ID: 1181900780

View in Genome Browser
Species Human (GRCh38)
Location 22:26154121-26154143
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181900780_1181900786 28 Left 1181900780 22:26154121-26154143 CCTGTCAATAACGGAGAATGTGC No data
Right 1181900786 22:26154172-26154194 GGAAATCTCATCTCTTCTAACGG No data
1181900780_1181900781 -6 Left 1181900780 22:26154121-26154143 CCTGTCAATAACGGAGAATGTGC No data
Right 1181900781 22:26154138-26154160 ATGTGCCTGAAATGCTCAAGTGG No data
1181900780_1181900782 -2 Left 1181900780 22:26154121-26154143 CCTGTCAATAACGGAGAATGTGC No data
Right 1181900782 22:26154142-26154164 GCCTGAAATGCTCAAGTGGCTGG No data
1181900780_1181900785 7 Left 1181900780 22:26154121-26154143 CCTGTCAATAACGGAGAATGTGC No data
Right 1181900785 22:26154151-26154173 GCTCAAGTGGCTGGGAGCTTTGG No data
1181900780_1181900784 -1 Left 1181900780 22:26154121-26154143 CCTGTCAATAACGGAGAATGTGC No data
Right 1181900784 22:26154143-26154165 CCTGAAATGCTCAAGTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181900780 Original CRISPR GCACATTCTCCGTTATTGAC AGG (reversed) Intergenic