ID: 1181913124

View in Genome Browser
Species Human (GRCh38)
Location 22:26256386-26256408
Sequence CCATAGCCAAAATGGCCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 15653
Summary {0: 1, 1: 0, 2: 22, 3: 1015, 4: 14615}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181913115_1181913124 22 Left 1181913115 22:26256341-26256363 CCAACATATGAATGAAAAGCAGG 0: 1
1: 0
2: 1
3: 27
4: 286
Right 1181913124 22:26256386-26256408 CCATAGCCAAAATGGCCAAAAGG 0: 1
1: 0
2: 22
3: 1015
4: 14615
1181913118_1181913124 -7 Left 1181913118 22:26256370-26256392 CCATTCCAGTATTTCCCCATAGC 0: 1
1: 0
2: 0
3: 25
4: 199
Right 1181913124 22:26256386-26256408 CCATAGCCAAAATGGCCAAAAGG 0: 1
1: 0
2: 22
3: 1015
4: 14615
1181913117_1181913124 -4 Left 1181913117 22:26256367-26256389 CCTCCATTCCAGTATTTCCCCAT 0: 1
1: 0
2: 1
3: 21
4: 297
Right 1181913124 22:26256386-26256408 CCATAGCCAAAATGGCCAAAAGG 0: 1
1: 0
2: 22
3: 1015
4: 14615

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181913124 Original CRISPR CCATAGCCAAAATGGCCAAA AGG Intronic
Too many off-targets to display for this crispr