ID: 1181905634

View in Genome Browser
Species Human (GRCh38)
Location 22:26193386-26193408
Sequence GTAACATACTCAAGATCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 1, 2: 9, 3: 90, 4: 459}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181905626_1181905634 26 Left 1181905626 22:26193337-26193359 CCTGTCTCCCTTTTTTAATGATG 0: 1
1: 0
2: 0
3: 32
4: 356
Right 1181905634 22:26193386-26193408 GTAACATACTCAAGATCACAAGG 0: 1
1: 1
2: 9
3: 90
4: 459
1181905628_1181905634 18 Left 1181905628 22:26193345-26193367 CCTTTTTTAATGATGAAGCATGT 0: 1
1: 0
2: 3
3: 24
4: 322
Right 1181905634 22:26193386-26193408 GTAACATACTCAAGATCACAAGG 0: 1
1: 1
2: 9
3: 90
4: 459
1181905633_1181905634 -6 Left 1181905633 22:26193369-26193391 CCACACAGGGAGTGGAGGTAACA 0: 1
1: 0
2: 1
3: 11
4: 163
Right 1181905634 22:26193386-26193408 GTAACATACTCAAGATCACAAGG 0: 1
1: 1
2: 9
3: 90
4: 459
1181905627_1181905634 19 Left 1181905627 22:26193344-26193366 CCCTTTTTTAATGATGAAGCATG 0: 1
1: 0
2: 2
3: 22
4: 302
Right 1181905634 22:26193386-26193408 GTAACATACTCAAGATCACAAGG 0: 1
1: 1
2: 9
3: 90
4: 459

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181905634 Original CRISPR GTAACATACTCAAGATCACA AGG Intronic
900813599 1:4826564-4826586 GTAACATGCTCACCAACACATGG - Intergenic
900885899 1:5415212-5415234 GTGACTTGCTCAAGGTCACAGGG - Intergenic
901931698 1:12600068-12600090 GTAACTTGCTCAAGGTCACACGG + Intronic
902217464 1:14943664-14943686 GTGACCTGCTCAAGATCACTTGG + Intronic
902376380 1:16031956-16031978 GTGACTTGCTCAAGGTCACACGG - Intronic
902434228 1:16386983-16387005 GGAACTTACCCAAGGTCACAAGG - Intronic
903418938 1:23204503-23204525 GTGACTTGCCCAAGATCACATGG + Intergenic
903464782 1:23544610-23544632 GTAACTTACCCAAGGCCACAGGG + Intergenic
903496240 1:23769514-23769536 GTGACATGCTCAAGTCCACATGG - Intergenic
903569377 1:24293206-24293228 GTAATCTGCTCAAGGTCACAGGG - Intergenic
903703896 1:25270717-25270739 GTGACTTGCTCAAGGTCACAGGG - Intronic
903723345 1:25422607-25422629 GTGACTTGCTCAAGGTCACAGGG + Intronic
903976816 1:27155442-27155464 GTAACTTGCTCAAGGTCACACGG - Intronic
904417807 1:30373758-30373780 GTGACACACCCAAGGTCACACGG + Intergenic
904583985 1:31569003-31569025 GTGACTTGCTCAAGGTCACATGG + Intergenic
904703856 1:32375900-32375922 GTAACTTGCCCAAGTTCACATGG - Intronic
904752477 1:32749532-32749554 GTGACTTGCTCAAGTTCACATGG + Intronic
905002858 1:34686744-34686766 GTGACATACTCAAGGTCACATGG - Intergenic
905087970 1:35400527-35400549 GTAAAATAGTGAAGTTCACATGG + Intronic
905333484 1:37226347-37226369 GCAACAGACTCAAGATTTCAAGG + Intergenic
906238613 1:44227804-44227826 GGAACTTGCTCAAGTTCACATGG - Intronic
906441074 1:45845636-45845658 GTAACATAATTAAAATCACTGGG + Intronic
906539485 1:46574242-46574264 GTGACTTGCCCAAGATCACATGG + Intronic
906912777 1:49972993-49973015 CTAACCTGCCCAAGATCACATGG + Intronic
907156669 1:52341258-52341280 TTAACTTGCTCAAGATTACAAGG + Intronic
907290873 1:53412112-53412134 GTAACAAGCCCAAGGTCACACGG - Intergenic
907490245 1:54804864-54804886 GTGACTTGCTCAAGATCCCACGG + Intergenic
908255318 1:62298607-62298629 GTGACTTACCCAAGGTCACACGG - Intronic
908583367 1:65541607-65541629 TTAACATACTTAAAATGACAAGG + Intronic
910476045 1:87608620-87608642 ATCACATACTCAAAATCACACGG + Intergenic
911997346 1:104783554-104783576 GCAACAAATTCAAGATAACAGGG - Intergenic
913044073 1:115058466-115058488 GTAACTTGCTCAAGGTCACAAGG + Intronic
913413663 1:118580827-118580849 GTCACATACTCAGCATCAAAAGG - Intergenic
915525030 1:156470670-156470692 GTAACTTACCCAAGGTCACATGG - Intronic
915960207 1:160260250-160260272 GTAACTTGCTCAAGGTCACATGG + Intronic
916147428 1:161752112-161752134 ATAACCTATTCAAAATCACATGG + Intronic
917011185 1:170473457-170473479 GTAGCATATTCAAGGTCCCAGGG - Intergenic
917437865 1:175039292-175039314 GTAACTTGCTCAAGGTCCCAGGG - Intergenic
917630726 1:176888838-176888860 GTAACTTGCCCAAGGTCACATGG - Intronic
917733492 1:177899462-177899484 GTAACTTACCCAAGGTTACAAGG + Intergenic
919196346 1:194291436-194291458 GTAACATCATTAAGATCAAAGGG + Intergenic
919954205 1:202396302-202396324 GTAACATGCCCAAGGTCACATGG - Intronic
920270612 1:204760674-204760696 GTAACTTCCTCAAAATCTCATGG - Intergenic
920577143 1:207069859-207069881 CTAAAACACTCAAGATGACAGGG - Intronic
920872640 1:209806627-209806649 GTAACTTACCCAGGGTCACACGG - Intergenic
920872920 1:209808927-209808949 GTGATTTACTCAAGGTCACATGG + Intergenic
921467025 1:215501148-215501170 GTGCTTTACTCAAGATCACAGGG + Intergenic
921514826 1:216077041-216077063 GTAACTTTCCCAAGGTCACATGG - Intronic
921964604 1:221075166-221075188 GTAACTTTCTCAAGGTCACAAGG - Intergenic
922084312 1:222331360-222331382 GTAACTTGTCCAAGATCACAAGG + Intergenic
922945117 1:229507764-229507786 GTGACTTACACCAGATCACACGG + Intronic
923478282 1:234358095-234358117 ATGACAGACTCAAGATCAAAAGG + Intergenic
923614041 1:235521798-235521820 GTTACCCACTCAAGGTCACAAGG + Intergenic
923641560 1:235766605-235766627 GTAACTTACCTAAGATCACATGG - Intronic
924059048 1:240152937-240152959 GTAACTCACCCAAAATCACAGGG - Intronic
924204799 1:241700668-241700690 GTAACATGCCCAAGACCACATGG - Intronic
924239399 1:242026596-242026618 GTAACAAAACTAAGATCACAAGG + Intergenic
1063215053 10:3916988-3917010 GTAACTTGCTCAAAATCTCATGG + Intergenic
1064382264 10:14856363-14856385 GTAGCTTCCTCAAGATCACACGG + Intronic
1064577778 10:16763463-16763485 GTAACTCACTCACTATCACAAGG + Intronic
1065551890 10:26876326-26876348 GTAACATACTCTTGATCAAGAGG - Intergenic
1066033182 10:31449961-31449983 ATAACATGCTCAAGGTGACAAGG + Intronic
1066506764 10:36053464-36053486 GTGACTTACCCAAGATCACATGG + Intergenic
1067370459 10:45677571-45677593 GTAACCTCCCCAAGGTCACATGG - Intergenic
1067472273 10:46545885-46545907 GTAACTTGCCCAAGATCACATGG + Intergenic
1068767214 10:60777123-60777145 GTGATATACTCTATATCACAAGG + Intergenic
1068856221 10:61799849-61799871 GTAACTTTCCCAAGACCACAAGG - Intergenic
1068885741 10:62095003-62095025 GTAACATACTTAATATCCAAAGG + Exonic
1069861855 10:71476412-71476434 GTGACATGCTCAAGGTCACATGG + Intronic
1069872577 10:71542271-71542293 GTAACTTGCCCAAGGTCACATGG - Intronic
1070492423 10:76990111-76990133 GGAACTTACTCAAAGTCACATGG + Intronic
1070692872 10:78540779-78540801 GTAACTTGCCCAAGATCACAAGG + Intergenic
1070758552 10:79008849-79008871 GTAACGTGCCCAAGGTCACAGGG + Intergenic
1070772852 10:79092380-79092402 GTGACTGACCCAAGATCACATGG - Intronic
1071382977 10:85088261-85088283 TTAACTTACACAAGATTACAAGG + Intergenic
1072237061 10:93462484-93462506 GTAACTTGCTCAAGATCACAGGG + Intronic
1073294596 10:102431493-102431515 GTAACTTGCCCAAGGTCACAAGG + Intronic
1074822012 10:117186699-117186721 GTAACTTGCCCAAGGTCACATGG - Intergenic
1074921315 10:118016773-118016795 GTAACTTGCTCAAGGTCACAGGG - Intronic
1075116184 10:119628902-119628924 GGAACTTACCCAAGGTCACACGG - Intergenic
1075533480 10:123250362-123250384 GTAACTTACCTAAGGTCACATGG + Intergenic
1078742330 11:14078651-14078673 GTAACCTGTTCAAGGTCACAGGG - Intronic
1078868101 11:15317191-15317213 GTAACTTGCCCAAGATCACACGG - Intergenic
1078911644 11:15738235-15738257 GTGACCTTCTCAAGATCACAGGG + Intergenic
1078921103 11:15831397-15831419 GTAACTCACTCAAGGACACATGG - Intergenic
1079052598 11:17175646-17175668 GTAACCCAGTGAAGATCACAAGG + Intronic
1080332110 11:31151141-31151163 GTAGCATGCTCATGAACACAAGG + Intronic
1080432543 11:32212056-32212078 ATAACATCCTGAATATCACATGG - Intergenic
1080700357 11:34639135-34639157 TTAACGTGCTCAAGGTCACATGG + Intronic
1081436297 11:43031091-43031113 GTAACTTACGAAATATCACATGG - Intergenic
1081784420 11:45736825-45736847 GTAACTTACCCAAGATCATGTGG - Intergenic
1083258794 11:61512017-61512039 GTGACTTGCTCAAGATCACTTGG - Intergenic
1085003050 11:73058362-73058384 GTAACATACTCAGTGTGACATGG + Intronic
1085803781 11:79615869-79615891 GTAACTTACCCAAGAACACATGG - Intergenic
1085821577 11:79799217-79799239 GTAACTTAGTCAAGATCACATGG + Intergenic
1087662235 11:101001117-101001139 GTAACTTGCCCAAGGTCACATGG - Intergenic
1087706155 11:101494265-101494287 CTAACATATTAAAGGTCACATGG - Intronic
1089685871 11:120146567-120146589 GTAACCTGCCCAAGGTCACAAGG + Intronic
1090163567 11:124521385-124521407 GTAACTTATTCAAGTTCACCTGG - Intergenic
1091004588 11:131941427-131941449 GTAACTTGCCCAAGGTCACATGG - Intronic
1091992019 12:4963049-4963071 GCAACCTGCCCAAGATCACACGG - Intergenic
1092022495 12:5214235-5214257 TTAACTTACTCAAGGTCATACGG - Intergenic
1092162222 12:6321943-6321965 ATAACTTACCCAAGGTCACATGG - Intronic
1092236808 12:6815544-6815566 GTAACTCACCCAAGGTCACATGG - Intronic
1092275483 12:7057834-7057856 GTAACTTTTTCAAGGTCACACGG + Intronic
1092907415 12:13114679-13114701 ATGACATACTCAAGCTCCCACGG - Intronic
1093224272 12:16462774-16462796 GTAACTTTCCCAAGATCACGTGG + Intronic
1093417655 12:18938579-18938601 TTAACTTACTCAAGATGATATGG - Intergenic
1095344412 12:41132830-41132852 GTAAAATAGTGAAGATCTCATGG - Intergenic
1095354368 12:41254358-41254380 GTAAGATACTCAAAGTCACATGG + Intronic
1096430586 12:51539713-51539735 GTAACTTTCTCAGGGTCACACGG - Intergenic
1097356826 12:58611631-58611653 GGAACTTGCTCAAGGTCACACGG + Intronic
1097943770 12:65343671-65343693 GTAATATGCTCAAGGTAACACGG + Intronic
1098229407 12:68357730-68357752 GCAGCTTACCCAAGATCACATGG - Intergenic
1098678153 12:73316607-73316629 GAAGGATACCCAAGATCACAGGG - Intergenic
1098954099 12:76670653-76670675 GGAACTTGCCCAAGATCACAGGG - Intergenic
1099122616 12:78710678-78710700 ATAACTTACTCATTATCACAAGG - Intergenic
1099979878 12:89586200-89586222 GTAACTTACTCTAGGTCACATGG - Intergenic
1100668521 12:96783501-96783523 GTATCATACTCTATATCACCTGG + Intronic
1100819424 12:98417497-98417519 GCAACTTGCTCAAGGTCACATGG - Intergenic
1100874586 12:98948811-98948833 GCAACAGGCTCAAGAGCACACGG + Intronic
1101241894 12:102847209-102847231 GTGACTTGCTCATGATCACAGGG + Intronic
1101273149 12:103169511-103169533 GTAACTTATCCAAGATCATATGG + Intergenic
1101915836 12:108895121-108895143 GTAACAGGCACAAGTTCACACGG + Intronic
1102168636 12:110825290-110825312 GGCACATACTCAACATCACCAGG - Intergenic
1102212920 12:111139922-111139944 GTGACTTACCCAAGGTCACACGG - Intronic
1102389205 12:112536059-112536081 GTCTCAAACTCAAGATCACTGGG - Intergenic
1102745042 12:115242953-115242975 GTGACTTGCTCAAGATCACATGG + Intergenic
1103357639 12:120333413-120333435 GTAACTTGCTCAAAGTCACATGG + Intergenic
1103546941 12:121708957-121708979 GTAACCTCCACAAGATCTCAGGG - Intergenic
1103547062 12:121709778-121709800 GTAACCTCCACAAGATCTCAGGG + Intergenic
1104234713 12:126922698-126922720 GTAACTTACTCAAGATCACAAGG + Intergenic
1106567802 13:30901412-30901434 GAAACTTGCTCAAGATGACATGG + Intergenic
1106997813 13:35508104-35508126 GTAATTTGCTTAAGATCACAGGG + Intronic
1107411357 13:40161573-40161595 GTAACTTACCCAGGGTCACATGG + Intergenic
1108450754 13:50560192-50560214 GTAACTTACACAAGGCCACACGG - Intronic
1109340934 13:61057847-61057869 ATAACATAGCCAAGAACACACGG - Intergenic
1109716024 13:66223471-66223493 GTAACCTGTCCAAGATCACATGG - Intergenic
1110136293 13:72071443-72071465 GTAACTTGCCCAAGCTCACACGG + Intergenic
1111048783 13:82850988-82851010 GTGACAAACTCAAGATCAATAGG + Intergenic
1111316837 13:86573912-86573934 GTATCATAGTGAAGATAACAGGG + Intergenic
1111833507 13:93358854-93358876 GTAACACACTGAACATCACAGGG - Intronic
1112038388 13:95519016-95519038 GCAATTTACTCAAGGTCACATGG - Intronic
1112672074 13:101652340-101652362 GTAACTTACATAAGGTCACATGG - Intronic
1112699591 13:101990809-101990831 ATAACATAATTGAGATCACATGG - Intronic
1113272368 13:108687322-108687344 GTAGGATACTGAAAATCACAAGG - Intronic
1113637226 13:111927966-111927988 GCAACTTTCCCAAGATCACACGG + Intergenic
1113637656 13:111931035-111931057 ATAACATTCTCAAAATGACAAGG - Intergenic
1113833009 13:113311683-113311705 CTACCCTGCTCAAGATCACAGGG - Intronic
1114570368 14:23662995-23663017 GTAACTTAGTCAAGGCCACATGG - Intergenic
1115068847 14:29297132-29297154 CCCACATACTCAACATCACAAGG + Intergenic
1115199972 14:30842800-30842822 ATTACTTGCTCAAGATCACATGG + Intergenic
1115321920 14:32090511-32090533 GAAACATCTTCAAGATCATAGGG - Exonic
1115375593 14:32672042-32672064 GTTACACACACAAGATCAGAGGG + Intronic
1115756476 14:36531340-36531362 GTAAATTGCTGAAGATCACATGG + Intergenic
1116778675 14:49211845-49211867 GTAACATACTCATAGTCCCAGGG + Intergenic
1116799000 14:49423205-49423227 ATAACTTACTCAAGGTCACATGG - Intergenic
1117015921 14:51516601-51516623 TTTACATACTCAAGATGACAGGG - Intronic
1117387049 14:55225962-55225984 GTTACACACTCAAGATCACATGG - Intergenic
1118241825 14:64067360-64067382 GTAACTTGCTCAAATTCACAAGG + Intronic
1118456515 14:65949723-65949745 GTAACACACTCAAGGCCACTTGG - Intergenic
1118595184 14:67429957-67429979 GTAACTTCCTCAAGATCACGTGG + Intergenic
1118922492 14:70162344-70162366 GTAACTTATCCAAGATTACATGG - Intronic
1119748878 14:77063888-77063910 GAGACATTCTCAAGGTCACATGG + Intergenic
1120032414 14:79657220-79657242 GGGACCTGCTCAAGATCACATGG + Intronic
1120833271 14:89016898-89016920 GTGACTTGCTCAAGGTCACATGG - Intergenic
1121285473 14:92732101-92732123 GTGACTTGCTCAAGGTCACATGG - Intronic
1121535376 14:94687111-94687133 GTGACTTCCTCAAGGTCACACGG + Intergenic
1122734634 14:103830510-103830532 GTAACTCACCCAAGATTACAGGG + Intronic
1124916183 15:33976931-33976953 GTAAAATAATCAAAATTACAGGG + Intronic
1125933672 15:43617272-43617294 GTAACCTGCTCAAGGTCATATGG + Intronic
1125946770 15:43716734-43716756 GTAACCTGCTCAAGGTCATATGG + Intergenic
1126351509 15:47749518-47749540 GTAACATGCCCAAAGTCACATGG + Intronic
1126733387 15:51707620-51707642 GCAACTTGCTCAAGATCTCATGG + Intronic
1126945595 15:53815806-53815828 GTAACATGCTCAAGAGAGCATGG + Intergenic
1127785681 15:62352823-62352845 GTAATTTGCCCAAGATCACATGG - Intergenic
1127964125 15:63911342-63911364 GTAATTTCCTCAAGGTCACACGG + Intronic
1128093026 15:64931737-64931759 GTAACTTGCTCCAGGTCACAGGG - Intronic
1128099169 15:64984160-64984182 ATGACTTACCCAAGATCACATGG + Intronic
1128527080 15:68419860-68419882 GTAACTTAGCCAAGATCACCCGG - Intronic
1128554105 15:68618723-68618745 GTAACTTGCCCAAGGTCACATGG + Intronic
1129276294 15:74447871-74447893 GTGACATACTCAAAACTACAAGG - Intronic
1130169394 15:81496136-81496158 GTAAGATCATCAAGATCACCTGG - Intergenic
1131174851 15:90202989-90203011 GTAGCCTGCTCAAGGTCACATGG - Intronic
1131439891 15:92451802-92451824 GTAACTTGCACAAGATCCCACGG + Intronic
1131912080 15:97218029-97218051 CTAACATACTCTAAAGCACATGG - Intergenic
1132997664 16:2831604-2831626 GTAACGAGCTCAAGATCACAGGG + Intronic
1133823368 16:9256572-9256594 GTAAAATACTGAAAACCACATGG + Intergenic
1134174333 16:11993626-11993648 GTAACTTGCTCATGATCACATGG + Intronic
1134681281 16:16127568-16127590 GTTACTTGCCCAAGATCACATGG + Intronic
1134796333 16:17040285-17040307 GGAACATGCTCAGGGTCACAAGG - Intergenic
1135144767 16:19951584-19951606 GTCACAAACTCAAGCTCTCAAGG - Intergenic
1135174025 16:20212180-20212202 GTAACTTACTCAACCTCCCATGG + Intergenic
1135968640 16:27055964-27055986 GTCACTTGCCCAAGATCACATGG + Intergenic
1136556952 16:31012565-31012587 ATAACATATCCAAGTTCACAAGG + Intergenic
1137289216 16:47040344-47040366 GTGACCTCCTCAAGATCACATGG + Intergenic
1137310014 16:47245877-47245899 GGACCATACTCACGGTCACAAGG + Intronic
1137466466 16:48714307-48714329 GTAATTTATTCAAGAACACAGGG + Intergenic
1138680475 16:58680309-58680331 ATAACTTTCCCAAGATCACATGG + Intronic
1139182792 16:64767601-64767623 GTAACGTACCCAAGATCACTTGG + Intergenic
1139297041 16:65910051-65910073 GTAACTTGTTCAAGGTCACACGG - Intergenic
1140439440 16:74975730-74975752 GTAACTTGCCCAAGATCACATGG + Intronic
1140649165 16:77067624-77067646 GCAACATTCTCAATATCACAAGG + Intergenic
1140659215 16:77171320-77171342 GTAACTTGCTCAAGGTCATATGG - Intergenic
1140776466 16:78253463-78253485 GTACCCTGCTCAAGATCACTGGG + Intronic
1140822422 16:78675216-78675238 GTGACTCACTCAAGATCACGTGG + Intronic
1141918636 16:87119845-87119867 GTAACATGTCCAAGGTCACACGG - Intronic
1142533892 17:599936-599958 ATAACCTACTGAAGGTCACATGG + Intronic
1142950273 17:3472449-3472471 GTAACTTGCCCAAGGTCACAGGG - Intronic
1143295984 17:5872444-5872466 CTAACTTACTCAGGACCACACGG + Intronic
1144475117 17:15580982-15581004 ATAATTTGCTCAAGATCACACGG + Intronic
1145088799 17:19968737-19968759 GTAACTTGTCCAAGATCACATGG - Intronic
1145803448 17:27707435-27707457 GTGAAATACTCAAGAGCACAAGG - Intergenic
1146309088 17:31753248-31753270 GTAACTTATTCAAGTTCACATGG - Intergenic
1146520031 17:33519186-33519208 GTAGCTTACCCAAGGTCACACGG + Intronic
1146558677 17:33849430-33849452 GTAACCTACTCAAGGTCCCATGG + Intronic
1146572573 17:33965677-33965699 GTAACATATCATAGATCACAAGG + Intronic
1146667246 17:34713307-34713329 GTGACATGCTCAAGAGCACATGG - Intergenic
1146894105 17:36528661-36528683 GTAACTTACCCAGGCTCACAGGG - Intronic
1146959097 17:36957208-36957230 GTAACTTGCCCAAGGTCACATGG - Intronic
1147386781 17:40087663-40087685 GTAACTTACCCCAGGTCACATGG - Intronic
1147499890 17:40952914-40952936 GTAACTTGCCCAAGATCTCATGG + Intergenic
1147638357 17:41978102-41978124 GTAACTTGCCCACGATCACATGG + Intronic
1148196129 17:45714674-45714696 GTAACTTGCCCAAGGTCACACGG + Intergenic
1149005802 17:51803985-51804007 GCAACTTGGTCAAGATCACACGG - Intronic
1149035490 17:52129489-52129511 GTAACTTGCTTAAGATCACATGG + Intronic
1149445028 17:56706682-56706704 ATTACTTGCTCAAGATCACACGG + Intergenic
1149609529 17:57949938-57949960 ATAACTTGCCCAAGATCACATGG - Intronic
1150142329 17:62740587-62740609 GTTGCATACTCAAGACCCCAGGG + Intronic
1150937123 17:69648757-69648779 GTTTCTTACTCAAGATCATATGG + Intergenic
1151754707 17:76067252-76067274 GTAACAGACACAAATTCACAGGG - Exonic
1153518877 18:5933193-5933215 ATAACTTAGTCAAGGTCACATGG - Intergenic
1153773112 18:8431225-8431247 GTCACATGCCCTAGATCACATGG - Intergenic
1153971466 18:10230785-10230807 GTAACATGCCCACAATCACATGG - Intergenic
1154140469 18:11819546-11819568 TGAACATAATGAAGATCACATGG + Intronic
1156005879 18:32440268-32440290 ATAACTTGCTTAAGATCACACGG + Intronic
1157733383 18:50024289-50024311 TTAACATTCTCAGGAACACAAGG + Intronic
1158427060 18:57349805-57349827 GTAACTTACCCAAGGTCACCTGG + Intergenic
1158545745 18:58395002-58395024 GTAACTTGCCCAAGGTCACACGG - Intronic
1158890987 18:61871495-61871517 GTAATTTACTTAGGATCACAGGG + Intronic
1160461242 18:79040386-79040408 AAAACCTGCTCAAGATCACATGG + Intergenic
1162556208 19:11387560-11387582 GTAACTTACTCAAGGTCCCATGG - Intronic
1164573005 19:29387612-29387634 GTGACATGCTCAGGATCACATGG - Intergenic
1166608939 19:44171596-44171618 GGAACGTGCTCAAGTTCACATGG + Intronic
1166656262 19:44614215-44614237 GTCACCTACCCAAGATCACAGGG + Intronic
926268599 2:11347241-11347263 GTAACTTGCTCAGGGTCACATGG - Intronic
926383070 2:12310369-12310391 CTGACATGCACAAGATCACATGG - Intergenic
926855157 2:17247969-17247991 GTAACTTGTTCAAGATCAAATGG - Intergenic
927070893 2:19528570-19528592 TTTACTTGCTCAAGATCACAGGG + Intergenic
928083678 2:28332373-28332395 GTGGCTTGCTCAAGATCACATGG + Intronic
928395250 2:30938760-30938782 GTGACCTACTCAATAGCACATGG - Intronic
928540871 2:32282401-32282423 GTAGCTTGCCCAAGATCACATGG - Intronic
928932056 2:36635012-36635034 GTCACAAACTCAAGCTCTCAAGG + Intronic
929130905 2:38570016-38570038 GTAAAATACGGAAGATCACCTGG + Intronic
929324866 2:40597009-40597031 TTAGCCTGCTCAAGATCACATGG - Intronic
929874699 2:45786845-45786867 GTAACTTGCACAAAATCACATGG + Intronic
929970108 2:46566725-46566747 CTGACATACTGAAGACCACAGGG - Intronic
930737846 2:54797793-54797815 GTAACTTGCCCAAGATTACATGG - Intronic
931476510 2:62593065-62593087 GTAACTTTCTGAAGTTCACACGG + Intergenic
931529268 2:63195328-63195350 GTGACCTGCTTAAGATCACATGG - Intronic
931709486 2:64976149-64976171 GTAACTTTCCCAAGATCACAAGG + Intergenic
931919380 2:66996607-66996629 GTGACATGGCCAAGATCACATGG + Intergenic
932046023 2:68350793-68350815 GTAACTTGCCCAAGGTCACATGG + Intergenic
932137834 2:69246004-69246026 GTAAGAAACTCAACATCAGACGG + Exonic
932476860 2:72011722-72011744 GTAACTTACCCAAGTTCACATGG - Intergenic
932707303 2:74036588-74036610 GTAATTGCCTCAAGATCACAAGG - Intronic
933383029 2:81574608-81574630 GTAACTTTTTCTAGATCACATGG + Intergenic
933693146 2:85195132-85195154 GTAACTTGCTCAAGGTTACAAGG - Intronic
933917998 2:87016121-87016143 GTAATATACTCAAGCTGACATGG + Intronic
934004997 2:87753793-87753815 GTAATATACTCAAGCTGACATGG - Intronic
935767954 2:106387824-106387846 GTAATATACTCAAGCTGACATGG - Intergenic
936246082 2:110828710-110828732 GTCATTTGCTCAAGATCACATGG + Intronic
936688526 2:114857943-114857965 GTAGCTTTCTCAAGGTCACATGG - Intronic
936961069 2:118075226-118075248 GTAACATACAGAAGATTAAAAGG + Intergenic
938233223 2:129679753-129679775 GTAACTTGCCCAAGGTCACATGG + Intergenic
938626883 2:133119795-133119817 GTAACTTGCTTATGATCACATGG - Intronic
938979537 2:136513247-136513269 GTGACTTGTTCAAGATCACATGG - Intergenic
941351826 2:164447505-164447527 GTAAACTGCTCAAGGTCACAAGG + Intergenic
941733845 2:168950054-168950076 TTAACTTACACATGATCACAAGG - Intronic
943616667 2:190100818-190100840 GAAAGATACTCCAGATCCCAGGG + Intronic
944014026 2:195010524-195010546 GTGAAATACTCAAGGTCACAGGG - Intergenic
944469222 2:200035265-200035287 GGAACATATCCAGGATCACACGG + Intergenic
945089174 2:206162929-206162951 GTAACATACTCAAGAGCCAAAGG - Intergenic
945109784 2:206351163-206351185 GTTACCTTCTCAAGATCATAGGG + Intergenic
945314111 2:208352074-208352096 GCAACTTGCTCAAGATCACTTGG - Intronic
945340194 2:208643497-208643519 GTAATAAGCCCAAGATCACATGG + Intronic
946727408 2:222674081-222674103 GTGAGTTACTCAAGATCACATGG + Intronic
947079822 2:226383594-226383616 GTAACTCACTCAAGATCTCATGG - Intergenic
1168858724 20:1029375-1029397 GTCACCTACACAAGGTCACATGG - Intergenic
1170057293 20:12220594-12220616 GAAACATACTCAGGCTGACAAGG - Intergenic
1170258638 20:14376859-14376881 GTAACTTTCCCAATATCACATGG - Intronic
1170825797 20:19794101-19794123 ATAATATACCCAAGATCACAAGG + Intergenic
1170855154 20:20045767-20045789 GTGACTTATCCAAGATCACATGG - Intronic
1171499072 20:25579234-25579256 ATAACATACTCAGGGTCACATGG - Intronic
1172010143 20:31841862-31841884 GTAACATGCCCAGGGTCACATGG - Intergenic
1172318066 20:33971785-33971807 ATAACTTACTCAAAGTCACATGG - Intergenic
1172376598 20:34446839-34446861 GTAACTTACTCAAAGTCATATGG - Intronic
1172611868 20:36258495-36258517 GCAGCTTGCTCAAGATCACACGG - Intronic
1172772110 20:37387951-37387973 ATAACTTACCCAAGGTCACATGG + Intronic
1172855791 20:38001315-38001337 TTAACTTACTCAAGGTCACATGG + Intronic
1172982417 20:38954108-38954130 GTAGCATATTCAAGATGACATGG + Intergenic
1173113393 20:40217534-40217556 GTAGCTTACCCAAGGTCACAGGG + Intergenic
1173759409 20:45546621-45546643 GTAACTTGCCCAAGATTACAGGG + Intronic
1173813474 20:45970546-45970568 GTAGCTTGCTCAAGATCACACGG + Intronic
1173954336 20:47019043-47019065 GTCACTTACCCAAGGTCACACGG + Intronic
1174324065 20:49765012-49765034 GTAATTTGCTCAGGATCACATGG + Intergenic
1174392435 20:50226253-50226275 GTGACATGCTCAAGGTCACATGG + Intergenic
1174496918 20:50952095-50952117 TTTATATTCTCAAGATCACATGG - Intronic
1174657093 20:52180812-52180834 GTAACCTGCCCAAGGTCACATGG + Intronic
1174961266 20:55159802-55159824 CTAACATACTTAATATCAAAAGG - Intergenic
1175045131 20:56097778-56097800 GTGACTTACCCAAGGTCACACGG + Intergenic
1175669937 20:60893369-60893391 ATAACTTGCTCAAGGTCACATGG + Intergenic
1177650509 21:23954986-23955008 ATAACTTGCTCAAAATCACATGG + Intergenic
1178105119 21:29309725-29309747 GTAATTTACAGAAGATCACATGG + Intronic
1178681149 21:34672763-34672785 GTAACTTGCCCAAGGTCACACGG - Intronic
1178883860 21:36469516-36469538 GTATCTTACTCAAAATCACACGG + Intronic
1179326623 21:40352742-40352764 GTGAATTACCCAAGATCACATGG - Intronic
1180595509 22:16970358-16970380 GGAAAATACTCAAGGCCACAAGG - Intronic
1180604956 22:17051140-17051162 GTGCCTTACACAAGATCACAAGG - Intergenic
1181905634 22:26193386-26193408 GTAACATACTCAAGATCACAAGG + Intronic
1181975918 22:26729583-26729605 GTAGCTTGCTCAAGAGCACACGG + Intergenic
1182065601 22:27429344-27429366 GTAACTTGCTCAAGGTCATATGG + Intergenic
1182740588 22:32564461-32564483 GTAACTTTCCCAAGGTCACACGG + Intronic
1182925765 22:34123149-34123171 GTGACTTGCTCAAGATCACACGG + Intergenic
1183125921 22:35782017-35782039 GTGACTTGCCCAAGATCACATGG + Intronic
1183492779 22:38125640-38125662 GTGACTTGCTCAAGGTCACACGG - Intronic
1183529908 22:38347725-38347747 GTGACTTGCTCAAGGTCACATGG + Intronic
1183741639 22:39671859-39671881 ATGACTTACTCAAGATCATAAGG + Intronic
1183764290 22:39856645-39856667 GAAACATACTTAAAAGCACATGG + Intronic
1184945376 22:47798984-47799006 ATATCCTTCTCAAGATCACATGG + Intergenic
949183698 3:1165760-1165782 GTGACTTACTCAAGATAACATGG + Intronic
949197112 3:1324843-1324865 GTAACCTGTTCAAGATGACATGG - Intronic
950049846 3:9979477-9979499 GTGACTTGCTCAAGATCACATGG - Intronic
951095860 3:18630095-18630117 GTTACATCCTCAAGGTCATATGG + Intergenic
952108224 3:30093055-30093077 GGAACATGCTTAAGAACACACGG + Intergenic
952650402 3:35719880-35719902 TTAACATACTCATGATTATATGG + Intronic
955091234 3:55752714-55752736 TTAACTTACTCAAGTTTACATGG + Intronic
955132460 3:56184590-56184612 GTAACATACCCAAGATTGCAAGG + Intronic
955443641 3:58983843-58983865 GTAACCTACCTAGGATCACATGG + Intronic
955600761 3:60642682-60642704 GAAACAATCTCAAGATCAGATGG + Intronic
955693636 3:61614325-61614347 GTAACTCACTCAAGGTCATAGGG - Intronic
955741762 3:62098600-62098622 GTAACTTGCCCAAGGTCACATGG + Intronic
956104925 3:65807873-65807895 GTAAATTATCCAAGATCACAGGG + Intronic
956417680 3:69051078-69051100 GTAACTTGCTCTAGGTCACACGG - Intronic
956760016 3:72433508-72433530 GTAACATACCCAAGGTCACAAGG + Intronic
956895428 3:73655105-73655127 GTAACATGCTTACCATCACAGGG - Intergenic
958131189 3:89426337-89426359 TTACCATAATCAAAATCACAAGG + Intronic
958827436 3:99048709-99048731 GTGACTTAGTCAAGAGCACATGG + Intergenic
959206399 3:103312354-103312376 ATAACTTGCCCAAGATCACAAGG - Intergenic
959554760 3:107704081-107704103 GTAACATGCACAGGATAACATGG - Intronic
960356539 3:116660584-116660606 GTAACTTACTCAAGGTCACTTGG + Intronic
960645404 3:119875579-119875601 GTGACTTACCCAAGATTACATGG - Intronic
960737902 3:120800741-120800763 GTAATTTGCCCAAGATCACATGG + Intergenic
961185609 3:124912507-124912529 ATAACATCCTCCAGCTCACAGGG - Intronic
961588217 3:127952990-127953012 GCAACTTGCTCAAAATCACATGG - Intronic
962365485 3:134776424-134776446 GTAATATACACCAGATCCCAAGG - Intronic
963219746 3:142796152-142796174 GTAACTTGCGCAAGGTCACATGG + Intronic
963729634 3:148958891-148958913 GTAACATGTTCAAGGTCAGAGGG + Intergenic
963900245 3:150726663-150726685 GTTACTTACTCAAGTTTACATGG - Intergenic
964724284 3:159798265-159798287 GTAATTTGCTCAAGGTCACATGG - Intronic
965375597 3:167919636-167919658 GTAACTTATTCAAAATCATAAGG - Intergenic
965450800 3:168835312-168835334 CTAACTTACTCAAGGCCACATGG + Intergenic
965727677 3:171736343-171736365 GTCACTCATTCAAGATCACAAGG + Intronic
966031481 3:175353546-175353568 GTGATTTACTCAAGATCACAAGG + Intronic
966239340 3:177738980-177739002 GTAACATCCTTTAGAGCACAAGG - Intergenic
966239437 3:177739922-177739944 GTAACTTGCTGAAGGTCACATGG - Intergenic
966421457 3:179738711-179738733 GTAACCTACAGAAAATCACAAGG - Intronic
966738918 3:183213742-183213764 TTAACTCACTCAAGATTACATGG - Intronic
966929450 3:184666316-184666338 GTGACTTACCCAAGTTCACAAGG - Intronic
967674806 3:192284270-192284292 GTGACATGCTGATGATCACAGGG + Intronic
968228568 3:196991035-196991057 GTAACTTGCCCAAGATCACTCGG - Intronic
969509159 4:7607784-7607806 GTCACATTCCCAGGATCACATGG + Intronic
970113304 4:12663159-12663181 GTATCAAACTGAAGACCACAGGG - Intergenic
970559025 4:17264837-17264859 GTGACATATCCAAGGTCACAGGG + Intergenic
970828588 4:20307818-20307840 GTAACTTGCCCAAGCTCACATGG + Intronic
970912858 4:21298017-21298039 ATAACTTGCTTAAGATCACAAGG - Intronic
972234714 4:37117847-37117869 GCAACTTGCTCAAGGTCACATGG - Intergenic
972763885 4:42133502-42133524 GTAACCTGCCCAGGATCACATGG - Intronic
973013934 4:45111388-45111410 GTAACCTAGTCAAGGTCAAACGG - Intergenic
973607553 4:52602571-52602593 GTGACTTGCCCAAGATCACAAGG - Intronic
973837388 4:54824198-54824220 GTAAAATACTCAATTTCATAGGG + Intergenic
974490972 4:62564195-62564217 TTGACTTACTTAAGATCACATGG - Intergenic
975332667 4:73135620-73135642 GTAAAATAGTCAAGATCAGAAGG + Intronic
975959082 4:79878808-79878830 GTAACTTATTTAAGATCATATGG - Intergenic
976644983 4:87377970-87377992 GTTTCATACCCAAGGTCACATGG + Intronic
977016960 4:91702664-91702686 GTAGGCTAATCAAGATCACAAGG + Intergenic
979163838 4:117499564-117499586 GCAACATACACAAGTTCACATGG - Intergenic
979458963 4:120958518-120958540 GTAACTTACGCAAGGTAACATGG - Intergenic
980551971 4:134349296-134349318 TTAAAATACTCAAGATAATATGG + Intergenic
981347398 4:143692247-143692269 GTCACTTACTCAAGGTCACACGG + Intronic
981572018 4:146161834-146161856 GTAATTTGCTCAAGATCACATGG - Intergenic
982101057 4:151968453-151968475 GTAACATGTTCAATGTCACATGG + Intergenic
982293730 4:153805934-153805956 GTAACTTTCTCAAGGTCACCTGG - Intergenic
982342405 4:154315276-154315298 GTAACTTGTTCAAGGTCACATGG + Intronic
983104690 4:163672116-163672138 AATACATGCTCAAGATCACATGG - Intronic
983381077 4:166994362-166994384 GTAACCTGTCCAAGATCACATGG + Intronic
983458237 4:167992434-167992456 GTAACTTACCCAAGAACTCATGG + Intergenic
984969434 4:185174055-185174077 GGGACTTACTCAAGGTCACACGG - Intronic
988712113 5:33789041-33789063 TCCACATACTCAGGATCACACGG + Intronic
990007127 5:50956632-50956654 GTAACTTGCACAAGATTACAGGG + Intergenic
990122676 5:52474707-52474729 GTAAACTACTCAAGAACATAGGG + Intergenic
991189579 5:63853835-63853857 GTAACTTTCTCAGGGTCACATGG - Intergenic
991206541 5:64056231-64056253 GTAACTTGTCCAAGATCACACGG - Intergenic
992710559 5:79450326-79450348 GTAACATCCACAAGAACCCAAGG + Intronic
993008923 5:82458048-82458070 GTAACTTAATCCAGGTCACAAGG - Intergenic
993275249 5:85849469-85849491 AGAACTTACTCAATATCACAAGG + Intergenic
993456487 5:88132956-88132978 GTAACTTGCCCAAGATCACTTGG - Intergenic
993543960 5:89188084-89188106 TTGACATACTTAAGATCATATGG + Intergenic
995226443 5:109706503-109706525 GTTACTTCCCCAAGATCACATGG + Intronic
995542394 5:113197777-113197799 GTAATCTGCTCAAGGTCACAGGG + Intronic
997607194 5:135183599-135183621 GCAACTTACCCCAGATCACACGG - Intronic
998029610 5:138854293-138854315 GTACAAGACTCAAAATCACAGGG + Intronic
998164206 5:139833269-139833291 GTGACATGCCCACGATCACAAGG - Intronic
998207758 5:140171336-140171358 GTAACTCACTCAAAGTCACATGG + Intergenic
998364819 5:141622801-141622823 GTAACTTTCTGAAGGTCACATGG - Intronic
998489600 5:142534799-142534821 GTACCCTATTCAAGGTCACAAGG - Intergenic
998796261 5:145822636-145822658 GTGACTTGCTCAAGGTCACATGG - Intronic
999096788 5:148986148-148986170 GTAACATACCCAAGTTCACACGG - Intronic
999652413 5:153780348-153780370 GCTACTTTCTCAAGATCACATGG - Intronic
999831234 5:155322219-155322241 GTAACCTTCTCAAGGCCACAGGG - Intergenic
1001119593 5:168968844-168968866 GTAACTTACTCAAGGTCACACGG - Intronic
1001774524 5:174319030-174319052 GAAACATATGCAAGTTCACATGG - Intergenic
1001978074 5:176017058-176017080 TTAATATACTCATGATCACCAGG - Intronic
1002239345 5:177826704-177826726 TTAATATACTCATGATCACCAGG + Intergenic
1002500565 5:179644858-179644880 GTAAGATAATCAGGATCACCAGG + Exonic
1002647386 5:180666659-180666681 GAAACATTCTCCTGATCACAGGG + Intergenic
1003766052 6:9237897-9237919 ATAACATACTCAAGGTTGCAAGG + Intergenic
1003771891 6:9313897-9313919 GTAATCTGCTGAAGATCACAAGG + Intergenic
1004783357 6:18937535-18937557 GTTACACACTAAACATCACAAGG + Intergenic
1005097757 6:22136618-22136640 GTAACATCCTCAAGATCAAAAGG - Intergenic
1006662921 6:35663904-35663926 GTAACAATCTCAATGTCACACGG - Intronic
1006748656 6:36363005-36363027 GTGACTTGCGCAAGATCACATGG - Intronic
1007035649 6:38670487-38670509 GTAACATATTAAAGATTAGAAGG - Intergenic
1008752223 6:54749404-54749426 GTAATATGCCCAAGGTCACAGGG - Intergenic
1009471892 6:64036842-64036864 GTAACTTGCTCTAGACCACACGG + Intronic
1010057194 6:71580187-71580209 GTAACTTGCCCAAGGTCACACGG + Intergenic
1011605313 6:89098723-89098745 GGAACAAAATCAAGATCACATGG - Exonic
1012529293 6:100214786-100214808 GTAATTTTCTCAAAATCACATGG - Intergenic
1013441352 6:110173510-110173532 GTAATTTGCTCAAGGTCACATGG - Intronic
1013581329 6:111537351-111537373 GTAACTTGCCTAAGATCACATGG + Intergenic
1013651097 6:112195327-112195349 GTAACCTATTCAGGGTCACAGGG + Intronic
1014984973 6:127994551-127994573 GTAACATTCCCAAGATCTCCAGG + Intronic
1015009245 6:128324087-128324109 GTAACTTATCCAAGATCTCAGGG - Intronic
1015461647 6:133498305-133498327 ATAAACTACTCAAGGTCACATGG - Intronic
1016277271 6:142369461-142369483 GTAACATACCCAGGGTCACATGG + Intronic
1018128793 6:160707965-160707987 GTAATACACTCAAGCTGACATGG - Intronic
1018146762 6:160898815-160898837 ATAATATACTCAAGTTGACATGG - Intergenic
1018347016 6:162910227-162910249 ATAACTTCCTCAAGGTCACACGG + Intronic
1018486153 6:164242990-164243012 GTAACATTATAAAGATAACAGGG + Intergenic
1020154779 7:5713902-5713924 TTAAATTGCTCAAGATCACAGGG + Intronic
1020222913 7:6255159-6255181 GTAACTTACACAAAATCACAAGG + Intronic
1020397600 7:7734608-7734630 CATAAATACTCAAGATCACAAGG + Intronic
1020416301 7:7949980-7950002 TAAAGACACTCAAGATCACATGG - Intronic
1020444993 7:8259679-8259701 GTAACTTGGTCAAGGTCACACGG + Intronic
1020708168 7:11571551-11571573 GTAACCTGTCCAAGATCACATGG + Intronic
1020841087 7:13218834-13218856 GTGACTTACTCAAGGTTACAAGG + Intergenic
1021578715 7:22129577-22129599 GTGATATTCTGAAGATCACAGGG - Intronic
1021612030 7:22466873-22466895 GTAACTTGGTCAAGATCTCATGG - Intronic
1021640104 7:22728233-22728255 GGAATTTACCCAAGATCACAAGG - Intronic
1022406318 7:30093546-30093568 CTAACATGCTCAAAATCCCATGG - Intronic
1022619786 7:31971391-31971413 ATAACTCACTCAAGATCACATGG - Intronic
1022779482 7:33564414-33564436 GTTACTTACTCAAAATCACATGG - Intronic
1022799361 7:33761097-33761119 GTCACTTCCTCAAGATCACATGG + Intergenic
1022838532 7:34140112-34140134 GTAATTTACTCAATGTCACAGGG - Intronic
1023700768 7:42889945-42889967 GTTACCTGCTCAAGATTACATGG - Intergenic
1027162429 7:75812479-75812501 GTAACTTGCTCAAGGTCACGTGG - Intronic
1027386592 7:77665098-77665120 ATAACAGCATCAAGATCACAGGG + Intergenic
1027435163 7:78156637-78156659 GTAACTTCCTCAAGGTCACATGG + Intronic
1027994514 7:85408279-85408301 GTGACATGCCCAAGATCACAAGG - Intergenic
1028921187 7:96312204-96312226 ATAACTTGCCCAAGATCACATGG - Intronic
1028938969 7:96498806-96498828 GTAACCTTCTCAAGGTTACAGGG - Intronic
1030044441 7:105482249-105482271 GTAACATACTCAAGATGCCCTGG + Intronic
1030138396 7:106281489-106281511 ATAACATACCCAAGGTCACAGGG + Intronic
1031084769 7:117291597-117291619 GTCACATGCACAACATCACACGG + Intronic
1031104009 7:117516861-117516883 GTAACCTACCCAAAATCACATGG - Intronic
1031178554 7:118384799-118384821 TAAACATACTCAAGATAAAATGG - Intergenic
1031336965 7:120546980-120547002 ATAACATAATCTAGATCTCATGG - Intronic
1031713091 7:125073700-125073722 GCAACATGCTGAAGATCAAACGG + Intergenic
1032087026 7:128889852-128889874 GTAACTTGCCCAAGACCACACGG + Intronic
1032382633 7:131500906-131500928 GTGACTTCCTCAAAATCACATGG - Intronic
1032556849 7:132845130-132845152 GTAACTTACTCAGTTTCACAAGG - Intronic
1032684318 7:134216061-134216083 GTAACTTGCCCAAGGTCACATGG - Intronic
1033799140 7:144880099-144880121 GTAACTTTATCAAGATTACATGG + Intergenic
1033826321 7:145194542-145194564 GTAACTTATCCAAGATCACTAGG - Intergenic
1034731145 7:153388570-153388592 GTAACTTGCCCAATATCACATGG + Intergenic
1037089378 8:14895250-14895272 GTAATGTACCCAAGATTACATGG - Intronic
1039364419 8:36915365-36915387 ATACCATGCCCAAGATCACAAGG - Intronic
1040840019 8:51775393-51775415 GTAACATTTTCAAGTCCACATGG + Intronic
1041283268 8:56233131-56233153 GTGACTTGCTCAAGTTCACATGG + Intergenic
1042636127 8:70877460-70877482 GTGATTTACTCAAGATCACTTGG + Intergenic
1043851611 8:85222554-85222576 GTAACTTTTCCAAGATCACACGG - Exonic
1043880828 8:85540441-85540463 GTAACTTGTTCAAGATCCCATGG - Intergenic
1044090410 8:87993273-87993295 GTTACATATTCAAGACTACATGG - Intergenic
1044241258 8:89891511-89891533 GTAACTTAACCAAGATCACATGG + Intergenic
1044794556 8:95883853-95883875 GTAACTTGCTCAAAATCAAATGG + Intergenic
1045439191 8:102192983-102193005 GTAACTCATTCAAGGTCACATGG + Intergenic
1045743129 8:105385948-105385970 GTAACTTGCTCAAGGTCACATGG - Intronic
1045757061 8:105556511-105556533 GTAACTTGCTAAGGATCACATGG + Intronic
1046617841 8:116497227-116497249 GTAACATGCTGAAAATTACAAGG - Intergenic
1046657195 8:116907706-116907728 GTAACTAACCCAAGATCACTAGG + Intergenic
1047199521 8:122753487-122753509 GTAACTTACCCAATGTCACACGG + Intergenic
1047657199 8:126991003-126991025 ATAACTTGGTCAAGATCACATGG - Intergenic
1047976382 8:130134578-130134600 GTGACTTACACAAGGTCACACGG + Intronic
1048396679 8:134020631-134020653 GTAACTTGCTCAAGGTCACACGG + Intergenic
1050442192 9:5676532-5676554 GTAACCTGCTCAAGAATACATGG + Intronic
1053151055 9:35743275-35743297 GTAACATGCGCAAGGTCACAAGG - Intronic
1053306928 9:36991264-36991286 GTGACCTACCCAAGGTCACATGG + Intronic
1054754688 9:68945735-68945757 GTAACTTTCTCAAGACCACATGG + Intronic
1054995260 9:71380512-71380534 GTAACCAACTCAAGCCCACAGGG + Intronic
1055233909 9:74095914-74095936 GTAACACAATCAAAATCACAAGG + Intergenic
1055733806 9:79306667-79306689 ATCACATACTAAAGACCACAGGG + Intergenic
1056068948 9:82965930-82965952 GTTATTTACTCAAGGTCACATGG - Intergenic
1056140167 9:83669913-83669935 ATAACTTGCCCAAGATCACATGG - Intronic
1056184566 9:84120950-84120972 GTAACCTGCCCAAGATCTCACGG - Intergenic
1056411763 9:86335193-86335215 ATAACTTGCTCAAGGTCACAAGG + Intronic
1056438826 9:86599551-86599573 GTAACTTACCCAGGGTCACATGG + Intergenic
1056856392 9:90133337-90133359 GAAACATGCCCAAGATAACATGG - Intergenic
1058644999 9:107123206-107123228 GTAAATTGCTCAAGAGCACACGG - Intergenic
1058886791 9:109327721-109327743 GTACCCTCCTCAAGATCACCAGG - Intergenic
1059102083 9:111481883-111481905 GAAGAATACTCAAAATCACAGGG + Intronic
1059544144 9:115159442-115159464 GCAACTTACACAAGTTCACATGG - Intronic
1059681254 9:116588560-116588582 GTAACATATCCAAGATCAAGTGG - Intronic
1059725012 9:116999438-116999460 GTAACATACTCAAGGTCGACTGG + Intronic
1060000232 9:119952118-119952140 GTAACTTGCACAAGCTCACATGG + Intergenic
1060063356 9:120481450-120481472 GTAACTTGTTCAAGGTCACATGG - Intronic
1061563520 9:131422006-131422028 GTAACGCACCCAAGGTCACAAGG - Intronic
1187104711 X:16229399-16229421 GTGACTTCCTCAAGGTCACATGG - Intergenic
1187260099 X:17677605-17677627 ATAGCATACTCACAATCACATGG + Intronic
1188442788 X:30229770-30229792 GTAATATGCTCAAGTTCACAGGG + Intergenic
1188445918 X:30253203-30253225 GTAACATTCTCAAGTTCACATGG + Intergenic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1189226284 X:39415908-39415930 GTAACTTGCTCAAGGTCACATGG - Intergenic
1189667609 X:43373754-43373776 GTAACATACTAAGGCTCACTGGG - Intergenic
1190472061 X:50792094-50792116 GTATCATATTCAAGAACCCATGG - Intronic
1190490444 X:50977538-50977560 ATAACCTTCCCAAGATCACATGG - Intergenic
1190620184 X:52279560-52279582 ATAACACACTTAAGATCACTGGG - Intergenic
1190969216 X:55332675-55332697 GTAACTTACTCAAGGTCCCATGG + Intergenic
1191174870 X:57488490-57488512 ATAACATATCCAAGATCACTTGG - Intronic
1191979596 X:66911339-66911361 GTGACTTGCTCAAGTTCACATGG - Intergenic
1193038228 X:76976802-76976824 GTGACTTGCCCAAGATCACATGG + Intergenic
1194607605 X:96000677-96000699 GTAACATACTAAAGAACAATTGG + Intergenic
1195387541 X:104327200-104327222 GTAACATGCCCAAGGTCACTTGG + Intergenic
1195862421 X:109396138-109396160 GTAACTTACCCGAGGTCACATGG + Intronic
1195981798 X:110586485-110586507 GTAACTTACTCGAGGTCACATGG - Intergenic
1196096102 X:111801638-111801660 GTAACATCCTCAACATCATTCGG - Intronic
1197054710 X:122102985-122103007 GTAAGAGACTAAAGAGCACAGGG - Intergenic
1197627888 X:128823594-128823616 GTAACTTGCTCAAAGTCACAGGG + Intergenic
1198000068 X:132424612-132424634 GTAACATACTCATGAAAAGAGGG - Intronic
1198031742 X:132759962-132759984 GTAGTATCCTCAAGGTCACATGG + Intronic
1198228620 X:134669339-134669361 GTAACTTGCCCAACATCACACGG - Intronic
1198274309 X:135087084-135087106 GTAACATGCTCATGTTCCCAGGG + Intergenic
1198523119 X:137472783-137472805 GGGACATGCTCAAGGTCACACGG - Intergenic
1198968798 X:142256388-142256410 GTAACTTAGTCAATGTCACAAGG - Intergenic
1199255152 X:145710901-145710923 ATAGCATATTCAAGATCACATGG - Intergenic
1199434793 X:147801521-147801543 GTAACTTGCTCAGGGTCACAGGG + Intergenic
1199531745 X:148855757-148855779 GTAACTTGACCAAGATCACATGG - Intronic
1199726693 X:150590064-150590086 ATAACCTACTCAAGGTCAAATGG + Intronic
1199811445 X:151353774-151353796 GTAACTTACCCAAGGTCACACGG - Intergenic
1199982812 X:152930104-152930126 GTAACTTGCTCAAGGTCACATGG + Intronic
1202580423 Y:26375029-26375051 GTAACATGCCCAAGGTCATATGG + Intergenic