ID: 1181900782

View in Genome Browser
Species Human (GRCh38)
Location 22:26154142-26154164
Sequence GCCTGAAATGCTCAAGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181900777_1181900782 8 Left 1181900777 22:26154111-26154133 CCCATTAGTGCCTGTCAATAACG No data
Right 1181900782 22:26154142-26154164 GCCTGAAATGCTCAAGTGGCTGG No data
1181900778_1181900782 7 Left 1181900778 22:26154112-26154134 CCATTAGTGCCTGTCAATAACGG No data
Right 1181900782 22:26154142-26154164 GCCTGAAATGCTCAAGTGGCTGG No data
1181900776_1181900782 9 Left 1181900776 22:26154110-26154132 CCCCATTAGTGCCTGTCAATAAC No data
Right 1181900782 22:26154142-26154164 GCCTGAAATGCTCAAGTGGCTGG No data
1181900780_1181900782 -2 Left 1181900780 22:26154121-26154143 CCTGTCAATAACGGAGAATGTGC No data
Right 1181900782 22:26154142-26154164 GCCTGAAATGCTCAAGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181900782 Original CRISPR GCCTGAAATGCTCAAGTGGC TGG Intergenic
No off target data available for this crispr