ID: 1181911732

View in Genome Browser
Species Human (GRCh38)
Location 22:26243814-26243836
Sequence CCAGAGAAGAAAAATGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 754
Summary {0: 1, 1: 0, 2: 9, 3: 64, 4: 680}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181911724_1181911732 12 Left 1181911724 22:26243779-26243801 CCTGGTCTGGTAATTTTATTTAA 0: 1
1: 0
2: 7
3: 53
4: 498
Right 1181911732 22:26243814-26243836 CCAGAGAAGAAAAATGAGCAGGG 0: 1
1: 0
2: 9
3: 64
4: 680

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181911732 Original CRISPR CCAGAGAAGAAAAATGAGCA GGG Intronic
900896260 1:5484998-5485020 CTAGAGAAGAAAAGTGGTCAGGG - Intergenic
901641657 1:10695680-10695702 GCAGAAAAGAAAGAGGAGCACGG - Intronic
902086426 1:13866441-13866463 TCAAAGACGAAAAAAGAGCATGG - Intergenic
902174487 1:14638978-14639000 CCAGAGAGGTAAACTGAGGAAGG - Intronic
902822137 1:18949929-18949951 CCAGAAAAGAAAAGGAAGCAGGG - Intronic
902959126 1:19949813-19949835 AAAGAGAAAAAAAATGGGCAGGG + Intergenic
903295004 1:22338120-22338142 CCAAAGAAAAAAAATTAGCTGGG + Intergenic
903468741 1:23569855-23569877 CCAGATAAGAAAACTGAGGGAGG - Intergenic
903707589 1:25298152-25298174 CCAGAGTGGAAAAATGACCCAGG - Intronic
903719652 1:25395202-25395224 CCAGAGTGGAAAAATGACCCAGG + Intronic
904798169 1:33073066-33073088 CCAGAGAAGAAAATTCAGAATGG - Intronic
904904928 1:33889286-33889308 CCAGAAAATAAAAGTGACCATGG + Intronic
905701087 1:40014983-40015005 CCACAGAAGGAGAAAGAGCATGG + Intergenic
906489565 1:46257704-46257726 CAAGAGAAGGAACATGAGAAAGG - Intronic
906492330 1:46278352-46278374 CCAGAGAACAAAATTCAACAGGG - Exonic
906941929 1:50263036-50263058 CAAGAGAAGAGAAAAGAGCCAGG + Intergenic
907523766 1:55041517-55041539 CCAGAGAAGAAACATCCTCAAGG - Intronic
907562218 1:55401505-55401527 CAAGAGAAGACATATGAGAAGGG + Intergenic
907650389 1:56289118-56289140 CCAGAGAAGAAAAAGCAGTGGGG - Intergenic
907659883 1:56382185-56382207 CCAGAGAAGAAGAAAGAGGGAGG + Intergenic
907935744 1:59040744-59040766 CCAGAGAAGTAAAAACAGGAGGG + Intergenic
908438036 1:64126126-64126148 CAGGTGAAGAAAAATGAGAATGG + Intronic
908508327 1:64828169-64828191 CCAGACAAGGAAAATGGGCGGGG - Intronic
908636805 1:66175615-66175637 CAAGAGAAGAAAAATGTCCACGG - Intronic
908912425 1:69087703-69087725 CAAGGAAAGAAAAATGAGAAAGG - Intergenic
909336405 1:74480110-74480132 CAAGAGAAGAGAAAAGAGGAGGG + Intronic
909865390 1:80662100-80662122 CCATGGAACAAAAATGAACAGGG + Intergenic
909909147 1:81239512-81239534 TCAGAAAAAAAAAATGAGCATGG - Intergenic
910123836 1:83818960-83818982 CAAAAGAAGAAAAATAAGCAAGG + Intergenic
910191424 1:84599846-84599868 CCAAAAAAGAAAAATTAGCCAGG + Intergenic
910687664 1:89934018-89934040 GCAGAGAATAAAAATGAACTTGG - Exonic
910835994 1:91510923-91510945 CGAGAAAAGAAAACTGAGCTTGG - Intronic
911010966 1:93280378-93280400 GCAGAAAAGAAAATTGAGAATGG + Intergenic
911565033 1:99454201-99454223 CCAGTGAAGAATAAACAGCAGGG + Intergenic
911958548 1:104269371-104269393 TAACAGAAGAAAAAGGAGCAGGG - Intergenic
912173707 1:107132465-107132487 CCAGAGAAGTAAAATGATGTAGG + Intergenic
912456740 1:109803208-109803230 ACAGAGAAGGAAAATGAGTCAGG + Intergenic
913142649 1:115956584-115956606 CCAGAGTAGATGCATGAGCAAGG - Intergenic
914909737 1:151775166-151775188 TCTGAGAAGAAAAATGAAAAGGG + Exonic
914986968 1:152468264-152468286 CCAGAGAAGAGAAATCCACAAGG - Intergenic
915317628 1:155038174-155038196 CCAGAGAGGAGGAATGAGCTTGG + Intronic
915422125 1:155791388-155791410 CCAGAGAAGAGTAATGTGCATGG + Intronic
915759702 1:158298064-158298086 ACAGGAAAGAAAAAAGAGCAGGG + Intergenic
915969174 1:160341014-160341036 CCAGAGAAGGCAAATAAACAAGG - Intronic
916281020 1:163051420-163051442 TCAAAGAAGAAGAAGGAGCATGG + Intergenic
916284877 1:163095257-163095279 CCAGAGAAATAAAGTGAGGAAGG + Intergenic
916305390 1:163324603-163324625 CCAGTGAAGCAAAATGATCTCGG - Intronic
916603728 1:166320273-166320295 ACAGAGAAGAAAAATGATAGAGG - Intergenic
916708940 1:167383947-167383969 CCATAGAAGAAAACTGACCTGGG - Exonic
916741958 1:167653995-167654017 TCAGAGAAGCAAAATGACAAAGG - Intronic
916812287 1:168316181-168316203 GTAGAGAAGATACATGAGCAAGG - Intergenic
917108052 1:171514967-171514989 ACATAGATGAAAAATGAGTATGG - Intronic
917478934 1:175393805-175393827 CCATCGAAGGAAAATGAGAAGGG + Exonic
917525754 1:175787092-175787114 CCAGAGAAGAAAGTTCAACAGGG - Intergenic
919037828 1:192338734-192338756 ACAGAAAAGGAAAATGAGCTAGG - Intronic
919047686 1:192474189-192474211 GCAGAGAAGAAAAATAACCTTGG - Intergenic
919172222 1:193969256-193969278 CCAGAAAACAAAAATTAGCCAGG + Intergenic
919176596 1:194027133-194027155 CCAGCCTGGAAAAATGAGCAAGG - Intergenic
919622324 1:199876758-199876780 ATCGAGAAGGAAAATGAGCAAGG + Intergenic
919750934 1:201037775-201037797 CTAGAGAGGAGAAATGAGAATGG + Intergenic
919821260 1:201473688-201473710 CCATAGAGAAAAATTGAGCAGGG - Intergenic
919918069 1:202151299-202151321 CCAGAGAAGAAATGTGAAAATGG - Intronic
921555132 1:216589556-216589578 CCAGAGAAGGAAACTAAGAAAGG + Intronic
922466451 1:225848224-225848246 GCAGAGAAGGAAAGAGAGCAGGG + Intronic
923221926 1:231903220-231903242 CCTAAGAAGAAAAATGGGCCAGG - Intronic
923741995 1:236663426-236663448 CCAGAGAAGTATAATGACAATGG + Intergenic
924531382 1:244896784-244896806 GCTGAGAGGAAACATGAGCAAGG + Intergenic
1063096595 10:2913877-2913899 CCAGAGAATAAATATTAGCCAGG + Intergenic
1063243626 10:4195657-4195679 CAAGAAAAGAAAAATTAGCTGGG + Intergenic
1063353336 10:5375607-5375629 ACCCAGAAGAAAAATAAGCAAGG + Intergenic
1064242301 10:13641588-13641610 CCAGGGAAGAAAAACTACCAAGG + Intronic
1064379885 10:14832070-14832092 GCAAAGAAGAAAAATAAACATGG + Intronic
1064934267 10:20662534-20662556 GAAGTGAAGAAAATTGAGCAAGG - Intergenic
1066004023 10:31130898-31130920 TCAGAGAAGAAAAATTTTCAGGG - Intergenic
1066470981 10:35698048-35698070 CCAGATTAGAAAAATAATCATGG - Intergenic
1067117678 10:43447739-43447761 CCAGAGAAGAAAGAGCTGCATGG - Intronic
1067716392 10:48694180-48694202 CCAGAGAAGGAAAATGACAGGGG - Intronic
1068098793 10:52525927-52525949 GCAGACAAGAAACAAGAGCAGGG - Intergenic
1068674559 10:59757395-59757417 CAAGAGACCAAAAATGACCATGG - Intergenic
1068782873 10:60940749-60940771 CCAGACAAAAAAAATGTGCTTGG + Intronic
1069305114 10:66959466-66959488 CAAGAGAACAAAAATATGCAAGG + Intronic
1070163932 10:73883662-73883684 CCTGAGAAGAAAACTGGTCAAGG - Intergenic
1070270518 10:74950059-74950081 ACAGAGAAGTATAATGAGCAGGG + Intronic
1070459888 10:76654422-76654444 ACAGAAAACAAAAAAGAGCAGGG + Intergenic
1070835871 10:79446486-79446508 CCAGAGCAGAAATAGGAGAAGGG - Intergenic
1071171811 10:82875197-82875219 TCAGAGGAGATAAATGAGTAAGG - Intronic
1071336676 10:84606117-84606139 CCGGAGAGGAAAAATAAGCAGGG - Intergenic
1071506708 10:86236781-86236803 ACAGAGAAGGAAAATGTGCATGG + Intronic
1071777572 10:88806341-88806363 CAGGAGGAGCAAAATGAGCAGGG - Intronic
1071933273 10:90497727-90497749 ACAGAGAAGAAATATGGGTATGG - Intergenic
1071987160 10:91063392-91063414 CCAGAGAAGAGAAGGGATCAAGG + Intergenic
1072027037 10:91469892-91469914 ATAGAAAAGAAAAAAGAGCAGGG + Intronic
1072039649 10:91594713-91594735 TCAGGGAAGCAAAAGGAGCAAGG + Intergenic
1072802513 10:98402959-98402981 CCAGAGGAGAGAAATGAGATCGG + Intronic
1073209464 10:101787451-101787473 TCAGAGAAGGGAAATTAGCAAGG + Exonic
1073758616 10:106607332-106607354 GCAGAGAAGAAAGCTGAGAAGGG + Intronic
1074046251 10:109842070-109842092 TCAGAGAAGAAAGACCAGCATGG - Intergenic
1075313036 10:121430628-121430650 CCATGGAAGAATAATGGGCAAGG - Intergenic
1076349187 10:129803222-129803244 TCACAGTATAAAAATGAGCAAGG - Intergenic
1076882450 10:133246142-133246164 CCACTGAAGAAAAATGGACAGGG - Intergenic
1078134746 11:8642500-8642522 GCAGGGAAGAAAAATGCACAAGG + Intronic
1078583613 11:12560175-12560197 CAAAAGAAAAATAATGAGCAAGG - Intergenic
1078937708 11:15966151-15966173 CAAGAGAAGATAAGAGAGCATGG - Intergenic
1079234848 11:18680908-18680930 CAAGACCAGAAAAATGGGCAGGG - Intergenic
1079373210 11:19869831-19869853 GCAGAGAAGAACAATGAGGAAGG + Intronic
1079857838 11:25628542-25628564 CTAAAGAAGAAAAATTAGCTGGG - Intergenic
1080061808 11:27964383-27964405 ACTAAGAGGAAAAATGAGCAGGG - Intergenic
1080118948 11:28653275-28653297 ATACAGAAGAAAAATCAGCAAGG - Intergenic
1080151162 11:29053922-29053944 CCAGAAAACAAAAATGATCCTGG + Intergenic
1080445835 11:32336238-32336260 CAGTAGAAGAAAAATGGGCAGGG - Intergenic
1081598560 11:44476165-44476187 CAACACAAGGAAAATGAGCAGGG + Intergenic
1081944741 11:46980778-46980800 CCAGAGAAGAAAATTGGCAAAGG + Intronic
1083546725 11:63554302-63554324 CCAGAGGAGAAGACTGAGGATGG + Intronic
1085783876 11:79434571-79434593 CCAGGGAAGAAAAATGTTCTTGG + Intronic
1085798161 11:79562846-79562868 CAAGAGAAGAGAATTGTGCAGGG - Intergenic
1085818379 11:79765946-79765968 CCAGAGAAGAGAAGAGAGGAGGG - Intergenic
1087308299 11:96509164-96509186 GCAAAAGAGAAAAATGAGCAAGG - Intergenic
1087669196 11:101084797-101084819 ACAGAAAACAAAAAAGAGCAGGG + Intronic
1088107308 11:106221977-106221999 GGACACAAGAAAAATGAGCATGG + Intergenic
1088372839 11:109110478-109110500 GCTGAGATGAAAAGTGAGCAGGG + Intergenic
1088431383 11:109763164-109763186 CCAGAGGAGTGAAATGAGAAAGG + Intergenic
1088922731 11:114272931-114272953 ACAGATAAAACAAATGAGCAGGG + Intronic
1089789296 11:120931087-120931109 ACAGATAAGAAAAACGAGCTGGG + Intronic
1090062556 11:123476611-123476633 CAACAGCAGAAAAATGAACAAGG - Intergenic
1090249474 11:125241347-125241369 ACAGAGGAGATAAATGAGCAAGG - Intronic
1090345651 11:126067899-126067921 CCACAGAAGAACAATGTGAATGG + Intergenic
1090472523 11:126992894-126992916 GAAGAGAAGAAAAAAGATCATGG - Intronic
1090766136 11:129877860-129877882 CCAGGGAAGAAAAAGAAACATGG + Intronic
1092099191 12:5869280-5869302 GCACAGAAGAGTAATGAGCAGGG - Intronic
1092918968 12:13213924-13213946 CCAGAGGAGAAAATTGCACAAGG - Intronic
1093174414 12:15896071-15896093 AAAGAGAAGAAAAATTAGCTGGG + Intronic
1094006398 12:25757006-25757028 CAAGAGCAGAAAAACAAGCAAGG + Intergenic
1094093864 12:26681427-26681449 CCAGAAAAAAAAAATCTGCAGGG - Intronic
1094807541 12:34107506-34107528 CCAGAAAAAAAAAATGAGTATGG + Intergenic
1096163980 12:49404975-49404997 CAAAAAAAAAAAAATGAGCATGG - Intronic
1096489357 12:52005328-52005350 CTAGAGAAGAAGACTGAGCCAGG + Intergenic
1096553474 12:52389442-52389464 ACAGAGAAGAAAAGGGAGGAAGG - Intergenic
1096624606 12:52886677-52886699 CCAGATTAGAAAAATAATCAAGG - Intergenic
1096727715 12:53578484-53578506 AGAGAGAAGGAAAATGAGCTAGG + Intronic
1097017049 12:55994523-55994545 CCAGAAGAAAAAAATGAGCTGGG - Exonic
1097033639 12:56107362-56107384 CTAGAGAAGCAAAAGGAGAAAGG + Intronic
1097568580 12:61302156-61302178 CAAGAGAAGAGAAAGGATCAAGG + Intergenic
1097961613 12:65536858-65536880 CCAGAGAAGAAAAGAACGCAGGG + Intergenic
1098393569 12:69994961-69994983 CCATAGAAGAAAGATAAGCTGGG - Intergenic
1098482100 12:70975455-70975477 ACACAGCAGAAAAATGGGCAAGG + Intergenic
1099034368 12:77566881-77566903 CCAAATAAAAAAAATGAACATGG + Intergenic
1099424392 12:82504418-82504440 CCACAGAAGAGTTATGAGCAGGG - Intergenic
1099642563 12:85311141-85311163 CCAGAGAAGTACTAGGAGCATGG + Intergenic
1100320624 12:93488263-93488285 CAAAAGAAGAAAAAAGAGCCAGG - Intronic
1101322432 12:103684397-103684419 TGATAGAAGAAAAATGAGGAGGG + Intronic
1101538787 12:105645371-105645393 TCAGAGAAGAAATATGCTCAAGG + Intergenic
1101599435 12:106196207-106196229 CATGAGAAGGAAAAAGAGCATGG + Intergenic
1101735778 12:107461787-107461809 CCAGAGAAAGAAAATAAGCCAGG + Intronic
1101987682 12:109460561-109460583 GCAGAGAGGGAAAATGAGGAAGG + Intronic
1102774166 12:115504528-115504550 GCAGAGAAGAAAGGGGAGCAGGG + Intergenic
1102925313 12:116821607-116821629 CCAGGGAAGAAAAGCAAGCAAGG + Intronic
1103123098 12:118397208-118397230 CCAGAGAAGACACCTGAGCAGGG - Intronic
1103430419 12:120880319-120880341 CCTTAGAAGAAAAAAGAGAAGGG + Intronic
1103846936 12:123908306-123908328 CCAGAGAAGAAAGAGGGGGATGG - Intronic
1104363198 12:128153255-128153277 CCAGAGCAGGAACAAGAGCAGGG + Intergenic
1104424171 12:128660880-128660902 CCAGAGAAACAAGATGAGGAGGG + Intronic
1105059672 12:133137398-133137420 CCAGAGAACAAAAAGAAACAGGG - Intronic
1105548381 13:21368703-21368725 CTACAGAAAAAAAATGAGCTGGG + Intergenic
1106204921 13:27583966-27583988 CCAGAGAGAAAAAATGGACAAGG + Intronic
1106299169 13:28447969-28447991 CCAAAGAAGATAAACAAGCAGGG + Intronic
1106385313 13:29279264-29279286 GCACAGAAGAAACATCAGCAAGG - Intronic
1107069086 13:36250455-36250477 GCAGAGAAGAAAAATGGGTGTGG + Intronic
1107894164 13:44942808-44942830 ACAAAGAAAAAAAATTAGCATGG + Intronic
1108305331 13:49126196-49126218 CCAGACAAGAACCAAGAGCACGG - Intronic
1108571284 13:51754232-51754254 ACAGAGAAGTAAAATGTGAATGG - Intronic
1108972608 13:56395968-56395990 CCTGACAAGAAAGATGAGCTTGG - Intergenic
1109063756 13:57656635-57656657 ACAGAGATGGAAAAAGAGCACGG + Intronic
1109106201 13:58253544-58253566 GCAAAGAAGAAAAATGAGGAGGG - Intergenic
1109132084 13:58599968-58599990 AAAGAGAAGAAACATGAGGATGG - Intergenic
1109291394 13:60479820-60479842 ACAGAAAACAAAAAAGAGCAGGG - Intronic
1111633999 13:90880094-90880116 CCAAATAATCAAAATGAGCAAGG + Intergenic
1112153308 13:96788588-96788610 CAAGTGAACAAAAATAAGCAGGG - Intronic
1112204842 13:97314670-97314692 TCAAAGAAGAAAAAATAGCATGG - Intronic
1112535985 13:100256016-100256038 CCAAAGAAGAAAAAAAAGAAAGG - Intronic
1112684199 13:101804060-101804082 CCAGAGAATAAGAAGGAGCATGG + Intronic
1112980514 13:105378946-105378968 CCAGAGAAGACGAATAAGGATGG - Intergenic
1113272396 13:108687664-108687686 CCACAATAGAAAAATGAACAAGG + Intronic
1114040817 14:18676781-18676803 CCAGGGCAGGAAATTGAGCATGG + Intergenic
1114045855 14:18875285-18875307 CCAGGGCAGGAAATTGAGCATGG + Intergenic
1114118359 14:19644185-19644207 CCAGGGCAGGAAATTGAGCATGG - Intergenic
1114357851 14:21933002-21933024 CCAGAAAAAAAAAGTGAGAAGGG + Intergenic
1114831811 14:26152671-26152693 CCAGAGAGGAAAAAAGAGTCTGG - Intergenic
1115200507 14:30849162-30849184 CCAGGTAAGAAAACTGAGCTTGG - Intergenic
1115461495 14:33666034-33666056 CTTGAGAAGAAAAATGAGATAGG + Intronic
1115915432 14:38307467-38307489 ACAGAGAAGACTTATGAGCAAGG + Intergenic
1116254989 14:42542146-42542168 CCAGTGAAGGAAAATGGGCTGGG - Intergenic
1117014490 14:51504949-51504971 CCTGAGAAGGAATAGGAGCATGG - Intronic
1117036417 14:51734283-51734305 CCAGAGAAGGAAACTAAACAAGG + Intergenic
1117202992 14:53411547-53411569 CTAGAGAAGAAAAATGTTGAAGG - Intergenic
1117739653 14:58803859-58803881 CTACTGAAGAAAAATGAGGATGG + Intergenic
1117877331 14:60267231-60267253 CCAGGAAAGAAAAAAGAACAAGG - Intronic
1117980763 14:61340141-61340163 ACCGGGAAGAAAAATGAACAGGG - Intronic
1118264646 14:64283422-64283444 TAAGAGAAGATCAATGAGCAAGG + Intronic
1119430222 14:74562583-74562605 CCTTAAAAGAAAAATCAGCAAGG + Intronic
1119518540 14:75267959-75267981 CCATGGAAGAACAAGGAGCAGGG - Intronic
1119719138 14:76879505-76879527 ACAGAGAAGAAAAGGGACCAAGG + Intergenic
1119749196 14:77065473-77065495 AGAGAGAAGAAAAGTGAGCCAGG + Intergenic
1119757700 14:77130569-77130591 CCTGAGCAGACGAATGAGCAAGG - Intronic
1120301984 14:82719473-82719495 ACAGAAAATAAAAATTAGCAGGG + Intergenic
1120676935 14:87431516-87431538 CCAAAAAAGAGAAATGAGCAAGG + Intergenic
1120726147 14:87943768-87943790 CCAGACAACAGAAATGAACAAGG + Intronic
1120936945 14:89906060-89906082 ACAGATAAGAAAACTGAGCTTGG - Intronic
1121003136 14:90466232-90466254 CCACAGGAGAAGAATGACCAAGG + Intergenic
1121184758 14:91956841-91956863 CTTGAGAAGAAAAATGTGCAGGG + Intergenic
1122284019 14:100640194-100640216 CCAGAGAGGAAAAAACATCAGGG + Intergenic
1123219489 14:106842842-106842864 CCAGAGAATAACAAGGAGAATGG - Intergenic
1124509296 15:30309437-30309459 CCAAAGAAAAAAAAATAGCAGGG - Intergenic
1124734264 15:32229225-32229247 CCAAAGAAAAAAAAATAGCAGGG + Intergenic
1125130274 15:36276539-36276561 ACAGACAAGAAAAAAGAGCAGGG - Intergenic
1125350191 15:38758553-38758575 GCAGAGAACAAAAATTAGGATGG - Intergenic
1126291352 15:47083804-47083826 CCAGAGAAGAGAAATAAAAATGG - Intergenic
1126473457 15:49041733-49041755 CCACAGAAAAAATATGACCATGG + Intronic
1126909281 15:53401215-53401237 GCAGGGAAGAGAAATTAGCAAGG + Intergenic
1127310759 15:57750187-57750209 CCAGGGAATGAAAATGAGCTAGG - Intronic
1127524221 15:59776127-59776149 CTGGAGAAGAGAAATGAGCTGGG - Intergenic
1127561210 15:60138172-60138194 CCAGAGAAGAACAAAGAAGAAGG + Intergenic
1127574595 15:60278747-60278769 TATGAGAAGAAAGATGAGCAGGG - Intergenic
1127634722 15:60858401-60858423 GCAGTGAAGAAAAAAGACCAGGG + Intronic
1127755361 15:62086611-62086633 CCAGAGAAGAGAGTTGAACATGG - Intergenic
1127944110 15:63732639-63732661 AGAGAGAAGAATAATGAGCAAGG - Intronic
1127959583 15:63880740-63880762 TCACAGAACCAAAATGAGCAAGG + Intergenic
1128452802 15:67815954-67815976 CCAGACCAGAAAAACCAGCAAGG + Intergenic
1128876994 15:71209887-71209909 CAAGAGAAGAAAATTGTACAGGG - Intronic
1128901491 15:71426477-71426499 AAAGGGCAGAAAAATGAGCAGGG - Intronic
1129256469 15:74336817-74336839 CCAGAGAAGAAAAAGGACACAGG + Intergenic
1129616043 15:77099302-77099324 CCAGGGAGGAAACCTGAGCATGG - Intergenic
1129836171 15:78708139-78708161 CAAAAGAAGAAAACTGAGCTAGG + Intronic
1129987709 15:79933277-79933299 TCAGAGAAGAAAAATTTGAACGG + Intergenic
1130636624 15:85627645-85627667 CCAGAAATGTAAACTGAGCAAGG - Intronic
1131263003 15:90898794-90898816 ACAGAGAGGAAAAAAGAGAATGG + Intergenic
1131757102 15:95576779-95576801 ACAGAGAAGCATCATGAGCAAGG - Intergenic
1132239089 15:100243924-100243946 CCAGATGAGAAAACAGAGCAGGG + Intronic
1133468127 16:6047577-6047599 ACAGAGAAGAAAAGGAAGCAGGG + Intronic
1133572359 16:7054072-7054094 ACAGAGAACAAAAATGAAGAGGG - Intronic
1134279045 16:12802044-12802066 CCTGAGAAGAAATCAGAGCAGGG - Intronic
1136551145 16:30983247-30983269 CCAGGGAGGAGAGATGAGCAGGG + Intronic
1137491307 16:48935338-48935360 CCAGAGAAGGAAAAGGGACATGG + Intergenic
1137507145 16:49064008-49064030 ACAGATAAGAAAAATGAGGCTGG + Intergenic
1138689622 16:58754956-58754978 CCAGAGAAGAGAGATTAGGAGGG - Intergenic
1138723354 16:59108340-59108362 ACAGAAAAGAAAAATGAGCTGGG + Intergenic
1138839105 16:60476479-60476501 CCAAAGGGGAAAAATGATCAAGG + Intergenic
1139835267 16:69833396-69833418 CCAGAGAAAAAAAAGAACCAAGG - Intronic
1139905193 16:70360479-70360501 ACAAAAAAGAAAAATGAGCTGGG - Intronic
1140295866 16:73709202-73709224 ACAGAAAAGAAAAATTAGCCAGG + Intergenic
1140593719 16:76383427-76383449 ACAGAGGGGAACAATGAGCAAGG + Intronic
1140639980 16:76960372-76960394 GCAGAGCAGAAAGATGAACAGGG + Intergenic
1140981053 16:80109685-80109707 CCAAAGAAAAATTATGAGCAGGG + Intergenic
1141272236 16:82551893-82551915 GCACATAAGAAAAATGAGCCCGG + Intergenic
1141331777 16:83117483-83117505 CAAGAGAAAAAAGATCAGCAGGG - Intronic
1143918416 17:10311910-10311932 CGAGAGAACAAAAATCTGCAAGG - Exonic
1144367927 17:14562491-14562513 CCAAAGAAGAAATTTGAGCAGGG - Intergenic
1144378735 17:14671566-14671588 TCAGAGAGGAAAAGTGAGCCTGG - Intergenic
1144573099 17:16412683-16412705 ACAGACAAGAAAACTGAGCATGG - Intergenic
1145801081 17:27685323-27685345 CCAGAAAAGAAAGATCAGGAGGG - Intergenic
1145966742 17:28924277-28924299 CGAGAGCAGAAAAAGGAGCTGGG - Exonic
1146028824 17:29346808-29346830 CTACAAAAGAAAAATGAGCTGGG - Intergenic
1146106080 17:30038782-30038804 GCCAAGAAGAAAAATCAGCATGG - Intronic
1146138102 17:30340872-30340894 TCAGAGAAGAGAAAAGAGAATGG + Intergenic
1146495304 17:33316969-33316991 CCAGGAAAGAGAAATGTGCAGGG - Intronic
1147445233 17:40471292-40471314 CCAGAGAGGAAGAATGAGGAGGG - Intergenic
1148134923 17:45286103-45286125 CCAGAGACGGAAGATGAGGATGG - Intronic
1148962497 17:51405207-51405229 CCAGAGATGGAACATGAGCTGGG + Intergenic
1150104613 17:62453188-62453210 GCAGAGAATAAAAGGGAGCAGGG - Intergenic
1150803717 17:68302296-68302318 CCAAAAAAGACAAAAGAGCAGGG - Intronic
1150883241 17:69055403-69055425 CCAAAGAAGGAAAATTATCAGGG + Intronic
1150952987 17:69823025-69823047 CTAGAGAAGGAAAAAGAGGAGGG - Intergenic
1151389722 17:73777814-73777836 ACAGAGAAGAAAACTGAGGTAGG - Intergenic
1151501371 17:74491621-74491643 CCAGTGAATAGAAAGGAGCAGGG - Intergenic
1151809594 17:76430386-76430408 CCAGATTAGAAAAATAATCACGG + Intronic
1152510664 17:80785264-80785286 CCAAAGGCTAAAAATGAGCAGGG + Intronic
1153191663 18:2547569-2547591 CAAAAGAAGAAAACTAAGCAGGG + Intronic
1153267941 18:3289689-3289711 CCAAAGAAGTGAAATGGGCATGG - Intergenic
1153576801 18:6530440-6530462 ACAGAAAACAAAAAAGAGCAGGG - Intronic
1153901347 18:9619858-9619880 ACAGAGAAGTGAAATGAGAATGG - Intergenic
1153944205 18:10004339-10004361 CTAGACAGGAAAAATGAGCCTGG - Intergenic
1154376695 18:13816850-13816872 CCAGTGATGAAAACTGAGGAAGG + Intergenic
1155202872 18:23532894-23532916 CCATAGAAGTAAAAGGATCAAGG + Intronic
1155779577 18:29813751-29813773 ACAGAAAACAAAAAAGAGCAAGG + Intergenic
1156424189 18:36991005-36991027 ACAGACAAGAATGATGAGCAAGG - Intronic
1156507189 18:37605305-37605327 TCTGAGAATAAAAATGAGCTGGG + Intergenic
1156509541 18:37624903-37624925 CCAGAGAAGGAGACTCAGCAGGG - Intergenic
1156515768 18:37678891-37678913 ACAGAGATGAAAGTTGAGCAAGG + Intergenic
1157645615 18:49266448-49266470 CCACAGAACAAAAATTAGCTGGG + Intronic
1157975395 18:52321598-52321620 CCAGAGAAGAAAAGGAGGCAAGG - Intergenic
1158195405 18:54879972-54879994 GAAGAGAAGAAATATGAGCTGGG - Intronic
1158421351 18:57297461-57297483 GCAGACAAGAAAATGGAGCACGG + Intergenic
1159019505 18:63131787-63131809 CCAGACAGGACAAATGATCAGGG - Intronic
1159543268 18:69807887-69807909 CCAGAGAAAAAAAATCAATAAGG + Intronic
1159840504 18:73393630-73393652 CCAGGGAAGAAAAATGAAATAGG + Intergenic
1160234040 18:77071512-77071534 CCAGAACAGAAAGATGAGGAAGG + Intronic
1161003267 19:1921815-1921837 CCAGAAAAAAAAAAAGAGGAAGG + Intronic
1161383405 19:3978340-3978362 CCAGACAAGGACAAGGAGCAGGG + Intronic
1161401862 19:4069411-4069433 CCAGAGATGGACAAGGAGCAAGG + Intergenic
1161500349 19:4611256-4611278 CCAGAGAGGAAAATTGGGGAGGG - Intergenic
1162638190 19:11986835-11986857 CCAGTGAAGGGAAATAAGCAGGG + Intergenic
1163078080 19:14914032-14914054 CCACACAAGAAAAGTGAGAAGGG + Intergenic
1164480156 19:28605355-28605377 CCAGAGAAGAACCATGAACCTGG - Intergenic
1164779674 19:30882338-30882360 CCAGAGAAGAAAACTGTTCTTGG + Intergenic
1164866865 19:31611650-31611672 CGAGAGAAGAAAAGAGAGAAAGG + Intergenic
1165636927 19:37348084-37348106 ACGGAGAAGACAAATGAGGAAGG - Intronic
1165738814 19:38193768-38193790 CCCGAGAAGAAATGTGAGCCTGG + Exonic
1166903434 19:46085456-46085478 ACAGAGAACAAAAAAGAGCAGGG - Intergenic
1167280903 19:48567974-48567996 CCAAAAAATAAAAATAAGCAGGG + Intronic
1167429924 19:49448295-49448317 CCAGAGAAGAGCTGTGAGCAGGG - Intronic
1167607380 19:50488632-50488654 CCAGAGAAGAGGAAAGAGAAAGG + Exonic
1168272196 19:55256078-55256100 CAAAAGAAAAAAAATGGGCAGGG + Intronic
1168450618 19:56463469-56463491 CCACATATGAAAACTGAGCACGG + Intronic
925038020 2:706683-706705 CCAGAGAAGAAAGTTCAGAAGGG - Intergenic
925132012 2:1500809-1500831 ACAAAGAAGAAAAATTAGCCGGG + Intronic
925326586 2:3026758-3026780 CAAGAGAAGAAAGATGACCAGGG + Intergenic
925500927 2:4503830-4503852 CCAGTGAAGAAGCATGAGCTTGG + Intergenic
926783199 2:16494579-16494601 GCTGAGAAGACAAATGAGTAAGG - Intergenic
926788652 2:16546907-16546929 CCAGAAAAGGAAAGTTAGCATGG + Intergenic
927357335 2:22188071-22188093 CCAGAGAAGAAAAAGGCTCCTGG - Intergenic
927443132 2:23133862-23133884 CCACATAAGATAAATGGGCAGGG + Intergenic
928940741 2:36724900-36724922 ACATAGAAAGAAAATGAGCAAGG - Intronic
929501954 2:42497849-42497871 CCAGGAATGAGAAATGAGCATGG - Intronic
929503302 2:42508490-42508512 CAAGATAAAAAAAATTAGCAGGG - Intronic
929517659 2:42618904-42618926 ACAGAAAAGAAAAATGGGCCAGG - Intronic
929594725 2:43168983-43169005 AGAGAAAAAAAAAATGAGCAGGG - Intergenic
929832343 2:45357204-45357226 ACAATGAAGAAAAATGAACAAGG - Intergenic
929859592 2:45665569-45665591 GCAAAGAAGACAAAGGAGCATGG - Intronic
930042588 2:47139452-47139474 CCAGATTAGAAAAATAATCATGG + Intronic
930341213 2:50117354-50117376 CCAGAGATGAATAAGGAGAATGG + Intronic
930678603 2:54231482-54231504 CCTGAGATGAAGAATGAGCACGG + Intronic
931419948 2:62117806-62117828 CCACTAAAGAAAAATCAGCATGG - Intronic
931468466 2:62513610-62513632 CCAGAAAAAAAAAATGAGGGTGG + Intergenic
931556057 2:63506770-63506792 CCACAGAAGAAAATTGAAAATGG + Intronic
931577115 2:63729924-63729946 ACCAAGTAGAAAAATGAGCATGG - Intronic
931870964 2:66459236-66459258 GCAGAGGAGAAGGATGAGCATGG + Intronic
931978721 2:67671152-67671174 CCAGGGAAGAAAATTAACCAAGG + Intergenic
933126001 2:78606907-78606929 TTAGAGAAAAAAAATGAGGAAGG + Intergenic
933152295 2:78930284-78930306 CCAGAGAGGTTAAATAAGCATGG - Intergenic
933159459 2:79008132-79008154 ACAGTGAAAAAAAATGATCAGGG + Intergenic
933246281 2:79978370-79978392 CCAGAGATGACAGATGAACAAGG - Intronic
933794927 2:85911929-85911951 CTACAGAAAAAAAAAGAGCATGG - Intergenic
934072309 2:88395822-88395844 CCAGAGAGCAGAAATGGGCAGGG + Intergenic
934786696 2:97014636-97014658 CCAGAGAAGGAATAAAAGCAGGG + Intronic
935209041 2:100922711-100922733 CAAGAGAAAGAAAATGAGCCTGG - Intronic
935621267 2:105131936-105131958 CCAGAGAATAAAATTAACCAAGG + Intergenic
935917699 2:107973879-107973901 GCAGATAAGAGAAATGAGGAAGG + Intergenic
936027070 2:109040397-109040419 CAAAAAAAGAAAAATGAACAAGG - Intergenic
936548565 2:113414292-113414314 ATAGGGAAGAAAAATGAGGAAGG - Intergenic
937806152 2:126147979-126148001 ACAGAGAAGATAACTGAGCAGGG - Intergenic
938747659 2:134295213-134295235 CCAGAAAAGAACAATGAGAATGG + Intronic
939159798 2:138574445-138574467 GCAAAGATGAAAAATGAGAATGG + Intergenic
939268154 2:139902745-139902767 CTAGAGAATAAAAATGTGAATGG + Intergenic
939858238 2:147386855-147386877 GCAGACAAGAACACTGAGCAAGG + Intergenic
940038995 2:149339755-149339777 CCAGAGAATAAGGATGAGCAGGG - Intronic
941132790 2:161674653-161674675 CAAGAGAAGAAATATATGCATGG + Intronic
941202587 2:162530809-162530831 TCAAAGAAAAAAAATCAGCAGGG + Intronic
941955327 2:171198182-171198204 ACAGAGAAAAAAAATGATAACGG + Intronic
942012429 2:171776215-171776237 CCAAAAAACAAAAATTAGCAAGG + Intergenic
943205525 2:184888483-184888505 TCAGAGAACCAAATTGAGCAAGG - Intronic
943308399 2:186296399-186296421 CCAGAGAAGAATAAGCAGCAGGG + Intergenic
943647873 2:190427247-190427269 TCAGAGAAGATAAAGGAGCAAGG - Intronic
943786345 2:191882087-191882109 CCAGACAAGAACAAGGAGCCCGG - Intergenic
943825260 2:192383125-192383147 CCAGACAAGAAAGATGTCCAGGG + Intergenic
944320493 2:198335603-198335625 ACAGAAGAGAAAACTGAGCACGG + Intronic
944468685 2:200029997-200030019 CAAGAGAAGAAAAACAAGCGAGG - Intergenic
944832686 2:203548881-203548903 CTCCAGAAGAAAAAAGAGCAGGG - Intergenic
945246863 2:207726105-207726127 CCACTGAAGAAAGAGGAGCATGG - Intronic
945271530 2:207945291-207945313 ATAGAGGAGAAAAGTGAGCACGG - Intronic
945541534 2:211093229-211093251 CCAGGGAACAAAAATTAGGAAGG + Intergenic
945605498 2:211924828-211924850 CCAAGGAAGAAAAAGGACCAAGG + Intronic
945702394 2:213188404-213188426 TCAGAGAAGCAAAGTGAGGAGGG - Intergenic
945703181 2:213197532-213197554 ACAGGGAAGCAAAATGAGGAAGG + Intergenic
946319929 2:218947017-218947039 CCAGAGAAAAAAATGGAGCAGGG + Intergenic
946766661 2:223046879-223046901 CCAGAGCTGAAAAAAGAGAAGGG - Intergenic
947161759 2:227222272-227222294 CCAGAAAAGGAAAATGTGCAAGG - Intronic
947251775 2:228114763-228114785 TAGGAGAAGAAAAATGAGAATGG - Intronic
947817583 2:233048486-233048508 CCAGACAAGAAGAAAGGGCAGGG + Intergenic
948081718 2:235211898-235211920 GCAGAGAACAACAAGGAGCAAGG - Intergenic
948444834 2:238024504-238024526 CCAGGGAAAAAAAAAGAGCTGGG - Intronic
948564490 2:238875228-238875250 CCAGAGAAAAGAAAAGAGCTGGG - Intronic
948646538 2:239408584-239408606 CCAGAAAAGATAAATGACCCTGG - Intergenic
1169816533 20:9662563-9662585 GCAGAGAAGAACAAAGTGCAGGG + Intronic
1170297810 20:14848440-14848462 TCAAAGAAAAAAAAAGAGCAAGG - Intronic
1170714549 20:18820569-18820591 CCAGAGAAGACACTTGAGAAGGG + Intronic
1171341048 20:24430084-24430106 CCAGAGAACAAGAAAGAGGATGG + Intergenic
1171348857 20:24487453-24487475 CCAGAGCAGATAACTCAGCATGG - Intronic
1172333203 20:34090907-34090929 CCAAAAAAAAAAAATTAGCAGGG - Intronic
1172574035 20:35993101-35993123 CCAGAGAAACAACATGAGCCCGG - Intronic
1173161001 20:40652709-40652731 CCAAAGAAGAAAAAGGGGCTTGG + Intergenic
1174334462 20:49849147-49849169 CCAGAGAACAAAGGCGAGCATGG + Intronic
1174930344 20:54806661-54806683 TCAGAGATGACAAATGAGCCTGG - Intergenic
1174983160 20:55420178-55420200 TTAGAGGAGAAAAATGAGCAAGG - Intergenic
1175411275 20:58771093-58771115 CAAGAGAAAGAAAATGAGAAGGG + Intergenic
1176343249 21:5717290-5717312 ACAGAGAAAAAAAATTAGCCGGG - Intergenic
1176475503 21:7149441-7149463 ACAGAGAAAAAAAATTAGCCGGG - Intergenic
1176501578 21:7607166-7607188 ACAGAGAAAAAAAATTAGCCGGG + Intergenic
1176537570 21:8115359-8115381 ACAGAGAAAAAAAATTAGCCGGG - Intergenic
1178460699 21:32799593-32799615 CAAGAGAAGAAAATTGTGAAAGG - Intronic
1178474053 21:32920770-32920792 CCAGAGGAGACAGATGTGCAGGG + Intergenic
1178644223 21:34372167-34372189 CAAGAGTATAAAGATGAGCAAGG + Intergenic
1178921507 21:36741890-36741912 ACAGGGAAGAGAAAAGAGCAAGG - Intronic
1179176569 21:39012037-39012059 TCAGACAAGAAGAACGAGCAGGG + Intergenic
1179319572 21:40277130-40277152 CCAGAGAAGAAAAATGCCCTGGG - Intronic
1180110937 21:45650175-45650197 CCAAAGAAAAAAAATTAGCCGGG + Intronic
1180374052 22:12074185-12074207 CCAGAGAAGAAAGATCTGGAGGG - Intergenic
1180464386 22:15597902-15597924 CCAGGGCAGGAAATTGAGCATGG + Intergenic
1180798512 22:18619813-18619835 CCAGAGAAGGAAACTGTCCAGGG + Intergenic
1181223205 22:21375452-21375474 CCAGAGAAGGAAACTGTCCAGGG - Intergenic
1181255533 22:21560174-21560196 CCAGAGAAGGAAACTGTCCAGGG + Intronic
1181911732 22:26243814-26243836 CCAGAGAAGAAAAATGAGCAGGG + Intronic
1181911739 22:26243857-26243879 CAAGAGAAGAAAGATGAGCAGGG + Intronic
1181911783 22:26244185-26244207 AAAGAGTAGAAAAATGAGCAGGG + Intronic
1182973688 22:34602183-34602205 ACACAGAAGAAAAATGTTCATGG - Intergenic
949696463 3:6701546-6701568 ACAGAAAACAAAAAAGAGCAGGG + Intergenic
949767580 3:7544061-7544083 CCAGAGAAGACAAATGAGATAGG + Intronic
949835199 3:8261185-8261207 ACAGAAAAAAAAAATGAGAAGGG - Intergenic
950037611 3:9898476-9898498 TCAGAGAGGAAAAATTGGCAGGG + Intergenic
950738265 3:15028846-15028868 TCAAAGAAGACAGATGAGCAGGG - Intronic
951025208 3:17821094-17821116 GCAGAGAAGCAAAGTGAGAAAGG - Intronic
951386230 3:22045968-22045990 CCAGGGAAGAAAAATAATGAGGG + Intronic
951704951 3:25535079-25535101 CCAGTGAAGGAAAAGCAGCAAGG + Intronic
951796809 3:26548336-26548358 CCAGAATTGAAAAATGAGCAGGG + Intergenic
952071821 3:29646701-29646723 GAAGGGAAGAAAAATGAGAAGGG - Intronic
953763803 3:45717003-45717025 CCAGGGCACAAAAATGAGCAGGG - Intronic
956301042 3:67773182-67773204 ACAGAAAAAGAAAATGAGCAGGG + Intergenic
956403616 3:68905568-68905590 ACAGAGAAGATAATTTAGCAAGG + Intronic
956761967 3:72451642-72451664 CCAGAGAGGAGAAATGAGGCTGG + Intergenic
956906084 3:73766797-73766819 TCAGAGGAGAAAAAAGAGAAAGG - Intergenic
957397092 3:79655725-79655747 ACAAAGAAGAAAAGTAAGCAAGG + Intronic
958477005 3:94597305-94597327 TCAGAGGAGAGAAATGAGGAAGG - Intergenic
958721092 3:97844563-97844585 TAAGAGAAGAAAAGGGAGCAAGG - Intronic
959652011 3:108759223-108759245 GAAGAGAAGAAAAATGAGACTGG + Intergenic
959850620 3:111082489-111082511 AGAGAGAAGAAAAATGTTCAAGG + Intronic
960077976 3:113510138-113510160 CCAAATAAGAAAAATGAGACTGG + Intronic
960236557 3:115289745-115289767 ACAGAAAAGAAAAATTAGCCAGG - Intergenic
960394240 3:117116999-117117021 TCAAAGAAGACAAATGAGGATGG - Intronic
960536947 3:118825308-118825330 AAAGAACAGAAAAATGAGCATGG - Intergenic
960738462 3:120805951-120805973 CCACAGAAGAAGAATGTGAATGG + Intergenic
960887100 3:122406989-122407011 CCAAAAAAAAAAAATGGGCAAGG - Intronic
961269370 3:125677606-125677628 CCACAGAAGAAAGATGAGGTTGG + Intergenic
961619744 3:128214416-128214438 CCAGAAATGAAAAGTCAGCAAGG - Intronic
961741656 3:129036768-129036790 CCAGAGAAGAGAAGGGAGAATGG + Intronic
962036025 3:131652751-131652773 TCAGAGAAGAGAACTCAGCAGGG - Intronic
962055440 3:131866419-131866441 CCAGAGAGGAGGAATGAGAAAGG + Intronic
963074317 3:141332313-141332335 CAAGAGGAGAAATGTGAGCAAGG - Intronic
963326178 3:143865875-143865897 ACAGGGAAGAAAGATGAGAATGG - Intergenic
964018643 3:151979264-151979286 TTAGAGAAGAAAAATGAAAAAGG - Intergenic
965340631 3:167486573-167486595 ACAGAAAACAAAAAAGAGCAGGG + Intronic
966027594 3:175304149-175304171 CCAGACAAGAGAAAAGAGAAAGG + Intronic
967702777 3:192613026-192613048 CCCACCAAGAAAAATGAGCAGGG - Intronic
968197555 3:196721247-196721269 ACAGAGAGGAAAAAAGACCAGGG - Intronic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
968870695 4:3240592-3240614 CCTGAGAAGAAAAGAGAGAAGGG - Exonic
969314922 4:6376194-6376216 CCAGAGAAAAAGAATCAGTAGGG - Intronic
970254370 4:14152131-14152153 CCAGGTAAGAAAACTGAGCTTGG + Intergenic
970308241 4:14754929-14754951 CCAGGGAAGAAAAATGGGCAAGG - Intergenic
970310724 4:14779586-14779608 CCAGAGGAGAGTAATGGGCATGG - Intergenic
970668659 4:18368695-18368717 ACAGAAAAGAATAAAGAGCAGGG + Intergenic
970698350 4:18704942-18704964 CTACAAAAGAAAAATGAGCTAGG - Intergenic
970750930 4:19359977-19359999 CCAGACAAGAAGAGTGAGGAAGG + Intergenic
970772434 4:19630120-19630142 CCACAGAAGCAAAATGCACAGGG - Intergenic
970788935 4:19833550-19833572 ACAGAGAAGAAACGTGAGAATGG - Intergenic
971249222 4:24958734-24958756 ACAGAGAAGAAAAAAAAGCCAGG + Intronic
971682702 4:29721825-29721847 AAAGACAAGAAAAAAGAGCAAGG + Intergenic
971778526 4:30999593-30999615 GGAGTGCAGAAAAATGAGCAAGG + Intronic
971977090 4:33704375-33704397 GCAGAAAGGAGAAATGAGCAGGG + Intergenic
972897476 4:43641317-43641339 GAAGAGAAGAAAAAAGAGGAGGG - Intergenic
973713224 4:53649967-53649989 ACAGAGAAGAAAAAGGAGCAGGG + Intronic
973713550 4:53652625-53652647 CCAGAGAAGGGAAATCAACAAGG + Intronic
973802320 4:54491660-54491682 CTTGAGAAGAAAAATGAGTGGGG + Intergenic
975018884 4:69462555-69462577 CCAGAGAAAAAAGTTGAGCTAGG - Intergenic
976702463 4:87985950-87985972 CAAGAGCACAAAAATGAGCCTGG + Intergenic
976871266 4:89796533-89796555 CCAGAGAAGTAAAATAGGAAGGG - Intronic
978174598 4:105714440-105714462 CTAGAAAAGAAAAAAGAGGAAGG + Intronic
978467158 4:109020474-109020496 ACAGAGAGCAAGAATGAGCATGG + Intronic
978683752 4:111414928-111414950 CCAGTGAAGAGAAATGGGAATGG + Intergenic
979113073 4:116783212-116783234 GCAGAGAAGAACAATGAGGCAGG + Intergenic
979572771 4:122249620-122249642 CCAGCCAAGAAAAATGGGGATGG + Exonic
979900001 4:126203615-126203637 CCAGAGAATAAAAATGGTCGAGG + Intergenic
979907933 4:126320527-126320549 GGAGAGAAGAAAAATGTGAAGGG + Intergenic
980416399 4:132494775-132494797 ACAGACAAGAAAAATTAGAAGGG + Intergenic
980449768 4:132955886-132955908 CCAGGGAAGAAAAAAGAGATGGG + Intergenic
981036571 4:140175897-140175919 CCAGAGAATGAGAATGAGAATGG - Intergenic
982046689 4:151454570-151454592 CCAATGAAGAAAACAGAGCAAGG + Intronic
982274861 4:153628319-153628341 AAAGAGAAGAAAAATGAGGGAGG - Intronic
983583513 4:169332657-169332679 TCAGAAAAGAATAAAGAGCATGG - Intergenic
984407800 4:179355783-179355805 CAAGAGAAGAAAAATGAAGTAGG - Intergenic
984439590 4:179749804-179749826 TCAGAGAGGAAAATTCAGCATGG + Intergenic
985186040 4:187317019-187317041 CCAGATAAGAAAGATGAACATGG + Intergenic
985385706 4:189445794-189445816 CCAGATAAGAGGAATGAGCTGGG - Intergenic
985558635 5:570363-570385 CCAGACCAGGAAAATGGGCAAGG - Intergenic
985793883 5:1948001-1948023 CCAAAAAAAAAAAATTAGCAGGG - Intergenic
986211436 5:5676821-5676843 GCAAAGCAGGAAAATGAGCAAGG + Intergenic
986308137 5:6530891-6530913 CCAGAAGAGAAAAATGAGCTGGG + Intergenic
986616616 5:9623907-9623929 CCAGAGAAGAGAAGAGTGCATGG - Intergenic
986950047 5:13071992-13072014 CCAGAGCAGGAAAAAGAGAAGGG + Intergenic
987042771 5:14078312-14078334 AAAGAGAAGAAAAAAGAGCAAGG - Intergenic
987056259 5:14195857-14195879 ACAGACAAAAAAAATAAGCAAGG - Intronic
987070802 5:14335323-14335345 TCAGAGATGTAAGATGAGCAGGG - Intronic
987319972 5:16759395-16759417 CCCGAGAACAAAAATGAAAAAGG - Intronic
989262359 5:39432509-39432531 CCAGAGAAGGACAAGGAGCCTGG - Intronic
989269359 5:39513888-39513910 CCAGTGAAGAAGAATGAAGATGG - Intergenic
989326434 5:40201374-40201396 CCAGAGCAGAGAAACGAGCTGGG + Intergenic
989746592 5:44837037-44837059 CTAGGGAAGAAAAATGCCCAAGG + Intergenic
989814572 5:45720813-45720835 CCAGGGATGAAAAATGACCTGGG + Intergenic
990018530 5:51097191-51097213 TCATTGAAGAAAAATGAACAAGG - Intergenic
990401114 5:55438379-55438401 CCAGAGAAGAACAATGGTCAGGG + Intronic
990985655 5:61638764-61638786 CAAGAGAAGAAGGGTGAGCAGGG + Intronic
991209289 5:64085568-64085590 ACAGAAAACAAAAAAGAGCAGGG - Intergenic
991406079 5:66302337-66302359 CCAGGGAAGAGAAGAGAGCATGG - Intergenic
991735643 5:69629564-69629586 CCAGAAAAAAAAAATTAGCCTGG - Intergenic
991812134 5:70485203-70485225 CCAGAAAAAAAAAATTAGCCTGG - Intergenic
992804969 5:80328389-80328411 ACAGGGAAGAAAAGTGAACACGG - Intergenic
992832688 5:80610322-80610344 CCAGGGAAGACAAAAGATCAAGG + Intergenic
993756382 5:91735348-91735370 ACCAAGAAGAAAAATGTGCATGG + Intergenic
993814955 5:92531812-92531834 CCAGAAAAAAAAAATGAGAGTGG - Intergenic
994521430 5:100841954-100841976 CCAAAGAAGAAAACAAAGCAGGG - Intronic
994653749 5:102562849-102562871 TCAGAGAAAAAAAAAGAGAATGG + Intergenic
995369269 5:111400619-111400641 CCAGAAAAGCAGAAGGAGCAAGG - Intronic
995701029 5:114935648-114935670 TCACATAGGAAAAATGAGCAAGG - Intergenic
995947423 5:117665455-117665477 CCTGAGAAGCAAAACAAGCATGG - Intergenic
996731127 5:126718469-126718491 CCAGACAAGGACAATTAGCAAGG - Intergenic
996942029 5:129019595-129019617 CCAGAAAAGAAAAAGGATCAAGG + Intronic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997112905 5:131094873-131094895 ACAAAGAAAAAAAATAAGCAGGG + Intergenic
997281538 5:132651084-132651106 CAAAAACAGAAAAATGAGCATGG - Intergenic
997423738 5:133788671-133788693 TCACACAAGAACAATGAGCATGG - Intergenic
998182106 5:139953045-139953067 AGAGAGAAGAAGAAAGAGCAAGG + Intronic
998205073 5:140152217-140152239 GCAGAGGGGACAAATGAGCAAGG + Intergenic
998790994 5:145766232-145766254 GCAGAGAAGAATAATGATAAGGG + Intronic
998946238 5:147342378-147342400 CCAGAAATGAAAAATCAGGAAGG + Intronic
999551762 5:152695265-152695287 GCTGAGAAGAAAAATGAGGCTGG - Intergenic
999591315 5:153150050-153150072 ACAGAAAATAAAAAAGAGCAGGG + Intergenic
999763245 5:154719036-154719058 TCAGAGAAGAAAACTGAGGCTGG + Intronic
1000101780 5:158023612-158023634 GCTGAGATGAAGAATGAGCAGGG + Intergenic
1000146387 5:158457322-158457344 CTATAGAAAAAAAATAAGCAGGG + Intergenic
1000371267 5:160539038-160539060 CCAGAGAAGAAAAATAAAATAGG - Intergenic
1000441235 5:161265879-161265901 CAAAAAAAGAAAAATTAGCAGGG - Intergenic
1001108520 5:168875976-168875998 CCAGAGATGATAAATCTGCATGG + Intronic
1002698992 5:181109466-181109488 ACACAGAAAAAAAATTAGCATGG - Intergenic
1003145740 6:3508847-3508869 AAACAGAAGAAAAATGAGGAGGG - Intergenic
1003650967 6:7959800-7959822 CAATATAAGAAAAATGAGCTGGG + Intronic
1004060003 6:12185334-12185356 CCAGAGAGGAAAAAGCTGCACGG + Intergenic
1004757059 6:18621804-18621826 CCAAAGAAGTAAAATGAGGATGG - Intergenic
1005288609 6:24356740-24356762 TCAGGGAACAAAGATGAGCAAGG - Intronic
1005328573 6:24726046-24726068 CGAGAGAAAAAAAAGGAACAGGG - Intergenic
1006376380 6:33673803-33673825 GCAGACTAGAAAAAGGAGCAGGG - Intronic
1006429765 6:33988441-33988463 GGAGAGGAAAAAAATGAGCATGG - Intergenic
1007253724 6:40513962-40513984 CCAGAGAGGACAAGGGAGCAGGG + Intronic
1007647453 6:43393970-43393992 CAGAAGAAGAAAAATGAGTAAGG + Intergenic
1008419051 6:51275106-51275128 TCAGAGAAGAAAAACTAGGAAGG - Intergenic
1008762024 6:54862721-54862743 CAAGAAAAGAAAAATTAGCCGGG + Intronic
1010179794 6:73073035-73073057 TCAGAGAAGAGAAAAGTGCAGGG - Intronic
1010857816 6:80863861-80863883 ATAGAGAAGAAAAATGAGATAGG + Intergenic
1011869439 6:91874080-91874102 CCAGAGAAGAAAAATGAGGCTGG + Intergenic
1012225663 6:96700525-96700547 CCATGTAAGAAAAATGAGAAAGG - Intergenic
1012496202 6:99836189-99836211 CCAAAAAAAAAAAATGAGCCGGG - Intergenic
1013088216 6:106874949-106874971 CCAGAGAAGAAGTAAGGGCAGGG + Intergenic
1013266864 6:108508423-108508445 CCAGGGAAGGAAAATGGGAAGGG + Intronic
1013534850 6:111054579-111054601 CCAGGCAGGAAAAATGAGAAAGG - Intergenic
1013673652 6:112433248-112433270 AGAGAGAAGAAGCATGAGCAAGG + Intergenic
1013797104 6:113900282-113900304 CAAAAGATTAAAAATGAGCAGGG - Intergenic
1014250421 6:119110193-119110215 GCAGAGTAGAAAAAGGAGCCTGG - Intronic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1014819455 6:125971173-125971195 CAAGAGAAGAAAGATGATAAAGG + Intronic
1015405508 6:132833054-132833076 GCAGAGAAGAACTAAGAGCAAGG - Intergenic
1015554128 6:134443449-134443471 ACAGAGAAGAAAACTGAGACTGG - Intergenic
1016343576 6:143087069-143087091 CCAGTTAAAAACAATGAGCATGG - Intronic
1016827414 6:148401091-148401113 CCAGAAAACAAAAACGAGCTGGG + Intronic
1016896727 6:149060879-149060901 CCAGCGAAAAAAAATAAGCATGG - Intronic
1017077475 6:150632278-150632300 CCAGAGAATAAAGAAAAGCAAGG - Intronic
1017286426 6:152681758-152681780 AAAGACAATAAAAATGAGCAGGG + Intergenic
1017596360 6:156032913-156032935 CGAGAGAAGAAAAACAAACAAGG + Intergenic
1018280010 6:162175300-162175322 ACAGAAAAGAAAAGTGAGCCAGG + Intronic
1019233810 6:170591588-170591610 CTACAGAAGAAAAAAGAGCACGG + Intergenic
1019332064 7:465117-465139 GCATAGAAGAAACATGACCAGGG + Intergenic
1019971719 7:4546848-4546870 GCATAAAAGAAAAATGAGAAAGG - Intergenic
1020100855 7:5393681-5393703 CCAGAGAAGACAGAGGAGCTTGG + Intronic
1020340324 7:7103091-7103113 ACACAAAAGAAAAATTAGCAGGG - Intergenic
1020539679 7:9444686-9444708 CCAGAGAGGAAAAATTAATATGG + Intergenic
1020543424 7:9491868-9491890 ACAAAAAAGAAAAATGAGCAGGG - Intergenic
1021280732 7:18714653-18714675 CAAGAGATGAAGAATGAGAAGGG - Intronic
1021768408 7:23972116-23972138 TCAGAGAAAAAGAATGAACAGGG - Intergenic
1021806465 7:24361825-24361847 CCACAGAGGGAAAAGGAGCAGGG - Intergenic
1022123460 7:27333082-27333104 CCAGAGAAGAAAAAACTACACGG - Intergenic
1022271432 7:28811533-28811555 CTAGAGAAAAAAAATTAGCCAGG - Intronic
1022280009 7:28898722-28898744 CTAGAAAAGAAACATGATCAAGG + Intergenic
1023732951 7:43209574-43209596 ACAGAGGAAAAAAATGGGCAAGG - Intronic
1024207793 7:47178647-47178669 ACAGAGAAGAAACATGAGAAAGG + Intergenic
1024708914 7:51993685-51993707 ACAGAAAACAAAAAAGAGCAGGG - Intergenic
1025289447 7:57701602-57701624 CCAGAGAAGAGAAATCAAAATGG + Intergenic
1026107549 7:67433129-67433151 ACAGAGCAGAAACAGGAGCAGGG + Intergenic
1026309309 7:69170068-69170090 ACAATGAGGAAAAATGAGCATGG + Intergenic
1026511077 7:71027762-71027784 CTAGAGGAGAAAACTGAGCTGGG + Intergenic
1026838348 7:73653124-73653146 ACAGAAAAGAAAAAAGAGAAAGG - Intergenic
1026996092 7:74617622-74617644 CGAGAGAGGAAATAGGAGCAGGG - Intergenic
1027050112 7:75016505-75016527 CCAGAGAAGCCCAATGTGCAGGG + Intronic
1027655387 7:80924061-80924083 GCAGTGAAGAAAATTGATCAAGG - Intergenic
1027679471 7:81202138-81202160 ACAGAGAAGGAAAATGAGACAGG + Intergenic
1027909439 7:84230250-84230272 ACTGAAAAGAAAAAAGAGCAGGG - Intronic
1028097945 7:86786012-86786034 GCAGAGTAGAGAAATGAGAAGGG - Intronic
1028628212 7:92901856-92901878 CCAGAGAAGCAGAACCAGCAGGG + Intergenic
1028829361 7:95310607-95310629 CCAGATAAGAAAGAAGAGGAAGG + Intronic
1028888007 7:95956136-95956158 CCAGAGAAGAAACTGGAACATGG - Intronic
1028896146 7:96044280-96044302 TCAGAGAAGAAACATCAGGACGG + Intronic
1029382923 7:100225163-100225185 CCAGAGAAGCCCAATGTGCAGGG - Intronic
1030539643 7:110814188-110814210 CCAGAGAGGAAAACTGGGGATGG - Intronic
1030875951 7:114813484-114813506 CAAGAGAAGGCAAAGGAGCAAGG + Intergenic
1030953479 7:115821503-115821525 CAAGAAAAGAAACATGAGCAAGG + Intergenic
1031185963 7:118480769-118480791 CCAGAGAAGAAAAAGGACATTGG - Intergenic
1031750245 7:125562824-125562846 CTAGAGAAGAGAAATGAGAGAGG + Intergenic
1032253153 7:130275266-130275288 CCAGAAAGGCAAAATAAGCAAGG - Intronic
1032400109 7:131618853-131618875 CCAGAGAAGAGAACCGAGCTGGG + Intergenic
1032457258 7:132082790-132082812 ACAAAGAAGAAAAAGGAGGAAGG + Intergenic
1033281710 7:140010541-140010563 CCAGAAAAGAAGAACAAGCAGGG + Intronic
1033410694 7:141114950-141114972 CCAGAGAAAGAAAAAGAGAAGGG + Intronic
1033521230 7:142162479-142162501 TGAGAGAAGAAAAAGCAGCAAGG + Intronic
1033978563 7:147133565-147133587 AGACAGAAGAAAAAGGAGCATGG - Intronic
1034777355 7:153841014-153841036 CCTGTGAAGAAAAACCAGCAAGG + Intergenic
1035132864 7:156672023-156672045 CCACAGAAGAAAACCTAGCATGG - Intronic
1036096430 8:5729396-5729418 ACATGGCAGAAAAATGAGCAGGG + Intergenic
1036386877 8:8289672-8289694 GCAGAGAAGAAAAAAATGCAGGG - Intergenic
1036592906 8:10185126-10185148 CCAGAGATGAGAGATCAGCAGGG - Intronic
1036675953 8:10833441-10833463 CCAGAGGAGAAAAAGGAGGGAGG + Intronic
1036926557 8:12912326-12912348 CCAGAGGAGAAAAAGAAGGAAGG + Intergenic
1037594726 8:20345515-20345537 CCATAGATGAAAAATGAACTGGG + Intergenic
1037594776 8:20345826-20345848 AAAGAAAAGAAAAATGAGCTGGG + Intergenic
1037599536 8:20382267-20382289 CCAGAACATAAAAATGAGCCTGG - Intergenic
1037697059 8:21232871-21232893 CCAAAGAAGAAGAAGGAGCAAGG + Intergenic
1037755981 8:21710309-21710331 GCAGAGAAGGAAGATGAGGATGG - Intronic
1038229966 8:25690766-25690788 GAAGAGAAGAAAAAGGAGCTGGG - Intergenic
1038341622 8:26691130-26691152 CAAGAGGAGAAAACTGGGCAGGG + Intergenic
1039020939 8:33205694-33205716 AGAGAGAAGAAAATTTAGCAAGG - Intergenic
1039327092 8:36497450-36497472 TCAGAGAAGAAAAATGAGAAAGG + Intergenic
1039776896 8:40746047-40746069 GGAGAGAAGAAAAGTGAGCCGGG - Intronic
1040724578 8:50367806-50367828 CCAGAGAAGCAAAACCAGTAGGG - Intronic
1041234936 8:55791112-55791134 GCTGTGAAGAAAACTGAGCAAGG - Intronic
1041255141 8:55973520-55973542 TCAGAGAAGAAAAATGAACTTGG + Intronic
1041372310 8:57174744-57174766 ACAGAAAACAAAAAAGAGCAGGG + Intergenic
1041545265 8:59035137-59035159 CCAGAGTAGGCTAATGAGCATGG - Intronic
1041622978 8:59994930-59994952 ACAGAGAAGGAAAATAAGGAGGG - Intergenic
1042199233 8:66264345-66264367 GCAGAAAAGAGAAATGAGAAAGG + Intergenic
1043414980 8:80038476-80038498 CCTGTGAAGAACAAGGAGCAGGG - Intronic
1043528079 8:81118300-81118322 CCAGAGAAGAAGATTCAGGATGG - Intergenic
1043730192 8:83668365-83668387 TCAGGGCAGAAAAATGAGAAAGG - Intergenic
1044297933 8:90549840-90549862 AGAGAGGAGAAAAATGAGAAAGG + Intergenic
1044464461 8:92487442-92487464 TCAAAGATGAAAAATGAGGAGGG + Intergenic
1044538497 8:93384246-93384268 ACACAGAAAAAAAATCAGCAGGG - Intergenic
1044580594 8:93822161-93822183 ACACAATAGAAAAATGAGCAAGG + Intergenic
1045131091 8:99153815-99153837 AGAGAGAAGAAAAATGATAAAGG - Intronic
1045456636 8:102386435-102386457 GAAAAAAAGAAAAATGAGCACGG + Intronic
1045494685 8:102698553-102698575 CCAAAGAAGAAAGAGGAGAAAGG + Intergenic
1045661891 8:104446651-104446673 GCAGAGAGGAATAATGAGAAGGG - Intronic
1045812378 8:106237935-106237957 TAAGAGAAGAAAAAGGAGTAGGG + Intergenic
1046376785 8:113393604-113393626 CTGGAGAAGGAAAATGAGAAAGG + Intronic
1046698723 8:117375490-117375512 TCAAAGAAGAAACTTGAGCAGGG + Intergenic
1046927972 8:119813599-119813621 CCAGAGAAGGACAAAGAGGATGG + Intronic
1047213429 8:122858135-122858157 CCAGACCAGAAATAAGAGCAAGG - Intronic
1047218768 8:122901540-122901562 CCAGAGAACAAAGATCACCAGGG - Intronic
1047707343 8:127512873-127512895 TGATAGAAGAAAAATGAGCCAGG + Intergenic
1048212815 8:132469684-132469706 CCAAAGAGAAAAAAGGAGCAGGG + Intronic
1048412430 8:134189228-134189250 AGAGAGAAAAAAAATGAGAAAGG - Intergenic
1048628022 8:136208012-136208034 CAAGGTAAGAAAGATGAGCAGGG - Intergenic
1049793399 8:144483897-144483919 TCAGAGCAGAGAGATGAGCAGGG - Intronic
1049904431 9:202880-202902 ATAGGGAAGAAAAATGAGGAAGG + Intergenic
1049968955 9:804478-804500 CCGGAGAAGAAAATTGAACAAGG - Intergenic
1050365656 9:4871257-4871279 CCTGAGAAGAAGAGTGAGAAAGG + Intronic
1050412618 9:5382487-5382509 CCTGGAAAGAAGAATGAGCATGG + Intronic
1050867309 9:10518945-10518967 CCAGAAAAAGAAAATTAGCATGG - Intronic
1050894354 9:10868238-10868260 CCAGAGAAGAAGTATAAACAAGG + Intergenic
1051129346 9:13841991-13842013 ACAGAGAAGTAAAAATAGCAAGG + Intergenic
1051385816 9:16507418-16507440 CCAAAGGAAAAAAATGAGCTAGG - Intronic
1051406472 9:16743057-16743079 CAAGAGAAAAGAAATGAGCATGG - Intronic
1051550362 9:18321400-18321422 CTAGAGAAAATAAATCAGCAAGG + Intergenic
1053727003 9:41014454-41014476 ATAGGGAAGAAAAATGAGGAAGG + Intergenic
1055127921 9:72740488-72740510 CCAGAGAATGAAAATGAAAAAGG - Intronic
1055577261 9:77672307-77672329 CCAGAGAAAATAAATGAACAAGG + Intergenic
1056407321 9:86287032-86287054 CAAGAGAACAAAAATCAGCCTGG + Intergenic
1056440755 9:86618752-86618774 TCAGAAAAGAAAAATAAGGAAGG - Intergenic
1057008975 9:91584831-91584853 CCAGTGAAAACAAATGAGCGGGG + Intronic
1057184759 9:93050921-93050943 ATAGAGAAGAAAAAAGCGCAGGG + Intergenic
1057410078 9:94810220-94810242 CCAGAGAAGAAAATTAGGCCAGG - Intronic
1057411744 9:94822533-94822555 CCAGAAAAGAAAAATCTGGAAGG - Intronic
1057997678 9:99834241-99834263 ACAGAGAAGAACCATGAGAAAGG + Intronic
1058350953 9:104023235-104023257 ACAGAAAAAAAAAATTAGCAGGG + Intergenic
1058682632 9:107453488-107453510 TCAGAGAAGATAAGTGACCAGGG + Intergenic
1059108723 9:111534579-111534601 TCAGTGAAGGAAAATGAGGAAGG + Intronic
1059316760 9:113432187-113432209 CAAGAAAAGAAAAATGAAAAAGG - Intergenic
1059494163 9:114695886-114695908 CCAGATTAGAAAAATAATCATGG + Intergenic
1059993812 9:119890460-119890482 CTGGAGAATAAAAATGACCAAGG + Intergenic
1060414628 9:123421641-123421663 CCAGAGATGATAAATGAGCCTGG - Intronic
1061357900 9:130120219-130120241 CCAGTGAAGAAACATCACCACGG - Intronic
1062676205 9:137745983-137746005 ATCCAGAAGAAAAATGAGCAGGG - Intronic
1203458843 Un_GL000220v1:14797-14819 ACAGAGAAAAAAAATTAGCCGGG - Intergenic
1185613730 X:1407793-1407815 ACAGAGAAGATAAAGGAGGAAGG + Intronic
1185668080 X:1784027-1784049 CAAAAGAAGAAAAGTGAGGAAGG + Intergenic
1185989764 X:4880557-4880579 TCTGAAAAGAAAAATGAGCATGG + Intergenic
1186039915 X:5464380-5464402 ACAGAGAAAAAATATGAGAAAGG + Intergenic
1186092189 X:6061923-6061945 ACAGAGAAGAGAAAGGACCAAGG - Intronic
1186204284 X:7185071-7185093 CCAGAGAACAAGAATGATCAGGG + Intergenic
1186306415 X:8264562-8264584 CCAGAGAAACAGAATGAACAGGG - Intergenic
1186424078 X:9449625-9449647 GCAGGGAAGAAAGAAGAGCAGGG + Intergenic
1186748292 X:12593516-12593538 ACAGAGAACAATAATGAGAAAGG - Intronic
1186748935 X:12601698-12601720 ACAGAGAAGAAATTTGAGCAGGG + Intronic
1186846229 X:13533710-13533732 CCAGAGAGAAAAAATAATCATGG + Intergenic
1187361453 X:18631738-18631760 TCAGAGAGGAAAAACGAGGATGG - Intronic
1187640300 X:21280574-21280596 CCAGAGAAAAAAATTGAAAATGG - Intergenic
1187741070 X:22355922-22355944 CCAGATAAGAATAACCAGCATGG - Intergenic
1187830094 X:23372348-23372370 CCAGAGAAGAGAGGTCAGCAAGG + Intronic
1188197675 X:27258279-27258301 ACAGAAAAAAAAAATTAGCAGGG - Intergenic
1188754568 X:33946665-33946687 CCAGAGAAAACAAAAGAGAAAGG + Intergenic
1189233463 X:39470096-39470118 CCAGAAGAGAAAAATGGACAAGG - Intergenic
1189911285 X:45812843-45812865 CCAGAGCAGAAAGAAGAGGAGGG + Intergenic
1190102271 X:47530787-47530809 CCAGAGGAGGAAAATGAGAGAGG + Intergenic
1190258181 X:48780397-48780419 CCAAAGAAGATAAATGGGCTGGG + Intergenic
1190308884 X:49102512-49102534 CCAGAGAAGAAAAACGACTCAGG - Intergenic
1190441492 X:50479392-50479414 CCAGAAAAGAAAAATTACAAGGG - Intergenic
1190568428 X:51755625-51755647 AAAGAGAAGAAAAAGGAACAAGG - Intergenic
1190930832 X:54948613-54948635 CCAGAGATGAGAAGAGAGCATGG - Intronic
1190995946 X:55609338-55609360 CCAAGGAAGAAAAATATGCAAGG - Intergenic
1191889457 X:65925619-65925641 CCAGTGAAGAGAAATGAACCAGG + Intergenic
1191920758 X:66254778-66254800 GCAGAGAAAAAAAAGTAGCAAGG + Intronic
1192339051 X:70247178-70247200 CTACAGAAGAAAAATTAGCAAGG + Intergenic
1192715520 X:73637538-73637560 AAAATGAAGAAAAATGAGCAGGG - Intronic
1193044295 X:77034945-77034967 CAAAAAAAGAAAAATGGGCATGG + Intergenic
1193296184 X:79833498-79833520 ACAGAAACGAAAAATGAGCAGGG + Intergenic
1193370530 X:80691857-80691879 CCAGAGACGAAGAATGTGAACGG - Exonic
1193582197 X:83279635-83279657 CAAGTGAAGGAAAATGAGAAAGG + Intergenic
1193685040 X:84567680-84567702 CCAGAGAACAAAAATGGCAACGG + Intergenic
1193947848 X:87761171-87761193 ACAGAAAACAAAAAAGAGCAGGG - Intergenic
1194189179 X:90813553-90813575 CTGGAGAATAAAAATCAGCATGG + Intergenic
1194868490 X:99098539-99098561 ACAGAAAAGAAAAGTGAGAATGG + Intergenic
1194947578 X:100087664-100087686 CCAGAGAAGAAAACAGAACATGG + Intergenic
1195315839 X:103676919-103676941 GCAGAGAAGTAAAATGAGAGGGG - Exonic
1195681037 X:107546840-107546862 CCAGAGCAGGGAAATCAGCAGGG + Intronic
1195739676 X:108050904-108050926 CCAGGGAAAAACAAAGAGCAAGG + Intronic
1195995361 X:110726139-110726161 CAAGAGAAGATAACTGAGCCTGG + Intronic
1197273058 X:124447160-124447182 AGAGAGAAGAAAGCTGAGCAGGG - Intronic
1198237303 X:134747345-134747367 GAAGAGAAGATAAATGAGGAGGG + Intronic
1198739435 X:139825188-139825210 GGAGAGAAAAAAAATGAGGAAGG + Intronic
1199310503 X:146315019-146315041 GCAGAAACGAAAAATGATCAAGG + Intergenic
1199887092 X:152031011-152031033 CCAGAGAAGTTAAATAATCATGG + Intergenic
1200342693 X:155415663-155415685 CAAGAGTAGAAAAATTATCATGG + Intergenic
1200535759 Y:4395446-4395468 CTGGAGAATAAAAATCAGCATGG + Intergenic
1200690298 Y:6302178-6302200 CCTGAGGAGAAAAGTGAGCAAGG + Intergenic
1200826494 Y:7650211-7650233 CCTGAGGAGAAAAATGAGCAAGG + Intergenic
1201044975 Y:9872538-9872560 CCTGAGGAGAAAAGTGAGCAAGG - Intergenic
1201060854 Y:10045400-10045422 CCTGAGGAGAAAAATGAGCAAGG + Intergenic
1201648201 Y:16258850-16258872 CCACAGAGCAAAAATAAGCATGG + Intergenic
1201654609 Y:16326451-16326473 CCACAGAGCAAAAATAAGCATGG - Intergenic
1202106793 Y:21379280-21379302 CCTGAGGAGAAAAATGAGCAAGG + Intergenic
1202111028 Y:21420861-21420883 CCTGAAGAGAAAAATGAGCAAGG + Intergenic
1202117437 Y:21483324-21483346 CCTGAGGAAAAAAGTGAGCAAGG - Intergenic
1202200088 Y:22337126-22337148 CCTGAGGAGAAAAATGAGCAAGG - Intronic