ID: 1181902752 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:26169579-26169601 |
| Sequence | GGCGGCGGTGAGCGAGAAAG GGG (reversed) |
| Strand | - |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 215 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 15, 4: 199} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1181902752_1181902766 | 23 | Left | 1181902752 | 22:26169579-26169601 | CCCCTTTCTCGCTCACCGCCGCC | 0: 1 1: 0 2: 0 3: 15 4: 199 |
||
| Right | 1181902766 | 22:26169625-26169647 | TCCGCCCGCCCCACAGCCAGCGG | 0: 1 1: 0 2: 1 3: 17 4: 214 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1181902752 | Original CRISPR | GGCGGCGGTGAGCGAGAAAG GGG (reversed) | Exonic | ||