ID: 1181912016

View in Genome Browser
Species Human (GRCh38)
Location 22:26245690-26245712
Sequence CAATCAGCGGCCACTCTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 75}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181912016 Original CRISPR CAATCAGCGGCCACTCTCAG AGG (reversed) Intronic
901931777 1:12600605-12600627 CAAGCAGTGGCCCCTCTCACAGG - Intronic
903723646 1:25424673-25424695 CAATCAGAGGCCAGGCACAGTGG - Intronic
904134074 1:28297580-28297602 CATTCAGCGGCCAGGCGCAGTGG + Intergenic
911671499 1:100613571-100613593 CAACCTGGGGCCACTCACAGAGG + Intergenic
913080186 1:115377171-115377193 CAATTAGAAGCCACTATCAGCGG + Intergenic
915650424 1:157306609-157306631 CCAGCAGCCGCCCCTCTCAGGGG + Intergenic
924183059 1:241458573-241458595 CCATCTGGGGCCACTCTCTGTGG - Intergenic
1065799840 10:29342150-29342172 CAATGTGCTGCCACTATCAGTGG - Intergenic
1067787672 10:49262529-49262551 CAGTGAGCGGCCAAGCTCAGAGG + Intergenic
1070642667 10:78180690-78180712 CAATCAGAGGCCAGTCTCTTTGG + Intergenic
1071745931 10:88419384-88419406 CTATCAGGGGCCACTCTCCCAGG + Intronic
1072207985 10:93221399-93221421 CAAGCAGCGGCCGCTCTCCCTGG + Intergenic
1072789383 10:98306696-98306718 CAAACAGCCCCCAATCTCAGTGG + Intergenic
1075080286 10:119378894-119378916 CAATCAGAGGCCTCTCTCTCTGG - Intronic
1080664673 11:34325252-34325274 CCATCAGTGGCCACTATCAGAGG + Intronic
1094001093 12:25695200-25695222 CAATAAGCGGGCACACTGAGGGG - Intergenic
1096786446 12:54019547-54019569 CCATCAGCGGCCATCCACAGGGG - Intronic
1096808451 12:54154924-54154946 CAAGCAAAGGCCAGTCTCAGTGG + Intergenic
1104553897 12:129782455-129782477 CAATCAGCCGCCACCCCCACGGG - Intronic
1107542833 13:41409060-41409082 CAATCAGCTGCTACTCTCCAAGG + Intergenic
1115487562 14:33926744-33926766 CATTCAGTGGGCATTCTCAGGGG + Intronic
1121505316 14:94472756-94472778 CAATCAGCTGCCACTTCCACTGG - Intronic
1123476430 15:20594921-20594943 CAATCAGAGGCCTCTCTGACTGG - Intergenic
1123641581 15:22405443-22405465 CAATCAGAGGCCTCTCTGACTGG + Intergenic
1127717584 15:61664629-61664651 CATTCAGTGGTCACTCTTAGAGG - Intergenic
1130938836 15:88491257-88491279 CCAGCAGCTGCCACCCTCAGAGG - Intergenic
1140975003 16:80051246-80051268 CAATCATTGGCCATCCTCAGAGG + Intergenic
1141237266 16:82230099-82230121 CAATCAGCTGCCTCTCTTGGTGG + Intergenic
1142115758 16:88355361-88355383 GAACCAGAGGCCACTTTCAGGGG - Intergenic
1144336756 17:14278365-14278387 CAATCAGAGGCCAGGCACAGTGG - Intergenic
1147971404 17:44220399-44220421 AAACCAGCGGCCACGCTCCGGGG - Intronic
1150065711 17:62107442-62107464 TAATCAGAGGCCAGTCACAGTGG + Intergenic
1155042492 18:22076288-22076310 CCATGAGGGGCCAGTCTCAGTGG - Intergenic
1160434687 18:78838345-78838367 CCATCAGCGCCCCCTCCCAGTGG + Intergenic
1162588161 19:11574193-11574215 CAAGCAGAGGCCAGGCTCAGTGG - Intronic
1162825335 19:13247887-13247909 TAATCACAGGCCACTCCCAGGGG - Intronic
1164743580 19:30594748-30594770 CAAGCAGCGGCTTCTCGCAGGGG - Intronic
928950356 2:36808302-36808324 CACCCAGCGGCCACTCACTGAGG - Intronic
932299795 2:70658236-70658258 CAATGAGCAGCCACGCTCACCGG - Exonic
933419311 2:82026195-82026217 CAATCAGTGGCCACTTTCTCAGG + Intergenic
940976211 2:159947888-159947910 CAGTCAGCTGCCACTCTCTCTGG - Intronic
948305409 2:236943781-236943803 CAATCAGTGGCCACCCTCCAGGG + Intergenic
1170472397 20:16681338-16681360 CATTCAGAGGCCTCTCTCTGTGG - Intergenic
1171244314 20:23598282-23598304 CATTCAATTGCCACTCTCAGTGG - Intergenic
1180132325 21:45834704-45834726 AAATCAGAGGCGTCTCTCAGAGG + Intronic
1181912016 22:26245690-26245712 CAATCAGCGGCCACTCTCAGAGG - Intronic
1183768794 22:39905125-39905147 CAATTAGCGAGTACTCTCAGGGG + Intronic
950535018 3:13573596-13573618 CACTCAGAAGCCACTGTCAGAGG + Intronic
953117832 3:40010304-40010326 CCCTCAGCTGCCACTCTCAGAGG - Intronic
970443654 4:16106668-16106690 CAAAGAGCTGCCTCTCTCAGGGG - Intergenic
974107956 4:57492562-57492584 CAACCAGTGGCAACTCTCTGGGG - Intergenic
975435888 4:74350688-74350710 CAATTGGCCTCCACTCTCAGAGG - Intergenic
979247196 4:118520875-118520897 CAATCAGGGGCCAGGCGCAGTGG - Intergenic
988709188 5:33756348-33756370 CTAAAAGCAGCCACTCTCAGTGG - Intronic
995433523 5:112109431-112109453 CAATCATTGGCCATCCTCAGGGG - Intergenic
996054329 5:118966740-118966762 CAATCAGAGGCCAGGCACAGTGG + Intronic
996113697 5:119595200-119595222 TATTCAGTTGCCACTCTCAGTGG + Intronic
1001508355 5:172298152-172298174 CAATCAGATTCCCCTCTCAGTGG - Intergenic
1002776910 6:336191-336213 GAATCAGAGGCCAGACTCAGTGG - Intronic
1003358179 6:5395336-5395358 CAATCAGTGGCCAGGCACAGTGG - Intronic
1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG + Exonic
1013636217 6:112032115-112032137 CAAGCAGAGGCTACTCACAGTGG + Intergenic
1019340653 7:507389-507411 AAAGCAGGGGCCACTCCCAGCGG + Intronic
1019679948 7:2341698-2341720 CAAGCATCGGCCACGCGCAGTGG + Intronic
1022450655 7:30511306-30511328 CAATCATTGGCCAATCTCAAGGG + Intronic
1023357867 7:39385753-39385775 CTGTCAGCAGCCCCTCTCAGAGG + Intronic
1024659847 7:51482956-51482978 CCATCATCGGCCAGGCTCAGTGG - Intergenic
1025031303 7:55559381-55559403 CGGTCAGCGGCTGCTCTCAGGGG - Intronic
1035472212 7:159117687-159117709 CCCTCAGCTGCCACTCTCTGTGG - Intronic
1036926995 8:12916542-12916564 AAATCATAGGCCAATCTCAGTGG + Intergenic
1037999842 8:23382228-23382250 CAATCAGCGGCCAGGCACAGTGG + Intronic
1042041810 8:64599473-64599495 CAATCAGCGGCCGGACACAGTGG - Intronic
1043606557 8:82007836-82007858 CAATCACCTGCTACTTTCAGAGG - Intergenic
1049308695 8:141921733-141921755 GAATCAGCAGCATCTCTCAGGGG - Intergenic
1051221319 9:14851296-14851318 CAAACAGCAGCCATTCTGAGAGG - Exonic
1061154835 9:128852060-128852082 CAAACAGTGGCCACTCTCTAAGG + Intronic
1061855646 9:133440629-133440651 CATTCAGCGGTCACTTACAGGGG + Intronic
1189617775 X:42801405-42801427 CATTCAACAGCCAATCTCAGTGG + Intergenic
1200814807 Y:7520151-7520173 CAATCAGCTGACATTCTCTGGGG - Intergenic