ID: 1181900778

View in Genome Browser
Species Human (GRCh38)
Location 22:26154112-26154134
Sequence CCGTTATTGACAGGCACTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181900778_1181900782 7 Left 1181900778 22:26154112-26154134 CCATTAGTGCCTGTCAATAACGG No data
Right 1181900782 22:26154142-26154164 GCCTGAAATGCTCAAGTGGCTGG No data
1181900778_1181900784 8 Left 1181900778 22:26154112-26154134 CCATTAGTGCCTGTCAATAACGG No data
Right 1181900784 22:26154143-26154165 CCTGAAATGCTCAAGTGGCTGGG No data
1181900778_1181900785 16 Left 1181900778 22:26154112-26154134 CCATTAGTGCCTGTCAATAACGG No data
Right 1181900785 22:26154151-26154173 GCTCAAGTGGCTGGGAGCTTTGG No data
1181900778_1181900781 3 Left 1181900778 22:26154112-26154134 CCATTAGTGCCTGTCAATAACGG No data
Right 1181900781 22:26154138-26154160 ATGTGCCTGAAATGCTCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181900778 Original CRISPR CCGTTATTGACAGGCACTAA TGG (reversed) Intergenic
No off target data available for this crispr