ID: 1181903653

View in Genome Browser
Species Human (GRCh38)
Location 22:26175739-26175761
Sequence GAACTCACATTGTATAAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 207}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181903648_1181903653 1 Left 1181903648 22:26175715-26175737 CCAGGTCACCCAACCATTAATGG 0: 1
1: 0
2: 0
3: 12
4: 76
Right 1181903653 22:26175739-26175761 GAACTCACATTGTATAAAATTGG 0: 1
1: 0
2: 0
3: 15
4: 207
1181903651_1181903653 -8 Left 1181903651 22:26175724-26175746 CCAACCATTAATGGAGAACTCAC 0: 1
1: 0
2: 0
3: 11
4: 101
Right 1181903653 22:26175739-26175761 GAACTCACATTGTATAAAATTGG 0: 1
1: 0
2: 0
3: 15
4: 207
1181903650_1181903653 -7 Left 1181903650 22:26175723-26175745 CCCAACCATTAATGGAGAACTCA 0: 1
1: 0
2: 1
3: 10
4: 147
Right 1181903653 22:26175739-26175761 GAACTCACATTGTATAAAATTGG 0: 1
1: 0
2: 0
3: 15
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181903653 Original CRISPR GAACTCACATTGTATAAAAT TGG Intronic
904982255 1:34516084-34516106 GAACTCAAAATGGATCAAATGGG - Intergenic
907667357 1:56445063-56445085 CAACTCACATTGCATAACCTTGG + Intergenic
910530063 1:88225672-88225694 GTACTCACATGGTATCAAATTGG - Intergenic
911319404 1:96394658-96394680 AAACTCACATGGCATAAAACAGG - Intergenic
911337381 1:96597060-96597082 AAACTTACATTTTATAAAAGAGG - Intergenic
912536557 1:110377562-110377584 GAAGTCATATTGTAGAAGATTGG + Intronic
913085575 1:115433575-115433597 GAACTAAAATTTTAAAAAATGGG + Intergenic
915758686 1:158288899-158288921 CAAAACACATTGTATAAAAAGGG - Intergenic
919093751 1:193004701-193004723 CAGCTAACATTGTATTAAATGGG + Intergenic
919425606 1:197426538-197426560 AAACTGACATTGTAAAATATGGG - Intronic
919500624 1:198333635-198333657 AAAATATCATTGTATAAAATTGG - Intergenic
920956724 1:210626382-210626404 GAACTCTGATTCTATAAAAGTGG + Intronic
922430555 1:225548313-225548335 TGACTCACATTTTATAAATTAGG + Intronic
923504866 1:234596564-234596586 GAACTGCCATTTTGTAAAATGGG + Intergenic
1063595631 10:7432702-7432724 GAAGTCACATTAAAAAAAATGGG + Intergenic
1064147548 10:12837513-12837535 GACATCACACTGTAGAAAATGGG + Intergenic
1065091575 10:22239983-22240005 GAACAACTATTGTATAAAATCGG + Intergenic
1067383740 10:45799338-45799360 GAAGTCATATTGTCTAGAATTGG + Intergenic
1067880443 10:50039454-50039476 GAAGTCATATTGTCTAGAATTGG - Intergenic
1067891438 10:50139913-50139935 GAAGTCATATTGTCTAGAATTGG + Intergenic
1067905361 10:50285173-50285195 GAACACATTTTGTAGAAAATTGG + Intergenic
1068077687 10:52277373-52277395 TAACTAACATAGTATAGAATAGG - Intronic
1068373614 10:56150938-56150960 TAACTAACATTGTATTGAATGGG + Intergenic
1068564300 10:58554721-58554743 GATATCACATTGTTTAAATTAGG - Intronic
1069042545 10:63710463-63710485 GAACCCACATTGTACCAAAGTGG - Intergenic
1069661143 10:70124227-70124249 TAATTCAAATTTTATAAAATTGG - Intronic
1069807959 10:71137739-71137761 AAACTCCCATTTTATAGAATGGG + Intergenic
1070268932 10:74932968-74932990 GAGCTCAAATTGTATAAAGAAGG - Intronic
1071809401 10:89162505-89162527 AAAGTCACATTGTATAAAAGAGG - Intergenic
1072208776 10:93227457-93227479 GAGCTCACATTGGTTAAATTTGG + Intergenic
1075348943 10:121706465-121706487 ATACTCACCCTGTATAAAATAGG - Intergenic
1075349486 10:121710905-121710927 TACCCCACAGTGTATAAAATAGG - Intergenic
1075790580 10:125081754-125081776 GAAATCACATTGCAAAAATTTGG - Intronic
1075935628 10:126338598-126338620 AGTCTCACAGTGTATAAAATGGG - Intronic
1077758380 11:5061349-5061371 CATCCCACATTTTATAAAATGGG - Intergenic
1081318604 11:41662434-41662456 GAACTCAATTTGTAGAACATAGG - Intergenic
1084677076 11:70641800-70641822 GGACACACAATGTCTAAAATGGG + Intronic
1084837807 11:71816650-71816672 GAACTCACCTTGGAGAAAAGTGG - Intergenic
1084856223 11:71988846-71988868 GCACTCTCACTATATAAAATAGG - Intronic
1085398855 11:76223096-76223118 GAACTCTCATAATGTAAAATAGG - Intergenic
1086050601 11:82585303-82585325 GCAGTCACATTGTGGAAAATTGG + Intergenic
1086569852 11:88269383-88269405 GAAATCACATTGAATATAAATGG + Intergenic
1087947569 11:104182393-104182415 GTACCCACATTTTAAAAAATAGG - Intergenic
1089043683 11:115480269-115480291 GAATTCCCAGTGTACAAAATGGG + Intronic
1089133256 11:116228986-116229008 AAACTCACATTGTAAAGAGTAGG + Intergenic
1090498781 11:127241363-127241385 GAACGCATATTCTTTAAAATGGG + Intergenic
1092808124 12:12246307-12246329 GAATTAAGATTATATAAAATTGG - Intronic
1097446995 12:59683700-59683722 GAACACACCTTGAATAAAAGTGG + Intronic
1098838628 12:75452146-75452168 GAACAAAGATTGTAAAAAATAGG - Intergenic
1099236585 12:80090019-80090041 AAATTCACATGGTATAAAAAAGG + Intergenic
1100003849 12:89870316-89870338 GAACTCAACTTATAAAAAATTGG - Intergenic
1101792842 12:107945274-107945296 TAGCTAACATTGTATTAAATTGG + Intergenic
1103254870 12:119532317-119532339 GAACTCACCTCATATAAAAGAGG - Intronic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1109670097 13:65593475-65593497 GAACTCACATGTTATAATAGTGG - Intergenic
1110773590 13:79379181-79379203 GAATTCAGATTTTATAAAAGTGG + Intronic
1111391436 13:87600654-87600676 AAACTCACATTCTGCAAAATTGG - Intergenic
1111657133 13:91167845-91167867 GAACTCACCTTATGTAAACTTGG - Intergenic
1113187406 13:107704574-107704596 GAATCCACACTGTATAAAACTGG - Intronic
1114179524 14:20353997-20354019 GCATTTACATTGTATAATATTGG + Intronic
1118025655 14:61765638-61765660 GAAGTCACTTTGAATAGAATGGG + Intronic
1118184897 14:63528230-63528252 AAACTTACATTTTATAATATTGG - Intronic
1118791433 14:69096872-69096894 GACCTCACAGTGCATAAAACTGG + Intronic
1120036668 14:79705860-79705882 GAACTCACAATCTACTAAATAGG - Intronic
1125350059 15:38757045-38757067 GAACTTACATTGTGTACAAATGG - Intergenic
1125470550 15:39998459-39998481 GACCTCACATACTATAACATTGG - Intronic
1125545691 15:40502695-40502717 TAAAACACATTGCATAAAATAGG + Intergenic
1125937137 15:43647023-43647045 GAACTGACCTTGTATGAAAGAGG - Intronic
1125949985 15:43744124-43744146 GAACTGACATTGTATGAAAGAGG - Intergenic
1126344551 15:47679070-47679092 GAATACACAGTGTATAACATCGG - Intronic
1127951407 15:63810581-63810603 AAACTTACATAGTATAAAAAAGG - Intronic
1130097736 15:80868367-80868389 GAACCCACATTCTGTAAAATGGG - Intronic
1130714158 15:86315138-86315160 AAAATGGCATTGTATAAAATGGG - Intronic
1134457435 16:14405303-14405325 GAACTGACATTGTAGAACAAGGG - Intergenic
1137741433 16:50779921-50779943 GAACTCACATGGTCTAGAAGTGG + Exonic
1138578156 16:57922048-57922070 GGACTCACATTTTATGAGATAGG - Intronic
1138664008 16:58547558-58547580 AAACTCACAGTGTGTAAGATGGG + Exonic
1141404912 16:83784265-83784287 GAAATCACATAGTACAACATTGG + Intronic
1146109235 17:30072986-30073008 GAACTCCCATTGTCTAAAACTGG - Intronic
1147486616 17:40821391-40821413 GAAATCACATAGTCTAAAAGAGG - Intronic
1149150326 17:53554427-53554449 GAATTAACATTTTATAAATTGGG - Intergenic
1149734148 17:58976430-58976452 GAAACCACATGGAATAAAATGGG + Intronic
1153088267 18:1314576-1314598 AAACTCAAATTTAATAAAATCGG - Intergenic
1156903553 18:42328630-42328652 GAAACCCCACTGTATAAAATGGG - Intergenic
1156927679 18:42602239-42602261 GAACTTACCTTAGATAAAATTGG + Intergenic
1158289475 18:55923105-55923127 GATGTCACATTGTATCATATGGG - Intergenic
1158324056 18:56295074-56295096 CAGCTAACATTCTATAAAATTGG + Intergenic
1159148600 18:64489208-64489230 TAATTTACATTGTCTAAAATGGG + Intergenic
1162258647 19:9514293-9514315 GCACTCTCAATGTAGAAAATTGG - Intergenic
925877318 2:8323688-8323710 GTACCGACATTCTATAAAATGGG + Intergenic
926740505 2:16106652-16106674 AAACTCTCATTTTATAAATTGGG + Intergenic
928324777 2:30310840-30310862 GAACTCACATTTTTTAAAAAGGG - Intronic
928402856 2:30991897-30991919 GTACTCACATTGTGGAAACTGGG - Intronic
928562524 2:32505512-32505534 AAACTAACATGGTAAAAAATGGG - Intronic
929494408 2:42427638-42427660 GAACTATCATTGTATAAAAATGG + Intergenic
929883549 2:45858493-45858515 GAACTTATATTGTATATCATGGG + Intronic
930707459 2:54519009-54519031 GAAGTCACATTTTTTAAAATAGG - Intronic
930805200 2:55483437-55483459 GGAATCCCCTTGTATAAAATTGG - Intergenic
930960699 2:57257145-57257167 GAACTGAAGTTGTACAAAATTGG + Intergenic
933770402 2:85740476-85740498 GAGCTCCCACTGGATAAAATGGG + Intergenic
936993605 2:118391269-118391291 GAATACACATTCTACAAAATGGG + Intergenic
937501949 2:122488694-122488716 CAAGTCACATTGCATTAAATTGG - Intergenic
937699680 2:124850291-124850313 GAAGTCATACTGGATAAAATGGG + Intronic
937806833 2:126155169-126155191 AAACTCCTATAGTATAAAATAGG - Intergenic
938708931 2:133958633-133958655 TAACTCAAATTTTACAAAATGGG - Intergenic
940679664 2:156770133-156770155 GAACTTACATTGTACATAGTTGG - Intergenic
940722833 2:157300386-157300408 GAACTCATGTTTTACAAAATGGG + Intronic
940740888 2:157506294-157506316 CAACTTACATTTTATGAAATGGG - Intergenic
941383810 2:164828565-164828587 GCACTCACTGTGTATAAAAAAGG + Intronic
941443977 2:165578056-165578078 GAACTTACTTTATATCAAATAGG + Intronic
942579724 2:177404873-177404895 GCACTCAGATTTTATACAATTGG + Intronic
942687773 2:178551887-178551909 GAAGTCACATTGTATATAACTGG + Exonic
942749597 2:179272868-179272890 GAAGTCTCATTGCATAAAGTCGG + Intergenic
943026874 2:182640314-182640336 GAACTGACACTGAATAAAAGTGG + Intergenic
944323929 2:198381146-198381168 GAAGTCACATTCTATACACTTGG + Intronic
944598048 2:201280298-201280320 GAACTCTTATTGTCAAAAATTGG - Intronic
945432141 2:209776943-209776965 TAGGTCACATTGTCTAAAATAGG + Intronic
945751464 2:213790628-213790650 ATGCTCACATTGTATATAATTGG - Intronic
1169048559 20:2557967-2557989 AAACTTACATTAAATAAAATTGG - Intronic
1173941412 20:46914251-46914273 GAACTCACACTTAAAAAAATAGG + Intronic
1175603756 20:60295968-60295990 GAACTCGCGTTATTTAAAATGGG + Intergenic
1177502889 21:21982013-21982035 CAACTCACATTGTTTGAAAGTGG - Intergenic
1177687504 21:24457252-24457274 AAACTTATATTGTATAAAGTTGG + Intergenic
1179287775 21:39992872-39992894 GAACTCACATTGGAAGAAAACGG - Intergenic
1181903653 22:26175739-26175761 GAACTCACATTGTATAAAATTGG + Intronic
1182064739 22:27422389-27422411 GAAATCTCACTGTATAATATTGG - Intergenic
950324307 3:12091200-12091222 GAACAATCATTGTGTAAAATTGG + Intronic
951270433 3:20617724-20617746 CAACACACAATGCATAAAATGGG - Intergenic
955984444 3:64558496-64558518 CTCCTCACATTGTATAAAAATGG + Intronic
956599120 3:71000175-71000197 GAACTCACATTTAAAAAAAAAGG + Intronic
959665752 3:108918800-108918822 GAACACACTTTCTATATAATGGG - Intronic
960059084 3:113300696-113300718 GAACAGACATTTTATAGAATAGG + Intronic
960701982 3:120448600-120448622 GAACTCACAGTGTATGGAAATGG - Intronic
960950314 3:122994821-122994843 GAAATCAAATTGGATGAAATGGG + Intronic
963439323 3:145316842-145316864 GAAATCTGATTGTAAAAAATGGG - Intergenic
965114417 3:164469595-164469617 GGAGTGACATTGAATAAAATGGG - Intergenic
965362542 3:167759178-167759200 GAACTCAAAGTCTATAAAATGGG - Intronic
965910379 3:173768250-173768272 GAACTCACATAGTAGGAATTAGG - Intronic
966758245 3:183391476-183391498 GTAGTCACATTTTATAAAAAGGG + Intronic
970791092 4:19858837-19858859 GAAGTATCATTGTATAGAATTGG + Intergenic
971657039 4:29361764-29361786 TAACTTACATTCTATAAAACAGG - Intergenic
971925808 4:33008028-33008050 GAAGTCTCATTGAATAAAATAGG + Intergenic
973286597 4:48424688-48424710 GAAATCACATTTTGTAAAACTGG + Exonic
974290596 4:59925226-59925248 ATAATTACATTGTATAAAATGGG - Intergenic
974473052 4:62343143-62343165 GAACTAAAATTGTACAATATGGG - Intergenic
974887701 4:67840719-67840741 ATAATCACATTGTGTAAAATGGG - Intronic
975033155 4:69649003-69649025 TAACGCACATTGGATAATATCGG + Intronic
977525965 4:98145248-98145270 GAACTCCCTTTGTCTAAATTAGG - Intergenic
978015050 4:103733908-103733930 GAAATTACATTTTAAAAAATGGG - Intergenic
979045555 4:115858268-115858290 GAACACAGATTTTATAAAATAGG - Intergenic
980710333 4:136557866-136557888 GAACTTTCATTATATAAAACAGG - Intergenic
980747473 4:137037412-137037434 GAACTCAAATAAAATAAAATAGG + Intergenic
981692182 4:147522070-147522092 GAAATCACTTTGAATATAATCGG + Intronic
985134647 4:186774143-186774165 GAAATTACATTGTATCAAGTAGG + Intergenic
985408729 4:189661946-189661968 GAACTCAAATTGTAAAACATGGG - Intergenic
988885250 5:35550169-35550191 GAATTCTCATTTTATAGAATTGG + Intergenic
989231266 5:39089252-39089274 CAACTAACATTGTATAGGATGGG + Intergenic
989274018 5:39565705-39565727 TAACTCACTTTGGATACAATGGG + Intergenic
990150034 5:52807059-52807081 GAACTAACATTCTAAAGAATGGG - Intronic
990548598 5:56849549-56849571 GAAGTAACAATGTATAAAAATGG - Intronic
991395859 5:66204643-66204665 GAACACAAATTGTATTAACTTGG - Intergenic
991596251 5:68309606-68309628 ATACACACATTGAATAAAATGGG - Intergenic
993339305 5:86703276-86703298 GAACTGACATTGTAAGAGATAGG + Intergenic
994010274 5:94894338-94894360 AAAGTCACATTGTATAAACCTGG + Intronic
994947425 5:106414176-106414198 CAAGTCCCATTATATAAAATGGG - Intergenic
995096893 5:108246718-108246740 GAATTCACATAATATAAACTTGG + Intronic
995265969 5:110161082-110161104 AAACTCAAGTTGTCTAAAATTGG + Intergenic
996904620 5:128583945-128583967 GAAGCTACATTGTATACAATGGG - Intronic
997006246 5:129819808-129819830 GCACTTACATTGTACCAAATGGG - Intergenic
997663891 5:135611751-135611773 CAACCAACATTGTAGAAAATAGG + Intergenic
999833627 5:155344705-155344727 GATCTCACACTGAATAAAGTTGG + Intergenic
1000174946 5:158742814-158742836 GAACTTACATTGTTTTAAAATGG - Intronic
1000726120 5:164772968-164772990 AAAATCAAATTGAATAAAATTGG - Intergenic
1000748700 5:165068038-165068060 GTATTCACATTTTTTAAAATTGG + Intergenic
1003484814 6:6566417-6566439 GAACTCACATAGTTTATAGTTGG + Intergenic
1004341950 6:14815625-14815647 TAACTCTCATTGTTTAGAATAGG + Intergenic
1004427257 6:15514714-15514736 CAAATCACATTGTATCAGATAGG + Intronic
1005211532 6:23470532-23470554 GAATACACATTGCGTAAAATTGG - Intergenic
1005235629 6:23758744-23758766 GAACAAACATTTTTTAAAATAGG + Intergenic
1017517891 6:155174094-155174116 TAACTCCCTTTATATAAAATGGG - Intronic
1017568723 6:155717689-155717711 CAACTAACATTGTACTAAATGGG - Intergenic
1017756979 6:157538064-157538086 CAACTCACTTTTTATAAAAGTGG - Intronic
1018589658 6:165405408-165405430 GAATTGAAATTTTATAAAATTGG + Intronic
1018914579 6:168125262-168125284 GAACTCCCCTTCTATAAAGTAGG - Intergenic
1020983223 7:15097587-15097609 GAAATAATATTTTATAAAATAGG + Intergenic
1021391528 7:20099177-20099199 GAACCCACTGGGTATAAAATAGG + Intergenic
1021542082 7:21770916-21770938 AAACTTACAATGCATAAAATGGG - Intronic
1023553627 7:41396722-41396744 AAACTCACATAGGAAAAAATAGG - Intergenic
1024661947 7:51504266-51504288 GAAATTACATTGAATAAAATAGG - Intergenic
1025194770 7:56924220-56924242 GATCTAACCTTGTATAATATAGG + Intergenic
1025677182 7:63652723-63652745 GATCTAACCTTGTATAATATAGG - Intergenic
1027586095 7:80060952-80060974 GGACTGACATTGTGTTAAATAGG - Intergenic
1027848225 7:83413125-83413147 GAGTTCACATTGTAAAAAAAAGG - Intronic
1027950149 7:84804784-84804806 CAACTCACCTAATATAAAATGGG - Intergenic
1028358022 7:89933016-89933038 GAACTAATATTATAGAAAATAGG + Intergenic
1028994930 7:97089842-97089864 GGAGTCGCATTGTATAGAATTGG + Intergenic
1031498043 7:122476084-122476106 AATCACACATTTTATAAAATTGG + Intronic
1032558937 7:132867840-132867862 GAAAGTACATTATATAAAATAGG + Intronic
1037317327 8:17611258-17611280 TAACTCACATTGGATAAAAAAGG + Intronic
1041616776 8:59916621-59916643 GAACACAAATTGTTTGAAATGGG - Intergenic
1043167950 8:76927660-76927682 AAACTAAAATTGTATAATATTGG - Intergenic
1043758764 8:84037406-84037428 GAAATAAATTTGTATAAAATTGG + Intergenic
1046090859 8:109501319-109501341 GAACTCACGTTCGACAAAATAGG - Intronic
1047786758 8:128160909-128160931 GAACTCTCATTGCATACAAAGGG - Intergenic
1052043839 9:23771770-23771792 TAAGTCACATTTTGTAAAATGGG + Intronic
1052234643 9:26195349-26195371 GAAGACTCATTTTATAAAATAGG - Intergenic
1056203849 9:84301459-84301481 TATCTCCCATTGAATAAAATTGG + Intronic
1058225139 9:102350946-102350968 TAACTGACATTGTAAATAATGGG + Intergenic
1059084899 9:111289822-111289844 GAAGTGACATTGAATAAAACTGG + Intergenic
1187380461 X:18797074-18797096 GAGCTGACATTGGGTAAAATGGG + Intronic
1187824706 X:23323353-23323375 GCAATCACATTGAAGAAAATAGG - Intergenic
1188573655 X:31619893-31619915 AAACTCATATTGCATTAAATTGG + Intronic
1188633892 X:32404108-32404130 TAACTCACATTAAATATAATCGG - Intronic
1191633634 X:63351978-63352000 GTACTTATATTTTATAAAATTGG + Intergenic
1191702299 X:64055691-64055713 GAATTCACACTGTGTAATATGGG - Intergenic
1191960398 X:66694837-66694859 CAACTCACATTGTAGAAGACAGG + Intergenic
1194891140 X:99381150-99381172 GAACTCACATTCTGGAAGATTGG - Intergenic
1195612345 X:106882138-106882160 GAACTGACATAGTTGAAAATTGG - Intronic
1197306679 X:124850860-124850882 AAAATCACACTCTATAAAATCGG - Intronic
1198674254 X:139115295-139115317 GTAGTCACACTGAATAAAATGGG - Intronic
1199403729 X:147430964-147430986 GAAATCACAATGTATGAAACTGG + Intergenic
1200859835 Y:7978959-7978981 TAACTCATATTCTATAAACTTGG - Intergenic
1201550588 Y:15212975-15212997 GTACTCAGATTTTATAAAAATGG - Intergenic