ID: 1181915609

View in Genome Browser
Species Human (GRCh38)
Location 22:26277416-26277438
Sequence ACGGTCGTACAGATGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181915609_1181915615 24 Left 1181915609 22:26277416-26277438 CCCTGCTCCATCTGTACGACCGT No data
Right 1181915615 22:26277463-26277485 ACAGCAAGAAATTAATCAGTTGG 0: 1
1: 0
2: 1
3: 15
4: 259
1181915609_1181915616 25 Left 1181915609 22:26277416-26277438 CCCTGCTCCATCTGTACGACCGT No data
Right 1181915616 22:26277464-26277486 CAGCAAGAAATTAATCAGTTGGG 0: 1
1: 0
2: 3
3: 20
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181915609 Original CRISPR ACGGTCGTACAGATGGAGCA GGG (reversed) Intronic
No off target data available for this crispr