ID: 1181898320

View in Genome Browser
Species Human (GRCh38)
Location 22:26130722-26130744
Sequence AGTGTTGGCGAGGATGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181898320_1181898325 -8 Left 1181898320 22:26130722-26130744 CCCTCCACATCCTCGCCAACACT No data
Right 1181898325 22:26130737-26130759 CCAACACTTGTTATTTTTTGTGG No data
1181898320_1181898329 27 Left 1181898320 22:26130722-26130744 CCCTCCACATCCTCGCCAACACT No data
Right 1181898329 22:26130772-26130794 CTGTCCTGATGGATGAGAGGTGG No data
1181898320_1181898327 16 Left 1181898320 22:26130722-26130744 CCCTCCACATCCTCGCCAACACT No data
Right 1181898327 22:26130761-26130783 TTGGATAGTAACTGTCCTGATGG No data
1181898320_1181898326 -3 Left 1181898320 22:26130722-26130744 CCCTCCACATCCTCGCCAACACT No data
Right 1181898326 22:26130742-26130764 ACTTGTTATTTTTTGTGGTTTGG No data
1181898320_1181898328 24 Left 1181898320 22:26130722-26130744 CCCTCCACATCCTCGCCAACACT No data
Right 1181898328 22:26130769-26130791 TAACTGTCCTGATGGATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181898320 Original CRISPR AGTGTTGGCGAGGATGTGGA GGG (reversed) Intergenic
No off target data available for this crispr