ID: 1181902752

View in Genome Browser
Species Human (GRCh38)
Location 22:26169579-26169601
Sequence GGCGGCGGTGAGCGAGAAAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 199}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181902752_1181902766 23 Left 1181902752 22:26169579-26169601 CCCCTTTCTCGCTCACCGCCGCC 0: 1
1: 0
2: 0
3: 15
4: 199
Right 1181902766 22:26169625-26169647 TCCGCCCGCCCCACAGCCAGCGG 0: 1
1: 0
2: 1
3: 17
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181902752 Original CRISPR GGCGGCGGTGAGCGAGAAAG GGG (reversed) Exonic