ID: 1181913398

View in Genome Browser
Species Human (GRCh38)
Location 22:26258582-26258604
Sequence CTGTGTTTAAATGAGGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 327}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181913396_1181913398 -7 Left 1181913396 22:26258566-26258588 CCTACTACATTTTTTTCTGTGTT 0: 1
1: 0
2: 11
3: 113
4: 1350
Right 1181913398 22:26258582-26258604 CTGTGTTTAAATGAGGAAGTTGG 0: 1
1: 0
2: 2
3: 33
4: 327
1181913395_1181913398 18 Left 1181913395 22:26258541-26258563 CCTCTTGTGTGAATTATCTCATT 0: 1
1: 1
2: 3
3: 46
4: 373
Right 1181913398 22:26258582-26258604 CTGTGTTTAAATGAGGAAGTTGG 0: 1
1: 0
2: 2
3: 33
4: 327
1181913394_1181913398 29 Left 1181913394 22:26258530-26258552 CCATGTTGAGACCTCTTGTGTGA 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1181913398 22:26258582-26258604 CTGTGTTTAAATGAGGAAGTTGG 0: 1
1: 0
2: 2
3: 33
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181913398 Original CRISPR CTGTGTTTAAATGAGGAAGT TGG Intronic
903024396 1:20417160-20417182 CTGTTTTTGAATGAAGAAGCAGG - Intergenic
907860993 1:58352879-58352901 CTGTGTATGAACCAGGAAGTTGG + Intronic
908148555 1:61274417-61274439 CTGTGTTTAAAGGATGGGGTTGG - Intronic
908414520 1:63899954-63899976 CTGTTTTTAAAGGAGGAAAGGGG - Intronic
908774070 1:67623452-67623474 CTGTGTTCACATAAGTAAGTAGG + Intergenic
910033965 1:82767618-82767640 GTGTGTTTAAAGAAAGAAGTAGG + Intergenic
911152479 1:94608712-94608734 CTGTGTGTGAATGATGAAGCAGG + Intergenic
911366898 1:96949510-96949532 CTGTCTATGAATCAGGAAGTGGG - Intergenic
913670761 1:121095502-121095524 CTCTGTTTAACTGAGGCAGAGGG + Intronic
914019856 1:143856656-143856678 ATGTGTATGAATGAGCAAGTAGG + Intergenic
917865570 1:179191012-179191034 CTGTGGTTAGAAGGGGAAGTGGG - Intronic
918065035 1:181094862-181094884 CTGTGTTTGAATCAGGAAGGAGG - Intergenic
918264479 1:182828533-182828555 CTGTGTTTGAAGCAGGAAGAGGG + Intronic
919754615 1:201059027-201059049 CTGTGTCTGAAGGTGGAAGTGGG + Intronic
920314461 1:205067440-205067462 CAGTTTTTAAATGAGGAGTTTGG - Intronic
921306338 1:213800382-213800404 CTGTGATTTAATGTGGAAGTGGG + Intergenic
921306444 1:213801750-213801772 CTGTGTTTTAATGTGGAAGTGGG + Intergenic
922002225 1:221491092-221491114 CTGTGTTCCAATGAGGAAGCAGG + Intergenic
922138154 1:222853127-222853149 CTGTGTTTTAATAATGAAGTTGG + Intergenic
923830593 1:237551065-237551087 GTGTGTGTAAATGATGAAGGTGG - Intronic
924244951 1:242074889-242074911 CTGTGGTCAAATGAGTATGTTGG + Intergenic
924323464 1:242872222-242872244 TTGTTTTTAAATGTGGAAGGTGG - Intergenic
1064927916 10:20590454-20590476 CTTTGAGTAGATGAGGAAGTGGG - Intergenic
1065074915 10:22067732-22067754 ATGTTTTGAAATCAGGAAGTGGG + Intergenic
1065409685 10:25410994-25411016 CTTTGATTAACTGAGGAATTTGG - Intronic
1068190998 10:53652628-53652650 GTGTGTGTAAATGAGAAAGAAGG + Intergenic
1068311405 10:55281304-55281326 CTGTGGTGAAATGATGAAGGAGG - Intronic
1068341901 10:55715153-55715175 CTGTGTTGAAGTGAAGAAGTAGG + Intergenic
1069149261 10:64935122-64935144 CTTTGTTTATGTGAGGAGGTGGG + Intergenic
1070330414 10:75412642-75412664 CAGTTTTCAAATGAGGAAGGTGG - Intergenic
1070361507 10:75694533-75694555 CTGTGTGCAAATGTGAAAGTTGG - Intronic
1070902401 10:80041982-80042004 CTTTGTTTCAATGAGTAAGAGGG + Intergenic
1071820912 10:89279757-89279779 CTGTACTTAAGTAAGGAAGTGGG + Intronic
1072271038 10:93776856-93776878 CTGTGTGCAAAGGAGGAGGTTGG + Intronic
1072435794 10:95413935-95413957 TTGGGTTTAAGTGAGCAAGTGGG - Intronic
1073940856 10:108696062-108696084 CTGTGGTTAAATGATTCAGTTGG - Intergenic
1074914798 10:117945260-117945282 CAGTTTTAAAATGAGGAACTGGG + Intergenic
1075300568 10:121319842-121319864 TTGTGTTCAAATGAAGAAGTTGG - Intergenic
1075925813 10:126251350-126251372 CTTTATTTAGATGAGGAAGCAGG + Intronic
1078437892 11:11340547-11340569 CTAATTTTAAATGAGAAAGTTGG - Intronic
1079105844 11:17571978-17572000 GTGTGTGTATATGAGCAAGTAGG + Intronic
1079369306 11:19836850-19836872 CTGTCTGCAAATGAGGAAGTGGG - Intronic
1079403712 11:20127145-20127167 ATGTGTTAATATGAGGAAATGGG + Intergenic
1079815596 11:25053163-25053185 CTGTGATCAAATGAAGATGTAGG + Intronic
1079884323 11:25966873-25966895 CTGTGTTTAAAGGTGGATGCAGG + Intergenic
1080244648 11:30166013-30166035 CTGTGGTTAAATTGGCAAGTAGG + Intergenic
1080590819 11:33721967-33721989 CTGTGTTTTAATGATGATGATGG - Intronic
1080785302 11:35469927-35469949 CTGTGATCATATTAGGAAGTAGG - Intronic
1081295355 11:41379943-41379965 GTGTATCTAAATGATGAAGTAGG - Intronic
1081453378 11:43195366-43195388 CTGAGTTTGCATTAGGAAGTGGG - Intergenic
1081794354 11:45809352-45809374 CTGGGTTTAGAGGAAGAAGTAGG + Intronic
1082199733 11:49351302-49351324 CTGGGTTTTGATGAGGCAGTGGG + Intergenic
1082262860 11:50090660-50090682 CTTTCTTTAAATGTGGAAGAGGG + Intergenic
1084127081 11:67106432-67106454 CAGTTTTTAAATGAGCAAGTAGG + Intergenic
1084195430 11:67521832-67521854 CAGTGTTTCCAGGAGGAAGTGGG - Intronic
1084370539 11:68739688-68739710 CTGATTGTAAATGAGGCAGTGGG - Intronic
1084447139 11:69210203-69210225 CTGTGTTTGAAGGAAGAAGAGGG - Intergenic
1086030592 11:82350565-82350587 CTCAGTTTAAATGAGGTATTTGG - Intergenic
1086512434 11:87573836-87573858 CTATGTTTAACTGGGGAAGGAGG + Intergenic
1086816260 11:91375580-91375602 CTGTGTTAAAATGACAAATTGGG - Intergenic
1086872102 11:92050111-92050133 TTGGGTTTAACTGAGGAATTTGG - Intergenic
1087038440 11:93775899-93775921 TTGTGTATAAATCAGGAAATGGG + Intronic
1087254867 11:95942298-95942320 CTGTGCTAAAATGAGGAAAGTGG + Intergenic
1088250484 11:107857547-107857569 ATGTGTTTAAAGGGGAAAGTTGG - Intronic
1088580383 11:111310118-111310140 CTTTGTGTATATGAGGAAGTTGG - Intergenic
1088903357 11:114135466-114135488 CGGTCTTTAAATGTGGAAGAGGG + Intronic
1089571227 11:119411725-119411747 CTGTCTATAAATCAGAAAGTGGG - Intergenic
1091945152 12:4533053-4533075 ATTTGTTTAGATGAGGCAGTAGG - Intronic
1093138488 12:15479308-15479330 CTGGGGTTAACTGAGGAAGAAGG + Intronic
1093205667 12:16245987-16246009 CTTTGATTAATTGAGGAAGCTGG + Intronic
1093763004 12:22931364-22931386 CATTTTTAAAATGAGGAAGTTGG + Intergenic
1093799360 12:23353664-23353686 TTGAGTTTAAATGAAGAAGATGG + Intergenic
1094131452 12:27079807-27079829 CTGTGGTTGAATGAGGAGGATGG + Intergenic
1094180861 12:27591310-27591332 CTGTGATTGAATGAGGAGGATGG + Intronic
1095670737 12:44857263-44857285 CTGTCTTTTAATGAGAATGTAGG - Intronic
1095761871 12:45848299-45848321 CTGTTTTGAAATGGGGAAATGGG + Intronic
1095829887 12:46573478-46573500 GTCTGTTGAAATGAGGAGGTAGG + Intergenic
1096301594 12:50432995-50433017 CTGAGTTTTAAGGAGGAAGATGG - Intronic
1096752952 12:53774291-53774313 CTGTTTTTAAATGTGGCATTAGG - Intergenic
1096902070 12:54893964-54893986 CTATTTTTAAATGAGGATTTAGG - Intergenic
1097060273 12:56278035-56278057 CTTTTTATAAATGAGGAAATTGG + Intronic
1097690609 12:62731230-62731252 AGGAGGTTAAATGAGGAAGTAGG + Intronic
1097703274 12:62842009-62842031 CCTTATTTAAATAAGGAAGTTGG - Intronic
1097708070 12:62888571-62888593 GGGTGTTTCAAGGAGGAAGTGGG + Intronic
1098899655 12:76099812-76099834 CTTTGTTTAAAGGGGGAAGCTGG + Intergenic
1099167635 12:79325974-79325996 CTGTATTTTAAAGAGGTAGTAGG - Intronic
1099411509 12:82334675-82334697 CTGTGTGTGTATGGGGAAGTGGG - Intronic
1100306676 12:93356067-93356089 CAGTGTTTAAAAGAAGAATTAGG + Intergenic
1100416352 12:94380546-94380568 CTCAGTTTAAATGAAGAACTTGG + Intronic
1100649316 12:96567438-96567460 CAGAATTTGAATGAGGAAGTTGG + Intronic
1101973012 12:109330485-109330507 CAGTTATTAAATGAGGAAGTGGG - Intergenic
1102539341 12:113607360-113607382 CTGTTTTGAAATGAGAAAGAAGG + Intergenic
1102824434 12:115935939-115935961 CTGTTTTTAAATCAGGTTGTGGG - Intergenic
1102947060 12:116999237-116999259 GTGCATTAAAATGAGGAAGTGGG + Intronic
1103003842 12:117406265-117406287 CGAGGTGTAAATGAGGAAGTGGG + Intronic
1103201555 12:119092052-119092074 CTGTGTCTAAATGAATAACTTGG + Intronic
1103519957 12:121531690-121531712 ATGTGTTTGAAGGAGGAATTGGG - Intronic
1103857752 12:123985623-123985645 CTGTGTTTAAATCTGGGAGGTGG + Intronic
1104690576 12:130822990-130823012 CTATTTTAAAATGAGGAAGGAGG - Intronic
1104948744 12:132429279-132429301 ATGTGTGAAAATGGGGAAGTGGG - Intergenic
1105485933 13:20832585-20832607 CTTTGTTTTACTGATGAAGTAGG - Intronic
1106634590 13:31514186-31514208 CTGTTTTCAAACGAGGAACTTGG - Intergenic
1106808997 13:33341283-33341305 CTATGTCTAAATGATCAAGTTGG + Intronic
1107245228 13:38286071-38286093 CTATCTGTAAATCAGGAAGTGGG + Intergenic
1108680313 13:52774446-52774468 CTGTGTGTATATGAAGAAGTGGG + Intergenic
1111294707 13:86263766-86263788 CTGAGTTTTAAAGAGGAGGTGGG - Intergenic
1112853117 13:103731737-103731759 CTGTATTTAATTGATGAAATAGG + Intergenic
1113973544 13:114209269-114209291 CTGTGCTTAAATGATGACTTTGG - Intergenic
1114789696 14:25643364-25643386 CTGTTTTTAAATGAGAAAGCAGG - Intergenic
1115667793 14:35572337-35572359 CTGTGTTTAAATGGAGGATTTGG - Intronic
1117214698 14:53538326-53538348 CAGTGTTTCTATGAGGAAGAAGG + Intergenic
1118358364 14:65035058-65035080 CTGAGTTTAAATGCAGAATTTGG + Intronic
1118635224 14:67742738-67742760 ATGTTTTCAAATGAGGAGGTGGG + Intronic
1120586748 14:86321063-86321085 CTGTGTGGAAATGAAGGAGTTGG - Intergenic
1121720850 14:96107684-96107706 CTGTCCTTAAATGATGAAGACGG - Intergenic
1122289279 14:100671185-100671207 CTGGTTTTAAATGAGAAAGTTGG - Intergenic
1124339541 15:28881247-28881269 CTGGGTTTCGGTGAGGAAGTTGG - Intergenic
1124829711 15:33136478-33136500 CTGTTATAAAATTAGGAAGTGGG - Intronic
1126399572 15:48255788-48255810 CTGTGGATAAAGGAGGAAATTGG - Intronic
1127228651 15:56963810-56963832 CTGTGTCTCAAGGAGGAATTGGG + Intronic
1128803098 15:70509609-70509631 CTGATTTGAAATGAGGATGTAGG - Intergenic
1130361621 15:83192885-83192907 CTGTCCTTAAATGAGGCAATTGG - Intronic
1131407991 15:92182320-92182342 TTGGGTTTAAAGGAGGCAGTGGG - Intergenic
1133187782 16:4112803-4112825 CTGTTTAAAAAGGAGGAAGTGGG + Intronic
1133664375 16:7951655-7951677 CAGTGTTAAAATGATGAAATTGG + Intergenic
1133718022 16:8467910-8467932 CTGTCTTTTAATGAGGAACATGG - Intergenic
1135124040 16:19791973-19791995 CTGAGTTTTAAAGAGGAGGTGGG + Intronic
1135890731 16:26354759-26354781 CTGGCTTAAAATGAGGAAGCAGG + Intergenic
1136637755 16:31536724-31536746 CTGTGTTTAGAAGAGGATGTGGG - Intergenic
1137315291 16:47313590-47313612 TTAAGTTAAAATGAGGAAGTCGG + Intronic
1137515984 16:49144634-49144656 CTCTGTTTAAGTGAGGGAATGGG + Intergenic
1138477081 16:57277741-57277763 CTGTGGTTAAGTGAGGATGTGGG + Intronic
1138818082 16:60225796-60225818 CTGAGATGAACTGAGGAAGTAGG + Intergenic
1140655643 16:77136567-77136589 CTGAGTTTCAATGAGTAAGTGGG + Intergenic
1146552963 17:33797974-33797996 CAGTGTGCAAAGGAGGAAGTGGG + Intronic
1146700508 17:34955087-34955109 CTAAGTTTAATTGAGGAAATAGG + Intronic
1147180385 17:38681092-38681114 TTTTTTTTAAGTGAGGAAGTGGG - Intergenic
1147259782 17:39202570-39202592 CTGTGTGCAAATCAGAAAGTTGG + Intronic
1147344762 17:39782672-39782694 ATGGGTTTAAATGACGAAATAGG + Intronic
1148003952 17:44409685-44409707 CTGTTTTTTAATGAGGGAGCTGG - Intronic
1149147401 17:53512591-53512613 CTGTGTGCAAATGAGATAGTTGG - Intergenic
1149396102 17:56245773-56245795 CTGTGTTGAAATGTCAAAGTAGG - Intronic
1150345728 17:64403340-64403362 CCATCTATAAATGAGGAAGTAGG + Intronic
1152496245 17:80674441-80674463 CTGTGTGCAAATGAAGAACTGGG + Intronic
1153818294 18:8809866-8809888 CTGGGTGTGAATGAGGAGGTGGG + Intronic
1153827913 18:8893767-8893789 AAGTGTTTAAATGAAGAGGTTGG + Intergenic
1155271682 18:24148030-24148052 CTGTGTTTACATCAGGAAGGAGG + Intronic
1155816663 18:30319719-30319741 CTGTTTTTAAATGTTGAACTGGG + Intergenic
1157228077 18:45886413-45886435 ATGTGTTTAAATGAAAAAGGAGG + Intronic
1158209597 18:55032583-55032605 CTGTCTTTGACTGAGGAATTGGG + Intergenic
1158860027 18:61582626-61582648 GTGTGTTTATATGAGGGTGTGGG - Intergenic
1160311163 18:77791601-77791623 CTGTGTTTCAATGAACAAGGAGG - Intergenic
1160707870 19:538009-538031 CTGTGCTTTAATGAAGAAATGGG + Intronic
1161879996 19:6942514-6942536 CTGTGATTAAAGCAGCAAGTTGG - Intergenic
1162126790 19:8503724-8503746 AAGTGTTGAAATGAGGAAGGCGG - Intergenic
1162270229 19:9608338-9608360 CTGTGAAGACATGAGGAAGTGGG + Exonic
1162792600 19:13070746-13070768 CTCTGTGTAAAGGAGCAAGTGGG - Intronic
1162810601 19:13162623-13162645 CTGTGTATATATGAGGAAACAGG + Intergenic
1163293369 19:16395306-16395328 CAGTCTTTCAATGAGAAAGTGGG + Intronic
1163648299 19:18502650-18502672 CGGTGTTTAAATGAGAGAGAGGG + Intronic
1167059783 19:47136843-47136865 CTCTGTTCAGATGAGGAAGGAGG + Intronic
1167966145 19:53148865-53148887 CTATGTTTACATGAGGAGGGAGG + Intronic
925563922 2:5229101-5229123 CTGTGTGTACATGCTGAAGTTGG - Intergenic
928436517 2:31257977-31257999 CTATCTGTAAATCAGGAAGTTGG + Intronic
928650120 2:33395193-33395215 CTATTTTTAAATGAGGAACCTGG + Intronic
928916295 2:36475010-36475032 ATGTTTTGAAATTAGGAAGTAGG + Intronic
929858837 2:45658064-45658086 CTGTGTTTAAATGACAATGGAGG - Intronic
929953432 2:46435296-46435318 TTTTGTTTCAATGAGAAAGTTGG + Intronic
931740240 2:65236051-65236073 CTGTTTTTAAAAGACTAAGTGGG + Intronic
933358353 2:81243984-81244006 CTGAGTTTAAATGTGTAAGAAGG + Intergenic
933451429 2:82457904-82457926 CTGAGTTTCAATTATGAAGTAGG + Intergenic
934602641 2:95669633-95669655 CTTTATTGAAATGAGGAAGTTGG - Intergenic
935077861 2:99763196-99763218 CTGTGTTTAAAGGGGGATGTTGG - Intronic
935524551 2:104149764-104149786 CTGTGTTTTGATGAATAAGTAGG + Intergenic
935632130 2:105220714-105220736 CTAGGTTTCAATGAGTAAGTTGG + Intergenic
935902004 2:107802915-107802937 CTGAGTAAAAATGAGGCAGTAGG - Intergenic
936536014 2:113311825-113311847 CTTTATTGAAGTGAGGAAGTTGG - Intergenic
936550303 2:113432505-113432527 CTGAGTTTAAAAGAGCAAGGAGG + Intergenic
936758954 2:115750207-115750229 CTGTCTCTGAATGAGGGAGTAGG - Intronic
938866266 2:135424055-135424077 CTCTGTTTAAAAAAGCAAGTCGG + Intronic
938946242 2:136214574-136214596 CTGTGTTTATCTTAGGGAGTTGG + Intergenic
940372772 2:152921367-152921389 CTGTCTGTAAACCAGGAAGTAGG - Intergenic
941180376 2:162252599-162252621 CTGATTTTAAATGGGGAATTGGG - Intergenic
941543908 2:166821277-166821299 GTGTGTTTGAAAAAGGAAGTGGG + Intergenic
941557303 2:166997405-166997427 AAATGTTTAAATGAGGAGGTAGG + Intronic
942747568 2:179252655-179252677 CTTGGTTAAATTGAGGAAGTAGG + Intronic
942756720 2:179350112-179350134 CTTGGTTAAAAAGAGGAAGTAGG - Intergenic
944040877 2:195352766-195352788 CTGTTGATAAATGAGGATGTTGG - Intergenic
944260638 2:197672500-197672522 CTGGGTTTAAAGGAGGAATGTGG + Intronic
944337018 2:198546201-198546223 CTTTGTTTAAATGTGGAAGTTGG - Intronic
945050837 2:205822776-205822798 CTCATTTTAAATGAGTAAGTAGG - Intergenic
946319422 2:218942696-218942718 ATGTATTTAAAAGAGCAAGTTGG + Intergenic
946363539 2:219234370-219234392 GTGTGTTTAAATAAGGAAATGGG - Intronic
946690339 2:222304563-222304585 CTTTATTTAAAAGAGGAAATGGG - Exonic
947483217 2:230522352-230522374 TTGTTGTTAAATGAGAAAGTGGG + Intronic
948120048 2:235523238-235523260 CTGTGATGTCATGAGGAAGTGGG - Intronic
1169110224 20:3027893-3027915 GTGTGTGTAAATGGGGACGTTGG + Intronic
1170138413 20:13101250-13101272 CTGTGTTTGCATGAAGAAGCTGG + Intronic
1170181501 20:13535511-13535533 CTGTGGTTAAAAGAGGGATTAGG - Intronic
1170212207 20:13856664-13856686 CTGTCTTTCAAAAAGGAAGTTGG - Intronic
1172168395 20:32913274-32913296 CTGTCTATGAATCAGGAAGTAGG - Intronic
1172579003 20:36031822-36031844 CAGTGGTGAAATGAGCAAGTTGG + Intergenic
1174430808 20:50467339-50467361 CTGTATTTAAATCCAGAAGTAGG + Intergenic
1174668197 20:52280724-52280746 CTGTGTTTTAGGGAGAAAGTCGG + Intergenic
1174716377 20:52763213-52763235 CTCTTTATAGATGAGGAAGTCGG - Intergenic
1175048682 20:56132414-56132436 CTGAGATTAATTGAGGAAGCGGG - Intergenic
1175528022 20:59648954-59648976 CTGTGTTTACATGATGAGGCTGG + Intronic
1176915292 21:14618352-14618374 GTGTGATTATATGAGGAAGAGGG + Intronic
1177815836 21:25975430-25975452 CTGATTTTCAATGAGAAAGTAGG - Intronic
1178969162 21:37155890-37155912 ATGTGTCTAAAAGAGGAAATGGG - Intronic
1181777327 22:25169101-25169123 CTGTCTTTTGATGAGGAATTTGG - Intronic
1181913398 22:26258582-26258604 CTGTGTTTAAATGAGGAAGTTGG + Intronic
1182051518 22:27316104-27316126 CTCTGTCTAAATGATGAAGTTGG - Intergenic
1184478369 22:44733779-44733801 CTGTGTTACAATGAGTAGGTGGG - Intronic
1184876316 22:47278018-47278040 CTGAGCTGAAATCAGGAAGTGGG + Intergenic
949817820 3:8078867-8078889 CTGTGTTTAAGTTAGGAAACAGG + Intergenic
950766052 3:15273884-15273906 ATGTGATTATATTAGGAAGTGGG + Intronic
950932286 3:16802615-16802637 CTGTTTACAAATGAAGAAGTAGG + Intergenic
951760039 3:26137748-26137770 TTGTTTTTAAATTATGAAGTGGG - Intergenic
952093763 3:29923392-29923414 TTGTGTTTTAATGATGAGGTGGG + Intronic
953469778 3:43156824-43156846 CTGTGTTTAAATGCTGAGTTGGG + Intergenic
955565705 3:60242804-60242826 ATGTGTTTGTATGAGGAAGAAGG - Intronic
956154415 3:66280238-66280260 CTGTATTTGAAGGAGAAAGTAGG + Intronic
956263006 3:67365202-67365224 CTGTATTGAAAGGAGAAAGTGGG + Intronic
956377670 3:68633173-68633195 CTATTTTTAAATGAGGAACCTGG + Intergenic
957272163 3:78044873-78044895 CTGTCTTTAAATGCTGAAATGGG - Intergenic
958045919 3:88283422-88283444 CTGTGTGTGAATGAGGAAGGAGG + Intergenic
959306074 3:104667736-104667758 ATGTTTTTAAATGACTAAGTTGG + Intergenic
960288540 3:115856703-115856725 CTGTCTCTGAATCAGGAAGTGGG + Intronic
960587164 3:119330645-119330667 CACTGTTTAGATGAGGAAGCTGG - Intronic
962608075 3:137049322-137049344 CTGTCTGTAAATGTGGATGTAGG - Intergenic
964691702 3:159457189-159457211 TCCTTTTTAAATGAGGAAGTTGG - Intronic
964886708 3:161491853-161491875 CTGTGTTTAAATCGGGAAGCAGG + Intergenic
967295464 3:187959976-187959998 CTTTGTTTAAATGAGAAGATTGG - Intergenic
967746393 3:193060546-193060568 CTGAGGTGAAATGGGGAAGTCGG + Intergenic
968828085 4:2914313-2914335 CAGTGTTTAGCTGAGGAATTTGG - Intronic
969058829 4:4419255-4419277 CTTTGTTCAAAGGAAGAAGTGGG - Exonic
970462796 4:16292409-16292431 CTGTTTATCAATGAGGAAGTGGG + Intergenic
970528523 4:16957707-16957729 CTGTGCTTAATTGAGGAGGGTGG + Intergenic
970773493 4:19643974-19643996 CTATGTTGAAATGTGAAAGTGGG + Intergenic
972312826 4:37896646-37896668 AAGTGTTTTCATGAGGAAGTTGG + Intronic
972872507 4:43317308-43317330 CTGTTTTTACAAGTGGAAGTTGG + Intergenic
973624959 4:52762421-52762443 CTGTGAATAAAAGAGGAAGAGGG - Intergenic
976403414 4:84635061-84635083 CTCTGTTTAAATTGGTAAGTGGG + Intronic
976676233 4:87706815-87706837 CTTTTTTTAAGTGAGGAAGAGGG - Intergenic
977531237 4:98202584-98202606 CTGTCTTTAAATTAGCCAGTTGG + Intergenic
977871594 4:102096767-102096789 CTGATTTGAAATGGGGAAGTGGG - Intergenic
978340514 4:107717742-107717764 CTGTGTGGAAATTGGGAAGTAGG - Intronic
978520580 4:109611046-109611068 CTCTTTTTAGAAGAGGAAGTTGG - Intronic
979083522 4:116374978-116375000 CTGTGTGTGAACGAGGAAGTGGG + Intergenic
979351788 4:119651781-119651803 CATTTTATAAATGAGGAAGTAGG + Intergenic
979730859 4:124021129-124021151 CTAAGTTTAAATGAGGCTGTTGG + Intergenic
979869568 4:125802071-125802093 TTCTGTTTCATTGAGGAAGTTGG + Intergenic
980023212 4:127733638-127733660 ATGTTTTAAAATAAGGAAGTTGG - Intronic
980120434 4:128722411-128722433 CTGTGTATAAATGAAGAACCTGG - Intergenic
980749761 4:137073007-137073029 CAGTGTTTTAAAGAGGAAATAGG - Intergenic
981952658 4:150428927-150428949 ATGTGATGAAATGAGGAAGAGGG - Intronic
982387096 4:154819599-154819621 CTGTTTTTACATGATGAACTAGG - Intronic
983990947 4:174119053-174119075 CTGTGTTGAAAAGAGAAAGGTGG + Intergenic
984711093 4:182885882-182885904 ATGGGTTTGAATGAGGAATTTGG - Intergenic
984748250 4:183244973-183244995 CTGTGATTAAAAGAGAAAGGAGG + Intronic
985020866 4:185688689-185688711 CTGTGTTTACAAAATGAAGTAGG - Intronic
985218741 4:187680493-187680515 CTGTTTTTGAATGAGGGAATTGG + Intergenic
985340643 4:188949225-188949247 CTCTGTTTTAAAAAGGAAGTAGG + Intergenic
985878028 5:2615186-2615208 CTTTGTATAAATGAGGAGTTGGG + Intergenic
987823826 5:23002417-23002439 CTCTGATTAAATGGGGAATTAGG - Intergenic
988700761 5:33672295-33672317 CTGTGTGTATATGAGTATGTGGG - Intronic
991612663 5:68465137-68465159 CAGTTTTTAAATGAGGAATCTGG - Intergenic
992779479 5:80114878-80114900 ATGTTTTTAAATGAGTAAGGTGG + Intronic
993041598 5:82820966-82820988 ATGTGTTTCTATGAGGAAGAAGG + Intergenic
993083374 5:83331010-83331032 CTGTATTTTAATGATGAGGTAGG - Intronic
993878043 5:93331076-93331098 TTCTGACTAAATGAGGAAGTTGG + Intergenic
994963830 5:106640415-106640437 TTGTGTTCAAATGAAGAAGACGG - Intergenic
996095477 5:119394476-119394498 CTGTGTATAAATAATAAAGTAGG + Intronic
998191098 5:140025135-140025157 GTGTGTTTAGTTGAGGAAGAGGG - Intronic
999894714 5:156018779-156018801 CTGTGTATGAATGCTGAAGTAGG - Intronic
1000174638 5:158739275-158739297 CTGTGTCTAAAATGGGAAGTAGG + Intronic
1001017257 5:168152843-168152865 CTGTGTATGAATGCGGATGTGGG - Intronic
1003697539 6:8425427-8425449 CATTGGTAAAATGAGGAAGTTGG + Intronic
1003972704 6:11314302-11314324 TTGGCTTTAAATGAGGACGTAGG + Intronic
1005521409 6:26603968-26603990 TTGTGTTTTAAAGAGTAAGTTGG + Intergenic
1006886884 6:37389457-37389479 CTGTATTTGGAGGAGGAAGTAGG + Intronic
1007094153 6:39203221-39203243 CTCTGTTAAAATGGGGAAATGGG - Intronic
1007934551 6:45721411-45721433 CTGTGTTAAAATCAGGGTGTCGG - Intergenic
1008854268 6:56063018-56063040 CTGTGTTTACATGAAGAGTTTGG + Intronic
1010672999 6:78709063-78709085 CTGTCTATGAATGAGGAAGTGGG - Intergenic
1010953712 6:82067225-82067247 CTGTCTGCAAGTGAGGAAGTAGG + Intergenic
1012980427 6:105823721-105823743 ATATGTGTAAATGAGGAAATTGG + Intergenic
1013522352 6:110944818-110944840 CTATGACTAAATGAGGTAGTTGG - Intergenic
1014397837 6:120948422-120948444 CTGTAATTAAATGAGGATGTAGG - Intergenic
1015020638 6:128469783-128469805 GTGTCTTTAAATGTGGAAGAGGG + Intronic
1016974952 6:149798358-149798380 CTGTGCTTAAATGAGGCGGGTGG + Intronic
1017754891 6:157521138-157521160 CCATCTGTAAATGAGGAAGTGGG - Intronic
1017798718 6:157872127-157872149 CTATGTTAAGATGAGAAAGTGGG + Intronic
1018227944 6:161647535-161647557 CTGTGTTTAAAAGTGCAACTGGG + Intronic
1020225292 7:6274737-6274759 CTGTGCTTTAATGGGGAAATTGG + Intergenic
1020701429 7:11488748-11488770 CTTTGTTCTAGTGAGGAAGTTGG - Intronic
1020800127 7:12722708-12722730 GTGTATTTATAGGAGGAAGTTGG - Intergenic
1020854370 7:13398308-13398330 CTTTTTTTAAATGAGGAATTTGG - Intergenic
1021738761 7:23664328-23664350 CTGGGTATAAAACAGGAAGTAGG - Intergenic
1022518998 7:30993950-30993972 CTGTGTTTAGCTAAGGGAGTGGG - Intergenic
1023353537 7:39344249-39344271 CTGTGCTTATATGAGGAATGAGG + Intronic
1023616646 7:42026518-42026540 ATTTGTTTAAATGAGAAGGTAGG + Intronic
1023749788 7:43361479-43361501 CTGTGTATAAATGAGGACAGTGG + Intronic
1023990363 7:45124937-45124959 CATTTTATAAATGAGGAAGTTGG + Intergenic
1025244012 7:57302470-57302492 CTGTATTTAAATCCAGAAGTAGG - Intergenic
1027200195 7:76059403-76059425 CTGTGTGTGAATGAGGAAATGGG - Intronic
1028443762 7:90895034-90895056 ATGTGTTTTAAAGAAGAAGTAGG + Intronic
1028952344 7:96650635-96650657 TTGTGTTTAAATTTGGAACTTGG - Intronic
1029416153 7:100444492-100444514 CAGTGTTCAGATGAGGAAGAGGG - Intergenic
1029661263 7:101963586-101963608 CTATTTTTAGATGAGGAAATGGG - Intronic
1029804423 7:102981661-102981683 CTGTGTATAAACCAGGAAGTGGG - Intronic
1031749496 7:125554536-125554558 CCATGTTCAAATTAGGAAGTGGG + Intergenic
1031774187 7:125885710-125885732 CTGTCTCTGAATAAGGAAGTAGG + Intergenic
1035917390 8:3639627-3639649 CAGTGTTCAAATGAGGGAATTGG - Intronic
1036759622 8:11498301-11498323 CTGTGCTTAATAGATGAAGTGGG + Intronic
1036908914 8:12735485-12735507 CTCTATTTAAAGGAGGAAGAAGG + Intronic
1038875973 8:31549871-31549893 CTGAATTTACATGAGGAAATAGG - Intergenic
1039211544 8:35220740-35220762 CCGTGTATAAATGAGGAAATGGG + Intergenic
1040872268 8:52112732-52112754 CTGGGTTTTAATGAGGAAACAGG - Exonic
1040969482 8:53118633-53118655 CTTATTTTAAATGAGGATGTGGG + Intergenic
1041716929 8:60940983-60941005 CTGTTTATAAACCAGGAAGTGGG - Intergenic
1041850707 8:62388882-62388904 CTGTGGTTAAATAAGCAATTGGG + Intronic
1042156618 8:65851125-65851147 GTGTGTTTTAATGATGAGGTAGG + Intergenic
1042257934 8:66825674-66825696 CTCTGTGTAAATAAGGGAGTAGG - Intronic
1043550809 8:81370385-81370407 GTGTGTTTATCTGAGGCAGTTGG - Intergenic
1043790043 8:84454302-84454324 CTGTGTTTGTTTGAGGAGGTAGG + Intronic
1045099995 8:98834608-98834630 CTGTCTATGAATCAGGAAGTTGG - Intronic
1045100203 8:98836302-98836324 CTGTCTATGAATCAGGAAGTTGG - Intronic
1046373951 8:113350848-113350870 CTGTGTTTAAAGGAGAAAAGTGG - Intronic
1046794222 8:118353498-118353520 CTGTCTACAAATGAGGAAGAAGG + Intronic
1047665901 8:127090627-127090649 CTGGGTTAAAATCAAGAAGTTGG - Intergenic
1049189580 8:141279364-141279386 CTTTGTTTGAAGGAGCAAGTCGG + Intronic
1049902635 9:184315-184337 CTGAGTTTAAAAGAGCAAGGAGG - Intergenic
1050115843 9:2262630-2262652 ATGTGTATAAATGATCAAGTAGG - Intergenic
1050214069 9:3302139-3302161 CTGTATTAAAATATGGAAGTAGG + Intronic
1050366119 9:4875413-4875435 CTTTGTTAAAATGAGGATTTTGG + Intronic
1050586602 9:7118870-7118892 CTGTGTTTACATCTGGAAGGAGG - Intergenic
1050996668 9:12229130-12229152 CTGTGTATATATGAGGGAGTGGG - Intergenic
1052050104 9:23836754-23836776 CTGTCTATAATAGAGGAAGTGGG + Intergenic
1053221949 9:36319529-36319551 CTGTGTTTAATGGAGGGAGGAGG + Intergenic
1053745659 9:41194601-41194623 CTGAGTTTAAAAGAGCAAGGAGG - Intronic
1054481612 9:65670613-65670635 CTGAGTTTAAAAGAGCAAGGAGG + Intronic
1054682683 9:68236670-68236692 CTGAGTTTAAAAGAGCAAGGAGG + Intronic
1059147085 9:111909539-111909561 CTGTGGCTTAATGGGGAAGTTGG - Intronic
1060090194 9:120735897-120735919 CTGGGTTTTGATGGGGAAGTAGG + Intergenic
1061779655 9:132988153-132988175 CTGTGTTTAAATGAGTAACCAGG + Intronic
1202781792 9_KI270718v1_random:5382-5404 CTGAGTTTAAAAGAGCAAGGAGG - Intergenic
1185489157 X:507569-507591 CTGTGTTTAACTGGGAATGTCGG + Intergenic
1185518615 X:719648-719670 ATGTGATTAAATAAAGAAGTGGG + Intergenic
1186096006 X:6102476-6102498 CTGTCTATGAATCAGGAAGTGGG + Intronic
1186147850 X:6643632-6643654 CTATATTTGAATGAGGAGGTGGG - Intergenic
1186867834 X:13738782-13738804 CAGTGTTTAAATGATAAATTAGG - Intronic
1187630217 X:21161109-21161131 CCGTGTATACATGAGGAAATTGG + Intergenic
1187642915 X:21314348-21314370 GTGTGTGTACATCAGGAAGTGGG - Intergenic
1188569392 X:31563991-31564013 CTGTCCTTAAAAGGGGAAGTTGG + Intronic
1189346162 X:40243032-40243054 CTGAGTTAAAATGAGGTAGCCGG - Intergenic
1189533632 X:41912934-41912956 CTTTTTATAAATGAGGAAGCAGG + Intronic
1194961837 X:100244934-100244956 ATGTGTTCAAGTGAGGAACTGGG + Intergenic
1197117486 X:122850624-122850646 GTGTGTTTAAAGGAAGCAGTGGG + Intergenic
1198048591 X:132927042-132927064 CTTTGTTTACATGTGGAATTTGG - Intronic
1199903695 X:152203597-152203619 CTGTGCTAAAATCAGGATGTAGG + Intronic
1201885012 Y:18872679-18872701 CTGTCTATGAATGAGAAAGTGGG - Intergenic