ID: 1181907103

View in Genome Browser
Species Human (GRCh38)
Location 22:26207231-26207253
Sequence TGGTGTCAAAGCAAGATGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 232}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181907103_1181907107 6 Left 1181907103 22:26207231-26207253 CCATTCATCTTGCTTTGACACCA 0: 1
1: 0
2: 1
3: 18
4: 232
Right 1181907107 22:26207260-26207282 ATGGTAACCACCTTAGTTAGAGG 0: 1
1: 0
2: 0
3: 1
4: 55
1181907103_1181907108 10 Left 1181907103 22:26207231-26207253 CCATTCATCTTGCTTTGACACCA 0: 1
1: 0
2: 1
3: 18
4: 232
Right 1181907108 22:26207264-26207286 TAACCACCTTAGTTAGAGGCAGG 0: 1
1: 0
2: 0
3: 3
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181907103 Original CRISPR TGGTGTCAAAGCAAGATGAA TGG (reversed) Intronic
900433445 1:2613661-2613683 TGGAGTCAAAGCATGAGGAGGGG + Intronic
901808017 1:11750037-11750059 TGGTGGGAAAGAAAAATGAAGGG - Intronic
903421119 1:23218190-23218212 TGGTGTCCAAGCTGGATGAATGG + Intergenic
903685976 1:25132299-25132321 TAGGGTCAATGCAGGATGAATGG - Intergenic
906958407 1:50397159-50397181 TGGTGTTGAAGAAAGAGGAAGGG - Intergenic
907163367 1:52388005-52388027 TCATGTCACAGCAAGATGGAAGG - Intronic
908812378 1:67996268-67996290 TGGAGTCAAAGTAAGCTGCAGGG + Intergenic
909124048 1:71642529-71642551 TGGTGTTACAGCAAGATTATGGG - Intronic
909745948 1:79097512-79097534 TGTTCTCAAAACAAGATTAATGG - Intergenic
910045314 1:82906593-82906615 AGGGGTCAAAGCAAGAAGATGGG - Intergenic
910616858 1:89207695-89207717 TGGTGTCAAAGTAAAAAGAATGG + Intergenic
913181699 1:116328775-116328797 TGGGGACAAAGGAAGAGGAAGGG + Intergenic
914720849 1:150287654-150287676 AGGTGTCAAAACAAGGGGAAAGG - Intergenic
917640420 1:176978335-176978357 TTCTGTGAAAGCAAGATAAATGG + Intronic
918037615 1:180890749-180890771 TGGCACCAAAGTAAGATGAAAGG - Intergenic
918389345 1:184041654-184041676 TGGTGACAAAGCAAGTTTTATGG + Intergenic
919356928 1:196536395-196536417 TGAACTCAAAGCAATATGAATGG - Intronic
920271478 1:204768104-204768126 CGCTGTCAAAGCAAGAAGGAGGG - Intergenic
922201391 1:223404441-223404463 TGATGTCAAAGGAAGATGAGTGG + Intergenic
1063843072 10:10093259-10093281 AGACGTCAAAGCAAAATGAAAGG + Intergenic
1064140177 10:12783697-12783719 TGTTTTAAAAACAAGATGAAAGG + Intronic
1066073496 10:31847196-31847218 TGGTGACACACCAAGATGACAGG - Intronic
1067756143 10:49007328-49007350 TGGTGTCACTGGAGGATGAAAGG + Intergenic
1069249057 10:66245517-66245539 TGGAGGGTAAGCAAGATGAAGGG + Intronic
1071661683 10:87509614-87509636 TGGTGAGAAAGGAAGAAGAATGG - Intronic
1073382672 10:103091835-103091857 TGGTGTTTAAGCAGGAGGAAAGG - Intronic
1073479426 10:103777247-103777269 TGGTGTCATAACAAGAGTAATGG - Intronic
1073642760 10:105269682-105269704 AGGTATCAAAGGAAGAAGAAGGG + Intergenic
1073773756 10:106763643-106763665 TGTTTTCAGAGCCAGATGAAAGG + Intronic
1078526291 11:12104022-12104044 TGGTGCCATAGCCAGAGGAATGG - Intronic
1081588095 11:44401349-44401371 ATGTGTTAAAGCAAGATAAACGG - Intergenic
1081823714 11:46025403-46025425 TGGTGCTAAAGCAGGAAGAAAGG - Intronic
1082625871 11:55484752-55484774 GGGTGTCAAGGCAAACTGAAGGG - Intergenic
1084312537 11:68325267-68325289 TGTTGGCAGAGCAGGATGAAAGG + Intronic
1085715642 11:78870844-78870866 TGGTGACAAGGCAAGTTGTAGGG + Intronic
1086047532 11:82550213-82550235 TGGTGTGGAAGCAAGAGGAAAGG - Intergenic
1091971772 12:4793471-4793493 AGGTGGCAAACCAAGATGAAGGG + Intronic
1093798646 12:23344692-23344714 TGGAATCAAAGCCAGAGGAAGGG - Intergenic
1095600281 12:44005385-44005407 TGATGTCAAAGGAAGTTGGAAGG - Intronic
1095953667 12:47795014-47795036 TGGAGTCCTAGCAAGATGACTGG - Intronic
1096360839 12:50984879-50984901 TGGTGACAACCCAACATGAAGGG + Intronic
1096696929 12:53355272-53355294 GGGTGACAGAGCAAGATGGATGG + Intergenic
1097951346 12:65432365-65432387 TTGTGGCAAGGAAAGATGAATGG + Intronic
1099101040 12:78440365-78440387 AGGAGTCAGAGCAAGATGAATGG - Intergenic
1099666702 12:85639834-85639856 TGATGTGAAAGCTAGATGAAAGG + Intergenic
1101005617 12:100398421-100398443 TGCTGGCAAATCAAAATGAAAGG - Intronic
1102714874 12:114961638-114961660 TGTTGTCCAAGCAAAATAAACGG + Intergenic
1103828589 12:123761435-123761457 AGCTGTCAAATCAAGATGATGGG + Exonic
1104063366 12:125286328-125286350 TGGTGTCAGAGCAAGCAGCAGGG - Intronic
1106630671 13:31468437-31468459 TGGTGTCAAAGAAAAGGGAAGGG + Intergenic
1106929085 13:34644360-34644382 TGGGTTCAATTCAAGATGAAGGG + Intergenic
1107681895 13:42860665-42860687 TTCAGTCAAAGCAAAATGAAAGG - Intergenic
1108168888 13:47721086-47721108 AGGTTTCAAGGCATGATGAAAGG - Intergenic
1108274661 13:48795690-48795712 TGGTGTCAAAGCAGAATGAAGGG + Intergenic
1108415349 13:50192760-50192782 TGTTTTCAAGCCAAGATGAAGGG - Intronic
1109107441 13:58273344-58273366 TGGTATCCAATGAAGATGAATGG - Intergenic
1109338044 13:61017825-61017847 TGGTGAAAAATAAAGATGAATGG - Intergenic
1109763922 13:66867663-66867685 AGTTGTCAAAGAAAGATGATAGG - Intronic
1109929142 13:69190238-69190260 TAATGCCAAAACAAGATGAAAGG - Intergenic
1110434571 13:75464689-75464711 TTGTGCCAATGCAAGATCAAGGG - Intronic
1112006750 13:95260152-95260174 GTGTGTCAAAGCAAGCTGTATGG - Intronic
1113290673 13:108902245-108902267 CTGTGTCTAAGCAAGAGGAAGGG + Intronic
1114491094 14:23102440-23102462 TAGTGACAAGGCAAGATGAGTGG - Intergenic
1115248327 14:31319483-31319505 TAGGGACAAAGCAAAATGAAGGG - Intronic
1116002056 14:39254437-39254459 TGCTGTCAAATAAAGATTAAAGG + Intronic
1116100517 14:40427903-40427925 TATTGACAAAGTAAGATGAAAGG - Intergenic
1118608158 14:67518200-67518222 TCTTGTCAAAGCAAGAGGAGCGG + Intronic
1120029264 14:79622108-79622130 TGATGTCAGAGCAACGTGAAAGG + Intronic
1121141003 14:91541433-91541455 TGGTGTCAAAGGAGGCTGAGTGG + Intergenic
1123049536 14:105534238-105534260 TGTTCTGAAAGGAAGATGAAGGG - Intergenic
1123436507 15:20258409-20258431 TTGTTTCCAAGCAAGATGACAGG + Intergenic
1124069801 15:26380733-26380755 TGCTATCAAAGCACGATGACAGG + Intergenic
1126778317 15:52118267-52118289 TGTTCTCAAAGCAAGATCCAGGG + Exonic
1128411153 15:67399160-67399182 TGGAGTCAAAGCAACTTGAATGG + Intronic
1129100925 15:73262984-73263006 TAGTGACAAAGCAAGATCAGTGG + Intronic
1130267860 15:82424901-82424923 TGGTATCTAAACAAGAAGAAAGG + Intergenic
1130504164 15:84521933-84521955 TGGTATCTAAACAAGAAGAAAGG - Intergenic
1130759167 15:86799714-86799736 TGGAGTCAAATGAAGATGTAAGG - Intronic
1132993085 16:2807468-2807490 TGCTGGCAAGGCAAGAGGAAAGG + Intergenic
1134060199 16:11194947-11194969 TCGTGCCAAAGCAAGCTCAAGGG + Intergenic
1136848064 16:33592444-33592466 TTGTTTCCAAGCAAGATGACAGG - Intergenic
1137342256 16:47620102-47620124 TGGTTTAAAAACAAAATGAAGGG - Intronic
1138766102 16:59606589-59606611 TCTTGCCAAATCAAGATGAATGG - Intergenic
1138859731 16:60742295-60742317 TGCTGACAAAGCAACATGTAGGG - Intergenic
1139267630 16:65655208-65655230 TAGTCTCAAAGGGAGATGAATGG + Intergenic
1140784905 16:78331507-78331529 GGAAGTCAAAGCAAAATGAATGG - Intronic
1203109772 16_KI270728v1_random:1441093-1441115 TTGTTTCCAAGCAAGATGACAGG - Intergenic
1144290903 17:13825311-13825333 TGGAGTAAAAGCAAGACAAAGGG - Intergenic
1146091850 17:29887051-29887073 TGGTAGCAAAGCCAGATGAATGG + Intronic
1147962480 17:44176666-44176688 GAGTGTCACAGCAAGCTGAAGGG + Intronic
1148540256 17:48474752-48474774 TGGTGGAAAAGCAAGATAGAAGG - Intergenic
1149637371 17:58181686-58181708 TGGTGTTAAAGGAAAAAGAAAGG + Intergenic
1150201830 17:63365102-63365124 GGTTGTCAAACCAAGATTAATGG + Intronic
1151176854 17:72295846-72295868 TGGTGTCAAACAAAGAAGGAGGG + Intergenic
1153141766 18:1980797-1980819 TGGTTTCATAGGAAGTTGAAGGG - Intergenic
1155489918 18:26390541-26390563 TGTTGTCAAAACAAGACAAATGG + Exonic
1156043786 18:32855388-32855410 TGGGGTCCAATCAAGATGATAGG + Intergenic
1156504746 18:37582697-37582719 TGGTGCAGAAGCAGGATGAAGGG - Intergenic
1157212479 18:45755556-45755578 TGGAGCAAAAGCAAGAGGAATGG + Intergenic
1157710120 18:49844292-49844314 TGGTGCAAAGGCAAGATGACAGG + Intronic
1157922656 18:51729330-51729352 TGGTGTGATAGCAAGAAAAATGG - Intergenic
1158886643 18:61834358-61834380 TGGTGTCTAAGCCAGCTGGAGGG - Intronic
1162269607 19:9603602-9603624 AGGTGATAAAGCAAGATGAGAGG + Intergenic
1162301375 19:9847014-9847036 TTGTGTCAGAGCAAGAGGATTGG + Intronic
1162753556 19:12843562-12843584 TGGTGCCATAGCCAGATGAAGGG - Exonic
1164212937 19:23116428-23116450 TGGTGACAGAGTGAGATGAAAGG - Intronic
1165032573 19:33008812-33008834 TTGTTTCCAAGCAAGATGACAGG + Intronic
1165785979 19:38462264-38462286 TGTTGTGAAGGTAAGATGAATGG + Intronic
1166084067 19:40463623-40463645 GGGTGACACAGCAAGATGAAAGG - Intronic
925090401 2:1150551-1150573 TGGGGTCAGGCCAAGATGAATGG + Intronic
925401672 2:3577614-3577636 TGCTTTAAAAGCAAGAAGAATGG - Intronic
928256529 2:29727792-29727814 TGTTAACAATGCAAGATGAATGG - Intronic
930502495 2:52239220-52239242 TTGTGTCAAAGCTAGATTATAGG - Intergenic
931834424 2:66083848-66083870 AGGTGTCAAGGCAACATGAATGG + Intergenic
935847492 2:107182539-107182561 TGGGGTAAATGGAAGATGAAGGG - Intergenic
937152525 2:119695843-119695865 AGGACTCAAAGCAAGATGCACGG - Intergenic
937576468 2:123428545-123428567 GTGTGTCAAAGCAAGATAACTGG - Intergenic
937832606 2:126439974-126439996 TGGTGTCATACCAAGTTGGATGG - Intergenic
938231492 2:129664413-129664435 TGGTATCAAAGTGAGTTGAAAGG - Intergenic
938680781 2:133687659-133687681 AGATGTCTAAGCAAGATGATGGG - Intergenic
939430581 2:142100879-142100901 TGTTCTCAAAGCAAAAGGAAGGG - Intronic
939539202 2:143472940-143472962 TAGTATCAGAGCAAGATGTATGG - Intronic
941644281 2:168023771-168023793 TGCTCTCAAATGAAGATGAAAGG + Intronic
942695009 2:178632250-178632272 CGGTCTCAATGCAAGACGAAGGG - Exonic
944595167 2:201254627-201254649 GGGTGTCACATCAAGATGAATGG + Intronic
944636218 2:201678431-201678453 TGCAGTTAAAGCAAGAAGAAAGG - Intronic
945214350 2:207417448-207417470 TGGTGTAAAAGATAGATAAAGGG - Intergenic
946736683 2:222760828-222760850 TGGCGTCTATGCTAGATGAAGGG + Intergenic
1171361384 20:24588713-24588735 TGGTGTGAAAGGAAGAGGGAAGG + Intronic
1171918097 20:31075890-31075912 TGGAATCAAAGCAAGTGGAATGG + Intergenic
1173909564 20:46654839-46654861 TGGTCTCAAAGAATGATTAAAGG - Intronic
1174882642 20:54297116-54297138 TGGTGTGAGAGCAGGATGTAAGG - Intergenic
1175689822 20:61057238-61057260 AGCTGTCAAAGCAAGAGGCACGG - Intergenic
1177647965 21:23923496-23923518 TGATGGCAAAGAAAGGTGAATGG - Intergenic
1178270464 21:31184551-31184573 TGGTGTTAAATGAAGATGAACGG - Intronic
1179157119 21:38860213-38860235 AGGAGTCAAGGAAAGATGAAGGG + Intergenic
1179340197 21:40500734-40500756 TGGTTTCAGAGCAACCTGAATGG + Intronic
1181376912 22:22466028-22466050 TGATGTCAAAGCTAGCTGATGGG + Intergenic
1181907103 22:26207231-26207253 TGGTGTCAAAGCAAGATGAATGG - Intronic
1183470161 22:38000958-38000980 TGATGTTGAGGCAAGATGAAGGG + Intronic
954837969 3:53487311-53487333 TGAGGCCAAAGCAAGAAGAAAGG + Intergenic
956352105 3:68348900-68348922 TGGGGCAAAAGCAAAATGAATGG + Intronic
956638057 3:71386057-71386079 TGGTGTGAAAGACAGATGATTGG - Intronic
956653110 3:71523319-71523341 TGGTGTTAAAGCCAGAGGCAGGG + Intronic
957877487 3:86167378-86167400 TGTTGAAAAAGCAAGATAAAAGG + Intergenic
959265717 3:104135443-104135465 GGAAATCAAAGCAAGATGAATGG + Intergenic
961400614 3:126639533-126639555 CAGTGTCCAAGTAAGATGAAGGG + Intronic
961938840 3:130615878-130615900 TCTTGCCAAAGCAAGATTAAAGG - Intronic
964648457 3:158984809-158984831 TGGTGTCAAAGAATAAGGAAGGG - Intronic
964669744 3:159211867-159211889 TGGAGTCAAATCAAGGAGAATGG + Intronic
965559384 3:170046987-170047009 TGGTGTCCAGGGAAGCTGAATGG + Intronic
970755984 4:19427770-19427792 AGATGTCAAAGGAAGAAGAAAGG + Intergenic
976485165 4:85593448-85593470 TGGGGTCACATCAAGTTGAAAGG - Intronic
978420072 4:108522603-108522625 TGGTGGAAAAAAAAGATGAAAGG - Intergenic
979399484 4:120231089-120231111 AGGTGTCAGAGCAAGATCAAAGG + Intergenic
979786900 4:124726815-124726837 TGGTGTCAAACCAATATTACTGG - Intergenic
980953151 4:139401408-139401430 TAGGGACAAAGCAAGGTGAAGGG + Intronic
981842214 4:149125725-149125747 TGGTGACAATGGAATATGAATGG - Intergenic
985814483 5:2116431-2116453 TGGTGCCACAGCAAGATGCCTGG + Intergenic
985854619 5:2415399-2415421 CGTGGTCAAATCAAGATGAACGG - Intergenic
986333933 5:6738773-6738795 TGGTGTCTATGCAATATTAAGGG + Intronic
986389597 5:7272307-7272329 TGGTACCTTAGCAAGATGAAAGG + Intergenic
987881740 5:23755627-23755649 TAGTGTCAGAGGAAGCTGAATGG + Intergenic
989348970 5:40462809-40462831 TTCTGTCACAGCAAAATGAATGG + Intergenic
990810329 5:59715527-59715549 TGAAGTCAGAGCAATATGAATGG + Intronic
990974531 5:61547530-61547552 TGGCATCAAAGAAAGAAGAAAGG + Intergenic
992335494 5:75764193-75764215 TGGTTGCAGAGGAAGATGAAAGG + Intergenic
992860213 5:80901581-80901603 TGTTTTCAAAGCATGCTGAAAGG + Intergenic
993233380 5:85269390-85269412 TGGTGTCAAAGAAAAATCAGAGG + Intergenic
994179964 5:96753381-96753403 TGGTGTCAAGGGAAAATAAAGGG - Intronic
994225691 5:97249640-97249662 TAGTGTGAAAGCAAGAGGAGTGG - Intergenic
994979390 5:106854348-106854370 TTGTGGCACAGAAAGATGAAGGG - Intergenic
995061510 5:107815613-107815635 TGGTGTCAAAGTAAGACTTAAGG - Intergenic
995535661 5:113133441-113133463 TCCTGTCACAGCAACATGAATGG - Intronic
995892885 5:116975649-116975671 TTTTGCCAAAGCCAGATGAAAGG - Intergenic
996921398 5:128771719-128771741 TTGTGGCAAACCAAGATGACTGG + Intronic
997692586 5:135836830-135836852 TGGTGCCAATGCTAGATGCATGG - Intronic
997834761 5:137183284-137183306 TGGGGTCACAGAAAGATGAATGG + Intronic
999300724 5:150488620-150488642 TGTGGTCAGAGCAAGAGGAAAGG + Intronic
1000197778 5:158976353-158976375 TGGTGTGAAATCAAGCTGGAGGG - Intronic
1003855183 6:10266453-10266475 TGCTTTAAAAGAAAGATGAAAGG + Intergenic
1004448133 6:15721433-15721455 AAGTGTCTAAGTAAGATGAAAGG + Intergenic
1005206239 6:23408500-23408522 TGGTGGCAAAGCAAGCAGACGGG - Intergenic
1005397801 6:25401639-25401661 GTGTTTCAAAGCAAGATTAATGG + Intronic
1006377134 6:33677837-33677859 TGGGGTCAAATCAAGGTCAAAGG - Intronic
1009498312 6:64378141-64378163 TAGTGTCAAAGCCTGAGGAATGG + Intronic
1010022213 6:71173781-71173803 TGGTGTCAAAGGAAACTGAGTGG - Intergenic
1012103244 6:95119272-95119294 TGGAGTCAAAGGAAAATAAAAGG - Intergenic
1012155398 6:95813318-95813340 TGGTGTCAGAGAAAGCTAAATGG - Intergenic
1013665210 6:112340640-112340662 TTGTGTTATAGCATGATGAAGGG - Intergenic
1014693586 6:124591595-124591617 TGGTATCAAAGCAATTTGAAAGG + Intronic
1016308056 6:142703830-142703852 TGGGGTAAAAGCAAGGTGACTGG - Intergenic
1016804198 6:148196526-148196548 TGGTGGCAAAGAAAGATGGCTGG - Intergenic
1017067406 6:150542051-150542073 TGGTGTCACCTAAAGATGAATGG - Intergenic
1018097635 6:160405452-160405474 TGGTGAGAATGCAAAATGAAAGG + Intronic
1020483611 7:8693097-8693119 CAGAGTCAAAGCAAGAAGAAGGG + Intronic
1021290294 7:18835302-18835324 TGGTGTGGAAGCAGGCTGAAAGG + Intronic
1021350082 7:19581631-19581653 TTGTGTCAATGGAAGATGAGTGG + Intergenic
1022839060 7:34145305-34145327 TGGAGTCAGAGGAAGGTGAAAGG - Intronic
1022939211 7:35215927-35215949 TAGTTTCAAAGCTAGAGGAAGGG - Intronic
1024963272 7:55000357-55000379 TGGTGTCACAGCACAGTGAATGG + Intergenic
1026231703 7:68489565-68489587 TAGTGTCAAAGAAAGAGGAAAGG + Intergenic
1026736292 7:72950799-72950821 TGGTGTCCAAGCAACATGGTAGG + Exonic
1027107441 7:75414263-75414285 TGGTGTCCAAGCAACATGGTAGG - Intergenic
1028075159 7:86503446-86503468 TGGTGGCAAAACAAGAGGCAGGG + Intergenic
1029378696 7:100198595-100198617 TGGTGTTAAAGAAACATAAAAGG - Intronic
1029726348 7:102408166-102408188 TGTGTTCAAAGCAAGAAGAAGGG + Intronic
1036086782 8:5621231-5621253 TGGTGTCAGAGCAAGAGAAGAGG + Intergenic
1036195034 8:6707141-6707163 TGGGGACAAAGCCAGGTGAATGG - Intergenic
1036682788 8:10887724-10887746 TGGTGTCAAGGCAAGTGAAAAGG + Intergenic
1037340328 8:17838114-17838136 TAGTGGCAAACCAAGATGATAGG - Intergenic
1037984776 8:23283328-23283350 AGGTGTCAAAGGAAGCTGCATGG - Intronic
1038809951 8:30830154-30830176 TGATGTCAAAGATGGATGAAAGG + Intergenic
1039721444 8:40168754-40168776 TGGTATTAAAGCAACAAGAAGGG - Intergenic
1040885769 8:52262084-52262106 CTGTGTCAAAACATGATGAAAGG + Intronic
1040987383 8:53311156-53311178 TGGAGTCAATGCAGCATGAATGG - Intergenic
1041462753 8:58129992-58130014 TACTTTCAAAGCAAGAAGAAAGG - Intronic
1041620598 8:59963720-59963742 AGGTGTCAGTGCAACATGAAGGG + Intergenic
1043376279 8:79653421-79653443 TGGGGTTAAAGCAAGAGGCAGGG + Intronic
1047468325 8:125141843-125141865 ATGTTTCAAAGCAAGAAGAACGG - Intronic
1048818788 8:138360400-138360422 TGGTGAGAAAGCAGGAGGAATGG - Intronic
1049918047 9:337453-337475 TGTTGTCATAGCATAATGAATGG - Intronic
1050268133 9:3912868-3912890 AAGACTCAAAGCAAGATGAAGGG + Intronic
1050814441 9:9791612-9791634 TAATGTAAAAGAAAGATGAAAGG - Intronic
1051303415 9:15679289-15679311 TGGTGTAAAAGCTAGATTACTGG - Intronic
1053192156 9:36081393-36081415 TGGTGAAAAAGCCAGCTGAATGG + Intronic
1055116988 9:72615725-72615747 AGGTGTCAAAGCAAAAAGAGAGG - Intronic
1055256603 9:74379244-74379266 AGATGTAGAAGCAAGATGAAAGG + Intergenic
1055652808 9:78423321-78423343 TGGTGTGAAAGCAAAGGGAACGG + Intergenic
1057429980 9:94984880-94984902 TGCTGTCACAGCAAATTGAAGGG - Intronic
1057431506 9:94998841-94998863 TGGTATCAAAACCAGAAGAAAGG - Intronic
1057444301 9:95103230-95103252 TGGTGTGTAAGGAAGATGCAAGG - Intronic
1058489719 9:105484398-105484420 TGGTTTCAAAGAAAGGCGAAAGG - Exonic
1058608209 9:106746172-106746194 TGGTGACAATCCAAAATGAAAGG - Intergenic
1058658471 9:107247062-107247084 GGATGTCATAGCAAGAGGAATGG - Intergenic
1060818544 9:126648637-126648659 TGGTGGCACAGCAAGCTGGATGG + Intronic
1203721270 Un_GL000216v2:15140-15162 TGGTATCAACCCAAGTTGAATGG - Intergenic
1203721285 Un_GL000216v2:15225-15247 TGGTATCAACCCAAGTTGAATGG - Intergenic
1188943782 X:36271375-36271397 TGGAGTCAAAGGATGATGCAAGG + Intronic
1190272596 X:48877755-48877777 TGCTGTTAAAGAAAGGTGAAAGG + Intergenic
1190409905 X:50126126-50126148 TGGAGTCAAAACAAGAGAAAAGG + Intergenic
1190571498 X:51786881-51786903 TGGTTTCAGAGGAGGATGAATGG - Intergenic
1192080283 X:68041151-68041173 TCATGGCAAAGCAACATGAATGG - Intergenic
1192283158 X:69705437-69705459 TGGTGTTAGGGAAAGATGAATGG - Intronic
1194912364 X:99662129-99662151 AGCTGTCAAATCAAGGTGAATGG - Intergenic
1195735605 X:108009648-108009670 TGTCCTCAGAGCAAGATGAAGGG - Intergenic
1196237408 X:113299535-113299557 TCATCTCAAAGCATGATGAAGGG + Intergenic
1196960364 X:120993855-120993877 TGGTGACAAAGAAAGCTGAGTGG - Intergenic
1197718413 X:129727242-129727264 TGGTGTCAAGGCAAGGGGGAGGG + Intergenic
1200760256 Y:7031564-7031586 TGGTGTCAAGGTGAGCTGAATGG + Intronic
1202365746 Y:24162662-24162684 TGGTATCTAAACAAGAAGAAAGG + Intergenic
1202505036 Y:25507460-25507482 TGGTATCTAAACAAGAAGAAAGG - Intergenic