ID: 1181900783

View in Genome Browser
Species Human (GRCh38)
Location 22:26154143-26154165
Sequence CCCAGCCACTTGAGCATTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181900783_1181900788 10 Left 1181900783 22:26154143-26154165 CCTGAAATGCTCAAGTGGCTGGG No data
Right 1181900788 22:26154176-26154198 ATCTCATCTCTTCTAACGGAGGG No data
1181900783_1181900786 6 Left 1181900783 22:26154143-26154165 CCTGAAATGCTCAAGTGGCTGGG No data
Right 1181900786 22:26154172-26154194 GGAAATCTCATCTCTTCTAACGG No data
1181900783_1181900789 19 Left 1181900783 22:26154143-26154165 CCTGAAATGCTCAAGTGGCTGGG No data
Right 1181900789 22:26154185-26154207 CTTCTAACGGAGGGCAGCTCTGG No data
1181900783_1181900787 9 Left 1181900783 22:26154143-26154165 CCTGAAATGCTCAAGTGGCTGGG No data
Right 1181900787 22:26154175-26154197 AATCTCATCTCTTCTAACGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181900783 Original CRISPR CCCAGCCACTTGAGCATTTC AGG (reversed) Intergenic