ID: 1181900786

View in Genome Browser
Species Human (GRCh38)
Location 22:26154172-26154194
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181900780_1181900786 28 Left 1181900780 22:26154121-26154143 CCTGTCAATAACGGAGAATGTGC No data
Right 1181900786 22:26154172-26154194 GGAAATCTCATCTCTTCTAACGG No data
1181900783_1181900786 6 Left 1181900783 22:26154143-26154165 CCTGAAATGCTCAAGTGGCTGGG No data
Right 1181900786 22:26154172-26154194 GGAAATCTCATCTCTTCTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181900786 Original CRISPR GGAAATCTCATCTCTTCTAA CGG Intergenic