intergenic
1148621783 17:49039954-49039976 CAGGATAGACGTGCATAGGAAGG + Exonic
1148678128 17:49456928-49456950 AAGGAGAAGGATGAAGAGGAAGG - Intronic
1150873259 17:68939339-68939361 CAGGATATGTGAGCAGAGGAAGG - Intronic
1151162970 17:72181386-72181408 CAAGGTAAACGGGAAGAGGATGG - Intergenic
1156003023 18:32406841-32406863 AAGTATAAGACTGAAGAGGAAGG + Intronic
1157172673 18:45422492-45422514 TAGGCTAAGCGTGAGGTGGAAGG + Intronic
1158550389 18:58430916-58430938 AAGGATCAGTGAGAAGAGGAGGG - Intergenic
1160080077 18:75717991-75718013 CAGGAAAAGCGTGAGCAAGAAGG - Intergenic
1160712789 19:560389-560411 CAAGATTTGCGAGAAGAGGAGGG + Intergenic
1160743229 19:697354-697376 CAGGAAATGCGTGGAAAGGAAGG + Intergenic
1162215013 19:9126855-9126877 CAGGAACAGCATGAAGAGGATGG + Exonic
1163209443 19:15829720-15829742 CAGGCTAAGGGGGAAGAGGGAGG - Intergenic
1167234231 19:48303952-48303974 CTGGAGAAGCGTGAAAAGCAGGG - Exonic
926105289 2:10146051-10146073 CAGGATGAGTGTGAGAAGGAGGG - Intronic
926964758 2:18397645-18397667 GAGGAAGAGGGTGAAGAGGAAGG - Intergenic
927723913 2:25406096-25406118 CAGGAAATACGTGCAGAGGAGGG + Intronic
928276192 2:29902359-29902381 CAGGATGATGGAGAAGAGGATGG - Intronic
929175001 2:38967300-38967322 CTGGAGAAGGGGGAAGAGGAAGG + Intronic
933292337 2:80451923-80451945 TAAGATAAGCATAAAGAGGAGGG + Intronic
936273245 2:111068504-111068526 CAGGATAAGCCTGAAGTGGCTGG + Intronic
937336236 2:121064077-121064099 CAGGATAGGTGTCCAGAGGAGGG + Intergenic
938201226 2:129374558-129374580 CAGGATGAGCGTTCCGAGGAAGG - Intergenic
938642232 2:133293173-133293195 AAGGTTTAGAGTGAAGAGGAAGG + Intronic
938984235 2:136557985-136558007 CAGGATTAAGGTGAAGAGGAAGG - Intergenic
939415294 2:141888326-141888348 CCTGAGAAGTGTGAAGAGGAAGG + Intronic
942729420 2:179047452-179047474 AATGAGAAGGGTGAAGAGGAAGG - Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
944879665 2:203999530-203999552 GAGGAAAAGCTTGAAAAGGAAGG + Intergenic
946419336 2:219556241-219556263 CAGGATGTGCGGGCAGAGGAAGG - Exonic
948097947 2:235351214-235351236 CAGGATAAGTGTGGGGAGGCGGG - Intergenic
1168943473 20:1732549-1732571 CAGGCTAAGGGAGAAGAGGGAGG + Intergenic
1171072924 20:22092640-22092662 CAGAAAAAGAGAGAAGAGGAAGG - Intergenic
1171938906 20:31305166-31305188 CATGATAAGGGTGAAGATTAAGG - Intronic
1172393346 20:34581642-34581664 CTGGATAAACATGAAGAAGATGG + Exonic
1174846443 20:53947934-53947956 CAGGGTTAGCATGAAGATGAAGG - Intronic
1175346414 20:58280054-58280076 TAAGATAAGCGTGAACAGCATGG + Intergenic
1181893074 22:26081816-26081838 CAGGATAAGCGTGAAGAGGAAGG + Intergenic
1183226465 22:36553562-36553584 CAGGATAAGGTGGAAGAGGTGGG - Intergenic
1184273677 22:43398715-43398737 CAGGAGAAGGGTGCAGAGGAAGG - Intergenic
949266364 3:2161220-2161242 GAGGATAAGGGTGGAAAGGAAGG + Intronic
951762946 3:26164827-26164849 CAGGCTAAGGGAGAAGAGGGAGG + Intergenic
954043742 3:47911062-47911084 CAGGATAAGAGTGAGGAGCTGGG - Intronic
956037897 3:65115523-65115545 CAGGATGAGTTTGGAGAGGATGG - Intergenic
956378490 3:68641128-68641150 CATGATAAGAGGGGAGAGGAGGG - Intergenic
959431811 3:106263342-106263364 CAAGATGAGACTGAAGAGGAAGG - Intergenic
960157655 3:114313056-114313078 CAGTATAACTGTGAAGATGAAGG + Intergenic
961300048 3:125916444-125916466 CAGGATGAGCGTTATGAGGCGGG - Intergenic
964472670 3:157071146-157071168 CAGGATCAGCTTGAGGAAGAGGG - Intergenic
965054572 3:163697009-163697031 CAGGATAAGCCAGTATAGGATGG + Intergenic
965334918 3:167423479-167423501 CAGGCTAAGGGAGAAGAGGGAGG - Intergenic
965760240 3:172068058-172068080 CAGGATGAGCCTGAAGAGTTGGG - Intronic
966397514 3:179518108-179518130 CAGGCTAAGGGAGAAGAGGGAGG - Intergenic
966770716 3:183501185-183501207 CGGGATAAGGGTGAAGGGGTGGG + Intronic
967227068 3:187302210-187302232 CTGGATAAGAATGAAGAAGAGGG - Intergenic
967561249 3:190921398-190921420 CAGGCTAAGGGAGAAGAGGGAGG - Intergenic
969046502 4:4340359-4340381 CATGCTAAGTGTGAACAGGATGG + Intergenic
970256564 4:14174942-14174964 CAGGCTAAGGGAGAAGAAGAAGG + Intergenic
972358493 4:38304611-38304633 CAGGTTAAATGTGAATAGGATGG + Intergenic
973865850 4:55112244-55112266 GAGGAAAAGGGGGAAGAGGAGGG - Intronic
975803212 4:78084679-78084701 CAGGAAATGTATGAAGAGGACGG - Intronic
976332517 4:83849133-83849155 CAAGATGAGAGTGAGGAGGAGGG + Intergenic
976813055 4:89117867-89117889 CAGGGTAAGCCTGAAGACCAGGG - Intergenic
977257169 4:94754225-94754247 GAGGATATCCATGAAGAGGAAGG + Intergenic
977446582 4:97139061-97139083 CAGGCTAAGGGAGAAGAGGGAGG + Intergenic
977708313 4:100095961-100095983 GATGATAAGCGTGAAGAGACTGG - Intergenic
977782586 4:100996244-100996266 CAGGCTAAGAGAGAAGAGGTAGG + Intergenic
978718666 4:111877390-111877412 CAGGACTAGAGTCAAGAGGAAGG + Intergenic
982065585 4:151651632-151651654 CAGGAGAAGCCTGGTGAGGAGGG + Intronic
984973480 4:185210092-185210114 CAGGCTGAGCCTGAACAGGACGG - Intronic
985750338 5:1669961-1669983 GAGGATAAGGGTGAAGGGTAAGG + Intergenic
986369124 5:7062739-7062761 CAGGCTAAGGGGGAAGAGGGAGG + Intergenic
987078024 5:14402652-14402674 GAGGGTAAGGGTGTAGAGGAAGG + Intronic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
989503702 5:42200643-42200665 CAGCATAAGTTTTAAGAGGAAGG + Intergenic
989768714 5:45117171-45117193 CAGAATAAGCTTCCAGAGGAAGG - Intergenic
990186703 5:53217963-53217985 GAGGAGAAGGGGGAAGAGGAGGG + Intergenic
990523834 5:56605763-56605785 CAGGAGAGGGGTGAAGAAGAAGG - Intronic
990565266 5:57021439-57021461 CAGGCTAAGGGAGAAGAAGAAGG + Intergenic
990694714 5:58402820-58402842 CAGAGTAAACGTGAAGAGGTAGG + Intergenic
990986153 5:61642665-61642687 CAGGATAAGAGAGAAGAAGGAGG - Intronic
991412964 5:66363061-66363083 GAGGAAAAGGGTGAAAAGGAGGG - Intergenic
993041715 5:82822187-82822209 CAGAATAAGCTTGAGGAGGAGGG - Intergenic
993292069 5:86086265-86086287 AAGGATAAGCATAAAGAAGAAGG + Intergenic
994203759 5:97008949-97008971 CAGGTAAAGAGTAAAGAGGAGGG - Intronic
994550066 5:101223082-101223104 GAGGAGAAGCGTGGAGGGGATGG - Intergenic
996344169 5:122471798-122471820 AAGGATGAGGGTGAGGAGGAGGG - Intergenic
997157089 5:131572745-131572767 CAGGCTAAGGGGGAAGAGGGAGG - Intronic
997679049 5:135736444-135736466 CAGGCTAAGGGAGAAGAGGGAGG + Intergenic
1000764851 5:165274410-165274432 CTGGTTAAGGGTGGAGAGGAAGG - Intergenic
1001680721 5:173555144-173555166 CAGGAGCAGAGTGAAGAGGCGGG + Intergenic
1003668598 6:8134480-8134502 CAGGATAGGTGTCAAGAGCATGG + Intergenic
1005905437 6:30259215-30259237 CAGGATGAGCGTGAATGGGAAGG + Intergenic
1006094072 6:31644897-31644919 CAGGATCAGCATGATGAGGGAGG - Intronic
1006474283 6:34244828-34244850 CAGGAGAAGGAGGAAGAGGAGGG + Exonic
1006738984 6:36294038-36294060 CAGGATAAGCCTGGAGACGGAGG - Intronic
1007084738 6:39135467-39135489 CAGGCTAAGGGAGAAGAAGAGGG + Intergenic
1008124163 6:47649811-47649833 CAGGAGGAGGGTGAAGAGGCAGG + Intergenic
1008850358 6:56015258-56015280 CAGGCTAAGGGAGAAGAGGGAGG + Intergenic
1012963403 6:105646784-105646806 CAGGGTAAGCATGTAGAGGCAGG - Intergenic
1013594527 6:111648670-111648692 AAGGATAAGACTGAAGGGGAAGG + Intergenic
1014305068 6:119730007-119730029 CAGGAAAACCATGAAAAGGAAGG - Intergenic
1014508688 6:122293166-122293188 CAGGATAACCGAGAAGGTGAAGG + Intergenic
1014611931 6:123557891-123557913 CAGGCTAAGGGAGAAGAGGGAGG - Intronic
1014899296 6:126943716-126943738 AAGGTTAAGAGTTAAGAGGAAGG + Intergenic
1015801518 6:137065788-137065810 CAGGCTAAGGGAGAAGAGGGAGG + Intergenic
1016594482 6:145784006-145784028 CAGGAAAAGGGTTAAGAGGCGGG - Intergenic
1017865065 6:158435822-158435844 CAAGATAAGAGTGCAGATGAGGG - Intronic
1018285219 6:162230443-162230465 CAGGGGAAGAGTGAAGAGGAAGG + Intronic
1018479418 6:164174844-164174866 AAGGAGAAGCATGAATAGGATGG + Intergenic
1018972136 6:168536985-168537007 CAGGACAAGAGTGAAAATGAAGG + Intronic
1018996609 6:168715067-168715089 GAGGATGATGGTGAAGAGGAGGG + Intergenic
1022710189 7:32842323-32842345 CAGGCTAAGGGAGAAGAGGGAGG + Intergenic
1022925409 7:35051576-35051598 CAGAAAGAGCGTGAAGATGATGG + Intergenic
1023925526 7:44666696-44666718 CAGGACAAGCCAGATGAGGAGGG - Intronic
1026418273 7:70205850-70205872 TAGCATAAGCTTTAAGAGGAGGG + Intronic
1029056926 7:97755373-97755395 CAGGACAAGTGTGGAGAGGGAGG - Intergenic
1029316955 7:99724171-99724193 CAGGCTAAGGGAGAAGAAGAGGG - Intronic
1029354377 7:100040647-100040669 AAGGAGAAGGGGGAAGAGGACGG + Exonic
1029526960 7:101100620-101100642 CACGGAAAGAGTGAAGAGGAGGG - Intergenic
1029709692 7:102292952-102292974 CAGGAGCACCGGGAAGAGGAGGG - Intronic
1029750378 7:102539626-102539648 CAGGAGGACCGTGAGGAGGACGG + Intronic
1029768330 7:102638734-102638756 CAGGAGGACCGTGAGGAGGACGG + Exonic
1029805445 7:102991293-102991315 CAGGATATGGGGGAAAAGGAAGG + Intronic
1029915748 7:104208107-104208129 CAGGACCAGCGAGAAGAGGATGG - Intergenic
1030193277 7:106830609-106830631 CAGGCTAAGGGGGAAGAGGGAGG - Intergenic
1030281302 7:107778243-107778265 CAGGACAATGGTGAAGATGAAGG + Exonic
1030627163 7:111856737-111856759 ACGGGTAAGCGGGAAGAGGAGGG + Intronic
1030879437 7:114858888-114858910 TAGGATGAGCTTGGAGAGGAAGG + Intergenic
1034491732 7:151396487-151396509 CAGGAGCAGCGGGAAGGGGATGG + Intronic
1035095322 7:156349580-156349602 CAAGATAATCGTGAAGATCATGG + Intergenic
1036502799 8:9328994-9329016 CAGGATCAGTGGGAAGAGGTAGG - Intergenic
1037981925 8:23260483-23260505 CAGGAAAATCTTGAAGATGAAGG - Intronic
1040370573 8:46768355-46768377 CAGGACAAGTGTGGAGAGGGAGG + Intergenic
1041772584 8:61487832-61487854 CAGGATGAGTTTGAAAAGGATGG - Intronic
1042705939 8:71665649-71665671 CAGGCTAAGGGAGAAGAGGGAGG - Intergenic
1042757725 8:72235724-72235746 TAGGATATGTGTGAAGAGAAAGG - Intergenic
1043598693 8:81914675-81914697 CAGGCTAAGGGAGAAGAGGGAGG - Intergenic
1044885690 8:96774527-96774549 GATGGTAAGAGTGAAGAGGAGGG + Intronic
1045071898 8:98514981-98515003 GAGGATTAGGGTGAAGAAGAAGG - Intronic
1046808255 8:118504084-118504106 CAGGAAAAGAGGGAAGAGTAAGG - Intronic
1047191719 8:122684419-122684441 CAGAAAAAGCCTGAAGAGGCTGG + Intergenic
1047214989 8:122869095-122869117 GAGGACAAGAGAGAAGAGGAGGG - Intronic
1048115528 8:131517632-131517654 CAGGAGAAAGGAGAAGAGGAGGG - Intergenic
1048529081 8:135231198-135231220 AAGGATAATAGTGAAGAGGGAGG - Intergenic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1049038159 8:140092817-140092839 CAGCATAAGGGTTAAGAGAATGG + Intronic
1051953545 9:22662969-22662991 CAGGCTAAGGGAGAAGAGGGAGG + Intergenic
1053458517 9:38250489-38250511 CAGGACAAGCGGGCATAGGATGG - Intergenic
1053873045 9:42513776-42513798 CAGGATCAGCATAAAGAGGTGGG + Intergenic
1053899707 9:42782144-42782166 CAGGATCAGCATAAAGAGGTGGG - Intergenic
1054261938 9:62875449-62875471 CAGGATCAGCATAAAGAGGTGGG + Intergenic
1054269285 9:62952976-62952998 CAGGATCAGCATAAAGAGGTGGG - Intergenic
1055101261 9:72468001-72468023 CAGGATCAGTGTGGAGGGGAGGG + Intergenic
1055538860 9:77279367-77279389 CAGAAAAAGAGAGAAGAGGAAGG - Intronic
1055887788 9:81085354-81085376 CAGGTTAGGTGTGAAGAGAAAGG - Intergenic
1060404139 9:123364777-123364799 CAGGGTGATGGTGAAGAGGAAGG - Intronic
1061201109 9:129139022-129139044 CAGGATAAGCTGGAGGAGCAGGG + Intronic
1186119721 X:6347246-6347268 CAGAATAGGAGAGAAGAGGAAGG - Intergenic
1186175103 X:6918503-6918525 CAGGTTAAGCCTGTAGAGGCAGG - Intergenic
1187916083 X:24153310-24153332 CAGGAAAGGCATGAAGGGGAAGG - Intronic
1188333171 X:28897059-28897081 CAGGCTAAGGGAGAAGAGGGAGG + Intronic
1189177774 X:38975144-38975166 AAGGTTAAGCGTGAAAAAGAAGG + Intergenic
1189559938 X:42182063-42182085 CAGGGTCAGCGTGAGGAGGAGGG + Intergenic
1189576812 X:42362611-42362633 CAGGATAGACTTGAAGAGGCAGG - Intergenic
1189592576 X:42530686-42530708 CAGGCAAAGTGAGAAGAGGAAGG - Intergenic
1190902941 X:54696394-54696416 CATGATAAGCGGGAAGAGACTGG + Intergenic
1192764805 X:74129616-74129638 CAGGCTAAGGGGGAAGAGGGAGG + Intergenic
1192914283 X:75636721-75636743 CAGGCTAAGGGAGAAGAAGAGGG + Intergenic
1193478945 X:82002935-82002957 GAGGATAAGCAGGAAGAAGAAGG - Intergenic
1195453744 X:105044527-105044549 AAGCCTAAGCCTGAAGAGGAGGG + Intronic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1198006800 X:132503238-132503260 CAGAATAAGCCAGAGGAGGAGGG + Intergenic
1198211483 X:134520632-134520654 CAGGATAAGCCTAAATAAGAAGG + Intergenic
1199377774 X:147133570-147133592 CAGGCTAAGGGAGAAGAGGGAGG + Intergenic
1200007986 X:153100477-153100499 CAGGCTAAGGGGGAAGAGGGAGG + Intergenic