ID: 1181916787

View in Genome Browser
Species Human (GRCh38)
Location 22:26287841-26287863
Sequence TTGTGTATGATTAAGGAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 434
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 408}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181916782_1181916787 11 Left 1181916782 22:26287807-26287829 CCTTAAGTTTGGAGCCAGCTGGC 0: 1
1: 0
2: 0
3: 7
4: 115
Right 1181916787 22:26287841-26287863 TTGTGTATGATTAAGGAAAAGGG 0: 1
1: 0
2: 1
3: 24
4: 408
1181916783_1181916787 -3 Left 1181916783 22:26287821-26287843 CCAGCTGGCAAGATCCAAGCTTG 0: 1
1: 0
2: 0
3: 8
4: 99
Right 1181916787 22:26287841-26287863 TTGTGTATGATTAAGGAAAAGGG 0: 1
1: 0
2: 1
3: 24
4: 408

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181916787 Original CRISPR TTGTGTATGATTAAGGAAAA GGG Intronic
901157501 1:7150294-7150316 CTGGGTGTGATTAAGGAAACAGG + Intronic
903042129 1:20538866-20538888 TTGGCTATGATAAAGGAAATTGG + Intergenic
904993009 1:34608879-34608901 TTGAATAGGAATAAGGAAAACGG - Intergenic
906222699 1:44094516-44094538 TTGTGTATGATGAGGGATAGGGG + Intergenic
906936490 1:50218422-50218444 ATGTGTATGATAAGGGAGAATGG - Intergenic
907172500 1:52482257-52482279 TTGTATATGAGTATAGAAAAAGG - Intronic
907356549 1:53879718-53879740 TTGTTCATTATAAAGGAAAACGG + Intronic
907507725 1:54933440-54933462 TTATGTACAAATAAGGAAAATGG + Intergenic
907615190 1:55917178-55917200 TTGTGTTTAATTAATGAATAAGG - Intergenic
908363366 1:63391713-63391735 GTATGTATTATTTAGGAAAATGG + Intronic
909590604 1:77344956-77344978 TTGTTTATTTTTAAAGAAAAAGG + Intronic
909719549 1:78751926-78751948 TTGTGTTTGTTTATAGAAAAGGG - Intergenic
909773494 1:79456183-79456205 TTGAGTATGTTTAAAGGAAAAGG - Intergenic
909900284 1:81126280-81126302 TTTTGAATTATTAAGTAAAAAGG + Intergenic
909963484 1:81878438-81878460 TTGTAAATAATTAATGAAAAAGG + Intronic
910516449 1:88066591-88066613 TTGTCCATCATTCAGGAAAAAGG - Intergenic
910861364 1:91745255-91745277 TTGTGCAGGAGTCAGGAAAAGGG - Intronic
911185723 1:94902707-94902729 GTGTGTATGAGGAAGGAAAATGG - Intronic
911344345 1:96678286-96678308 TTGTATAAGTTTATGGAAAAAGG - Intergenic
912375335 1:109205068-109205090 TTGTGTAAAATTGGGGAAAATGG - Intronic
914820172 1:151095709-151095731 TAGTGGAGGATAAAGGAAAAGGG + Intronic
915770420 1:158416554-158416576 ATTTGTATAATTAAGGAAAATGG - Intergenic
915825799 1:159075256-159075278 TTGTGTATGATATAAGAGAAAGG - Intronic
915908304 1:159895852-159895874 TTGTATGTAATTAAGGGAAAAGG + Intronic
916318484 1:163477299-163477321 TTATGAATGCTAAAGGAAAAGGG - Intergenic
916404009 1:164479169-164479191 TTGTATATAAATAAGGTAAATGG + Intergenic
917008056 1:170437607-170437629 GTGTGAAGGATAAAGGAAAAGGG - Intergenic
917451582 1:175151771-175151793 TTGTGATTGAGGAAGGAAAAAGG + Intergenic
918029106 1:180786332-180786354 CTGTCTAGGAATAAGGAAAATGG - Intronic
919012223 1:191980009-191980031 TTGTGTATGGTGAAAGATAAGGG + Intergenic
919146193 1:193638597-193638619 TTGTGTATGATATAAGAAAAGGG + Intergenic
919243950 1:194952782-194952804 TTGTGTATGATCACAGATAAAGG - Intergenic
919277827 1:195444401-195444423 TTGTGTTTGATTAAGTAATTGGG - Intergenic
919560838 1:199116133-199116155 TTGTGTATCACCAATGAAAATGG - Intergenic
919699183 1:200613577-200613599 TTTTTTATGATAAAGGAAATTGG - Intronic
921798619 1:219376303-219376325 TTGTGTATGATGTAAGATAAAGG - Intergenic
922268356 1:224009625-224009647 TTGTGTATGATGTAAGATAAGGG + Intergenic
923186086 1:231574872-231574894 ATGTGTATGATGAAGTAAGAGGG - Intronic
923396088 1:233566017-233566039 ATTTGTATGATTATGAAAAATGG + Intergenic
1063229501 10:4050233-4050255 TTGTGGAAAATTAAGGGAAATGG + Intergenic
1063492570 10:6478402-6478424 TTTTGTTTTTTTAAGGAAAAAGG + Intronic
1064480680 10:15737447-15737469 TTTTATTTGTTTAAGGAAAATGG + Intergenic
1064525615 10:16253570-16253592 TTGTGTATGGTAAAAGGAAAGGG - Intergenic
1064980190 10:21158693-21158715 TTGCGTTGGATTAAGGAAATTGG - Intronic
1065563650 10:26987992-26988014 TTGTGTATGAATAGGGAGAAAGG + Intergenic
1065622801 10:27600370-27600392 ATGCTTATGATAAAGGAAAATGG - Intergenic
1067851152 10:49755361-49755383 TTGTGTATGTCTAGAGAAAAGGG - Intronic
1068066095 10:52133648-52133670 ATTTGTATGATTAATGACAAGGG + Intronic
1068777767 10:60886615-60886637 TTGAGTATTAATAAGTAAAATGG - Intronic
1069203291 10:65650820-65650842 TTGTTTAGGAATAAGGAAAAAGG - Intergenic
1069589229 10:69631463-69631485 CTGTGTCTGATTAACAAAAAGGG - Exonic
1071885423 10:89944523-89944545 TTGTGTAGGTTTGAGGAGAAGGG - Intergenic
1072494383 10:95941160-95941182 TTGTGTATGATGTAAGATAAAGG - Intergenic
1074411919 10:113235839-113235861 TTGTGTAGGAATATGGACAATGG - Intergenic
1076588531 10:131567784-131567806 TTGTGTCTGACAAATGAAAATGG - Intergenic
1077164779 11:1130123-1130145 TTGTGAATGAACAAGGAACAAGG - Intergenic
1077446858 11:2597963-2597985 ATGTGCTTGATTAAGAAAAAAGG - Intronic
1077792640 11:5458140-5458162 TTGTGTATGATGAAAGGAAGAGG + Intronic
1077796023 11:5493042-5493064 TTGAGTTTGATAAAGGAATATGG + Intronic
1077824868 11:5795575-5795597 TTGTGGATGAGCAAAGAAAATGG + Intronic
1078848013 11:15139182-15139204 TTGAGTATGATTTATGAAACAGG + Intronic
1079568604 11:21914924-21914946 TTGTGTATGCATTGGGAAAAGGG + Intergenic
1080089474 11:28327806-28327828 TTTTGTAAAATTAATGAAAATGG - Intronic
1080399200 11:31918495-31918517 TGGTGTAAGATTGAGGAAATGGG - Intronic
1080473936 11:32572345-32572367 GTTTTTATCATTAAGGAAAAGGG + Intergenic
1080558223 11:33436977-33436999 TTGTGTTTGTGAAAGGAAAAAGG + Intergenic
1080932670 11:36829085-36829107 TAGCCTATGATTAAAGAAAAGGG - Intergenic
1081035523 11:38139841-38139863 TTGTGCATGATTAAATATAAGGG - Intergenic
1081759798 11:45569188-45569210 TAGGGTATGATTAAGGGAAGGGG + Intergenic
1082222254 11:49653664-49653686 TTATGTATGATAAAAGTAAAAGG - Intergenic
1082724827 11:56721998-56722020 TCTTGTATGATTAAGGATAGAGG - Intergenic
1085888514 11:80549536-80549558 TTGTATATGATGAAAGGAAAAGG - Intergenic
1086626787 11:88965535-88965557 TTATGTATGATAAAAGTAAAAGG + Intronic
1086814470 11:91351620-91351642 TTGAGTATGATGAATGAAGAAGG - Intergenic
1086827892 11:91522270-91522292 TAGTTTATTATAAAGGAAAATGG + Intergenic
1087038440 11:93775899-93775921 TTGTGTATAAATCAGGAAATGGG + Intronic
1087608040 11:100401188-100401210 TTGTGTATGATGTAGAATAAGGG + Intergenic
1088827764 11:113510095-113510117 TTCTGTATGGTTGAGGAAATTGG - Intergenic
1089404345 11:118185151-118185173 TAGTGTTTTATGAAGGAAAATGG + Intergenic
1090368784 11:126230994-126231016 TGGTGGATGAAAAAGGAAAAAGG - Intronic
1090886452 11:130881056-130881078 CTGTCTATGAACAAGGAAAAGGG + Intronic
1091123180 11:133073882-133073904 TTGTTTGTGAATAAAGAAAAAGG + Intronic
1091971937 12:4794672-4794694 GTGTGTGTGTTTAAAGAAAAAGG + Intronic
1093410188 12:18856029-18856051 TTGTGTATGATATATGATAATGG - Intergenic
1093873643 12:24322925-24322947 TTGTGTTTGAATTGGGAAAAAGG - Intergenic
1094343900 12:29445049-29445071 TTGTATATGATTTCTGAAAATGG - Intronic
1094532710 12:31292103-31292125 TTCTCTATAATTAAGGGAAAGGG + Intronic
1095148983 12:38768236-38768258 TTGTATATGATTAAGAAAGTAGG - Intronic
1095756845 12:45777498-45777520 TTGTGCATTATTAAGAAGAAAGG - Intronic
1096099597 12:48961632-48961654 GTGTGTCTGATGAAGGAAGAGGG + Intergenic
1097353412 12:58574246-58574268 TTGTGAATGAATAATCAAAAGGG - Intronic
1097373123 12:58808398-58808420 TAGTTTATGCTGAAGGAAAATGG - Intronic
1098007013 12:66008146-66008168 TTTTGTATGTTTAATGGAAATGG - Intergenic
1098999748 12:77165516-77165538 TTGTGTATGGTGTAGGAAAGGGG - Intergenic
1099130277 12:78820389-78820411 TTGTGGATAATAAAAGAAAAAGG - Intergenic
1099669160 12:85668577-85668599 TTGTGTATGGTTAATGACAAAGG - Intergenic
1099842063 12:87978284-87978306 ATATGTGTGATTTAGGAAAAAGG - Intergenic
1100094450 12:91015025-91015047 TTGTATATGATGAAAGAAAGGGG - Intergenic
1100698585 12:97122057-97122079 TTATGCATGATAAAGAAAAAAGG + Intergenic
1100884234 12:99052012-99052034 TAGTAAATGATTGAGGAAAATGG - Intronic
1100944266 12:99762499-99762521 TTGTGTATGATGAAAGGTAAGGG - Intronic
1101095002 12:101329141-101329163 TACTGTATTATTAAGGGAAATGG + Intronic
1101271287 12:103147992-103148014 TTCTGTATGACTAATAAAAAAGG - Intergenic
1101666216 12:106818086-106818108 TTGTATAATATCAAGGAAAAAGG + Intronic
1103103141 12:118198177-118198199 CTTTGTATGTTCAAGGAAAAGGG - Intronic
1104188010 12:126450867-126450889 GTGTGTATTATTAAAGTAAAAGG + Intergenic
1105283208 13:18981952-18981974 TTGGTTAGGATAAAGGAAAAAGG + Intergenic
1106177426 13:27343129-27343151 TTCTGTGTTATTTAGGAAAATGG + Intergenic
1107669631 13:42731507-42731529 GTGTGAATGAGGAAGGAAAAAGG + Intergenic
1108072406 13:46641744-46641766 TTTTGTATGAAAAAGGAAAGTGG - Intronic
1109126158 13:58520223-58520245 TTGACTATGATTTGGGAAAATGG - Intergenic
1109442146 13:62388878-62388900 TTGTCTATGCTTAATTAAAAAGG - Intergenic
1109467966 13:62763507-62763529 TTGTGTATGATTTAAGAAAAAGG - Intergenic
1110335056 13:74319024-74319046 TTGTGTAAGACTAAGGAGAATGG - Intergenic
1110732917 13:78901381-78901403 TTGTGTATGTGTAAGGAAGGGGG - Intergenic
1111339657 13:86866977-86866999 GTTTGTATGTTTAAAGAAAAAGG + Intergenic
1111477450 13:88770865-88770887 TTGTGTAGAAATAAGTAAAATGG - Intergenic
1111907121 13:94268053-94268075 TTCTGAATGATTAAGAAGAATGG + Intronic
1112024279 13:95398121-95398143 ATGGGTATGATTCAGGAAAAGGG - Intergenic
1115652312 14:35411486-35411508 TTGGGAATCATTTAGGAAAAAGG + Intergenic
1115927764 14:38456037-38456059 TTGTATATGTTTGAGAAAAAGGG - Intergenic
1116681734 14:47979670-47979692 TTGTTTAATATTAAGTAAAATGG - Intergenic
1117395586 14:55306206-55306228 TTCATTATGATTAGGGAAAATGG + Intronic
1117512644 14:56469614-56469636 TTGTGTATGATGAAAGATAGGGG - Intergenic
1119130790 14:72171097-72171119 ATGTGTGTAATTAAAGAAAAGGG - Intronic
1120886738 14:89457680-89457702 GATTGTATGATTAATGAAAATGG - Intronic
1122558636 14:102594986-102595008 TTGGATGTGACTAAGGAAAAGGG + Intronic
1125207206 15:37167320-37167342 TTGTGAATGATTAAACAATAAGG + Intergenic
1126500705 15:49340936-49340958 TTGTATATGATGAAAGGAAAGGG + Intronic
1126834488 15:52645971-52645993 TTGTGTAGGATTAATGAAGCTGG - Intronic
1128357479 15:66938239-66938261 TTGTGTAGGAGTGAGGAATACGG - Intergenic
1128485609 15:68084193-68084215 TTGTTTTTGATTTAGGAGAATGG + Intronic
1131652824 15:94420705-94420727 TTGTGGATGAGTCAGGAAAGTGG + Intronic
1132734851 16:1380137-1380159 AAGTGTAAGATGAAGGAAAATGG + Intronic
1133422808 16:5661567-5661589 TTGTATATGTTTAAGGTATACGG + Intergenic
1134377618 16:13692572-13692594 TTGTGTATGGTGAAAGAAAGGGG - Intergenic
1137513670 16:49124010-49124032 ATGTGCATGATTCAGGAAAAAGG + Intergenic
1137957431 16:52846334-52846356 TTGTGTATGATGAAAGATAGAGG + Intergenic
1137964489 16:52916984-52917006 TTTTGAATGGTTATGGAAAATGG - Intergenic
1138218372 16:55226091-55226113 TTGTGTATGATTCTGTGAAAAGG + Intergenic
1138719262 16:59059793-59059815 TGCTGTGTGATTAAGGTAAATGG + Intergenic
1138728541 16:59167970-59167992 TTCTGTATCACTAAGGAAATGGG + Intergenic
1138857965 16:60718497-60718519 ATGTGTATGTTTGATGAAAAAGG + Intergenic
1138901730 16:61278793-61278815 TCATGTAGGATTCAGGAAAAGGG - Intergenic
1139168165 16:64595845-64595867 ATTTGTATGGTTAAGAAAAATGG - Intergenic
1139724398 16:68885022-68885044 ATGTGTATGTTGGAGGAAAATGG + Intronic
1140787880 16:78361441-78361463 ATGTGAAAGTTTAAGGAAAACGG - Intronic
1143442108 17:6983014-6983036 TAGTGGATGATAAAGGAATATGG - Intronic
1144390363 17:14787886-14787908 TTTTGTATGTATAAGAAAAATGG - Intergenic
1144457316 17:15429893-15429915 TTGTCTATGATCAAGAAAAGAGG + Intergenic
1144557044 17:16291334-16291356 TTTTGTATTTTTAATGAAAATGG - Intronic
1145001935 17:19311613-19311635 CTGTGTATGCTTCCGGAAAATGG - Intronic
1146238926 17:31196710-31196732 TTGTATATGATGTAAGAAAAGGG + Intronic
1146363584 17:32199810-32199832 TTTTGTTTGATTAAGGGAATTGG + Intronic
1147798435 17:43063226-43063248 TTGTGCATTGTTAAGGAAAGTGG + Intronic
1148448230 17:47754552-47754574 TAGTGCATGATTAAGCAACATGG - Intergenic
1149519191 17:57305365-57305387 GTGTGTGTTACTAAGGAAAAAGG - Intronic
1150999766 17:70361357-70361379 TTGTGTATAATTAAGAGAATTGG - Intergenic
1154930305 18:20987859-20987881 TTGTGTTTGATTAAACAGAAGGG - Intronic
1155275995 18:24187963-24187985 TTGTGTACAATAAAGGGAAATGG - Intronic
1156194331 18:34756762-34756784 TTCTTTATGAATAAGAAAAATGG - Intronic
1156740970 18:40327321-40327343 TTGTGTAAAATAAAGGAAGAAGG - Intergenic
1157577657 18:48754471-48754493 TTGTGCAGGAAGAAGGAAAAGGG + Intronic
1158066315 18:53413664-53413686 ATGTATATGATTAAAGATAAAGG + Intronic
1158071862 18:53479911-53479933 TTATGAATGACTAAGGCAAATGG + Intronic
1158272948 18:55736329-55736351 TTGTGTCTGAGCAAGCAAAATGG - Intergenic
1159276455 18:66228127-66228149 TTGTGTAAGATTGTTGAAAAGGG - Intergenic
1159390023 18:67779646-67779668 GTGTGTATGAATAAGGCAAGAGG + Intergenic
1159432381 18:68369909-68369931 TTGTGTATGATGTAAGAAAGGGG - Intergenic
1159750204 18:72291637-72291659 GTGTGTGTGTTTAAGGAAAATGG - Intergenic
1159932005 18:74322377-74322399 TTAGGCATGAATAAGGAAAATGG - Intronic
1160002323 18:75037349-75037371 GGGTGTGTGATTAAGAAAAAGGG - Intronic
1160301969 18:77690193-77690215 TGGTGTCTGAATAAGGAGAACGG - Intergenic
1166613150 19:44218110-44218132 ATGTGTATGAAAAAGGAACATGG - Intronic
1166924181 19:46254679-46254701 TTGTGTATGGTTAGAGATAAGGG - Intergenic
1168479387 19:56706228-56706250 TTGTGTATTATAAGTGAAAAAGG + Intergenic
924959708 2:23281-23303 TTGTGTATGGTCTAAGAAAAAGG + Intergenic
925583767 2:5442004-5442026 TTGGGGTTTATTAAGGAAAATGG - Intergenic
925889371 2:8421309-8421331 TTGTGTAAAATTGAGGGAAAGGG - Intergenic
926497907 2:13614676-13614698 TTGTGTATGTTTAGAGATAAGGG + Intergenic
926521036 2:13913780-13913802 TTGTTTCTGAATAATGAAAATGG - Intergenic
927220096 2:20698891-20698913 TTTTATATGCTTGAGGAAAATGG - Intronic
928790432 2:34944973-34944995 TTGTTTAGGTATAAGGAAAAAGG + Intergenic
928791946 2:34967973-34967995 TTATATATGAATAAAGAAAATGG - Intergenic
929526465 2:42707581-42707603 TTGTGTATGTTTCTGGAAATAGG - Intronic
930372357 2:50518454-50518476 TTGTGTAGTGTTAAAGAAAAGGG + Intronic
930794350 2:55372094-55372116 TCGTGTATGTTTCAGGAGAAGGG - Intronic
931036881 2:58253730-58253752 TTGTTTAAGAAAAAGGAAAAAGG + Intergenic
931049388 2:58393607-58393629 TTTTGTATGGTTAAGAAAGATGG + Intergenic
932652841 2:73578659-73578681 TTGTGTATTATTAAAGTTAAGGG - Intronic
932743859 2:74314820-74314842 CTGTGGATGAGTCAGGAAAAGGG + Intronic
933429517 2:82157698-82157720 TTGGGTATATTTAAGGAACATGG - Intergenic
933694489 2:85207381-85207403 CTGTGTATGATTAGGGAATCAGG - Intronic
935004669 2:99060894-99060916 TTGTGTATGATGTAAGATAAGGG - Intronic
935500946 2:103837755-103837777 TTGTCTATGTTTCAGGTAAAAGG - Intergenic
935604855 2:104960394-104960416 TTGTGTATGGTATAAGAAAAGGG + Intergenic
936735503 2:115437665-115437687 TAGTCCATGATTAAGGTAAAGGG - Intronic
936857521 2:116978142-116978164 TTGTGTGTGTGTAAGGACAAGGG + Intergenic
938146878 2:128841874-128841896 TTTTGTATGAGTGAGGAAAGAGG + Intergenic
938750449 2:134323585-134323607 TCCTTTATGATGAAGGAAAACGG + Intronic
939782828 2:146470397-146470419 TTGTGTATTATCAAGGACAGAGG + Intergenic
941710011 2:168702045-168702067 GTGTGTCTGAATAAGAAAAATGG - Intronic
943803274 2:192089248-192089270 TTGGGTGGGATTGAGGAAAAAGG - Intronic
944118634 2:196216171-196216193 CTGTGCATGATAAAGGGAAAGGG + Intronic
944499327 2:200342077-200342099 TTTTGCATGATTTAGAAAAAAGG - Intronic
945343769 2:208688288-208688310 TTGTGTATGATGTAAGGAAAGGG + Intronic
946547792 2:220764517-220764539 ATGTTCATGATTAAGGAAAGAGG - Intergenic
947064236 2:226202565-226202587 TTTTGTATGCTGAAGTAAAATGG + Intergenic
947336238 2:229087659-229087681 ATGTGTGTGTTTAAGGAGAAAGG - Intronic
947468313 2:230374402-230374424 TTATGGATGATTAAAGAAAGTGG + Intronic
1169831176 20:9827150-9827172 TTGTGTGTTTTTAAAGAAAATGG + Intronic
1170687370 20:18581634-18581656 GTGTGTATCAAAAAGGAAAATGG + Intronic
1171360448 20:24583134-24583156 TTGTGTTTAATTAACAAAAATGG + Intronic
1171362603 20:24598808-24598830 TTGCGTATGATGAAAGATAAAGG - Intronic
1171435136 20:25116390-25116412 TTGTGTGTTATTGAGGAGAAGGG - Intergenic
1173033436 20:39383760-39383782 ATGGGTCTGATTAGGGAAAATGG + Intergenic
1177074420 21:16554188-16554210 TTTTATATGATTAAACAAAATGG + Intergenic
1177454687 21:21321589-21321611 TTGTGTATGATGAAAGATAGTGG + Intronic
1178577930 21:33811673-33811695 TTGTATAAGATTAATGAAAGTGG - Intronic
1178734959 21:35140901-35140923 TTATTTATGATCAAGGAGAACGG + Intronic
1178802792 21:35811634-35811656 TTATGGCTGGTTAAGGAAAAAGG + Intronic
1180567558 22:16687407-16687429 TTGTGTATGATATAAGATAAGGG - Intergenic
1181916787 22:26287841-26287863 TTGTGTATGATTAAGGAAAAGGG + Intronic
1182408943 22:30165100-30165122 TTGTGTATGATCTAAGATAAAGG + Intronic
1182817986 22:33184472-33184494 TTTTGTATTAATAAGAAAAATGG + Intronic
1184876582 22:47279666-47279688 TTGTGAATTATTTAGGACAAGGG + Intergenic
949391836 3:3571156-3571178 TTATGAATGATCAAGGAAAGTGG + Intergenic
949676271 3:6457186-6457208 TTGAATATAATTAAGTAAAAAGG - Intergenic
950279618 3:11695509-11695531 ATGTGCATGATGAAGGAAATAGG + Intronic
951462506 3:22966631-22966653 TTGTCCATGATTAAAGAAAGTGG + Intergenic
951564161 3:23996154-23996176 AAGCGTATGATCAAGGAAAATGG - Intergenic
951667215 3:25140526-25140548 TTGTGGATGACCAAAGAAAATGG + Intergenic
951966702 3:28394727-28394749 TTGTGTATGATGTAAGATAATGG - Intronic
953293013 3:41685278-41685300 TTCTTTATGCTTAAGGAGAAAGG - Intronic
953349621 3:42205613-42205635 TTGGTTATGATTAAGCAGAAAGG - Intronic
953813979 3:46138568-46138590 TTGTGCATAACTAAGGAAACTGG - Intergenic
953831901 3:46306217-46306239 TTTTTTATGATAAAAGAAAAAGG + Intergenic
953893754 3:46777645-46777667 TTGTATATGATTTAAGATAAAGG - Intronic
955127589 3:56129111-56129133 TTTTGTCTTATTAAGAAAAAGGG - Intronic
956798617 3:72737930-72737952 TTGTGTCACATTAAGAAAAAGGG - Intergenic
957295884 3:78331727-78331749 TTGTGATTTATAAAGGAAAAAGG + Intergenic
959481507 3:106878310-106878332 TTGTATATGGTGAAAGAAAAGGG + Intergenic
959647312 3:108717825-108717847 TTGTGGATGTGTAAGGAAATGGG - Intergenic
959971250 3:112412777-112412799 TTGTGTATGATGAAAGATAAGGG + Intergenic
960834593 3:121892806-121892828 AAATGTATAATTAAGGAAAATGG + Intergenic
961967452 3:130920351-130920373 TTGTGTATGGTGTAAGAAAAGGG + Intronic
962100588 3:132338172-132338194 TTGTATATGCATAAGGAAATTGG - Intronic
962461241 3:135615253-135615275 TTGTGGATGAGCAAAGAAAATGG - Intergenic
962503843 3:136025985-136026007 TTGCCCATGATTTAGGAAAAAGG - Intronic
962586599 3:136848291-136848313 TAGTGTTTGATTAAGTAAATTGG + Intronic
964556978 3:157950539-157950561 TTGTGAATGCTTTAGGCAAATGG - Intergenic
964924577 3:161939738-161939760 ATGTGTAGCATTAAGAAAAAGGG - Intergenic
965338280 3:167455132-167455154 TAGAGGAGGATTAAGGAAAAGGG - Intronic
965828781 3:172758763-172758785 TTGCATATGATTAAGGAATCGGG + Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
968450358 4:673239-673261 TTGTGCAGGGATAAGGAAAATGG - Intronic
970340737 4:15103912-15103934 TTGTTTTTGATTAAGGAGGAAGG + Intergenic
970565510 4:17328421-17328443 TTGTAAAAGATTAAGGCAAAAGG + Intergenic
970686033 4:18568465-18568487 TGGTGTCTGATGAAGGAATAGGG + Intergenic
971677516 4:29652682-29652704 TTGTGTATGATGAAAGATAGAGG - Intergenic
972256605 4:37362637-37362659 TTGTGTATGGTGAAGGATAGGGG - Intronic
972663170 4:41137105-41137127 TTGTATATGTTTTATGAAAATGG - Intronic
974315573 4:60275390-60275412 TTGTGTATGATATAAGAGAATGG + Intergenic
974323243 4:60379774-60379796 TTGTGGATGTTTAAGGGAATGGG - Intergenic
974663891 4:64932841-64932863 TTGTATTTGATTAATGTAAATGG + Intergenic
975916340 4:79330220-79330242 TTGTTTATGATTATAGACAATGG - Intergenic
976874895 4:89841061-89841083 TTATGTATGATTTTGGAAAGGGG + Intergenic
976962793 4:90999958-90999980 TTGTGTATGGTGAAAGGAAAGGG + Intronic
979379384 4:119991284-119991306 TTGTGTATGGTGAGAGAAAAAGG - Intergenic
979962862 4:127041856-127041878 TTGTATATGATGAAAGATAAGGG - Intergenic
980117543 4:128693840-128693862 TTGTGTATGGTGTAAGAAAACGG - Intergenic
980124171 4:128757721-128757743 CTGTGTAAGATTTGGGAAAAGGG - Intergenic
981825381 4:148934749-148934771 TTGTGTATAGTTAAGGGAAATGG - Intergenic
983320095 4:166185699-166185721 TGATGTATGATTTAGGGAAAGGG + Intergenic
983395585 4:167190785-167190807 TTGTGTATGATATAAGATAAGGG + Intronic
983733463 4:171028167-171028189 TTGTGTATGTTCAAGGAAATAGG + Intergenic
984176188 4:176420330-176420352 TTGTGTATGATGTAAGATAAGGG + Intergenic
984408752 4:179368705-179368727 TTGTATGTGATTAAAAAAAAAGG + Intergenic
984529820 4:180902351-180902373 TTCTGTATGTTTAAGGAGAGGGG - Intergenic
984571119 4:181395590-181395612 TTTTGGAAGATTAAGTAAAATGG - Intergenic
985116060 4:186592271-186592293 CTGAGTATGATCAAAGAAAAGGG - Intronic
985176632 4:187209468-187209490 TGCTGTTTGATTAAAGAAAAAGG - Intergenic
985364723 4:189216370-189216392 TTGTGTTTGAATAAGTAAATGGG - Intergenic
987129104 5:14844004-14844026 TTGTGGATGATGCAGGAACACGG - Intronic
987824783 5:23016507-23016529 TTTTATATGCTTAAAGAAAAAGG - Intergenic
987903272 5:24041447-24041469 TTGTGTATGATGTATGATAAAGG - Intronic
988389403 5:30607916-30607938 TATTGTATGATTGGGGAAAAGGG + Intergenic
988574897 5:32412142-32412164 TTGTTCATTATAAAGGAAAAAGG + Intronic
988813383 5:34806849-34806871 TTGTGTATGAGTAAGAATACAGG + Intronic
988888986 5:35593814-35593836 TTGTGGATGAGCAAAGAAAATGG - Intergenic
989729185 5:44627487-44627509 TTCTGTATTATTTTGGAAAATGG - Intergenic
990769364 5:59225173-59225195 TTGTGTATGATTTAAGATAAAGG + Intronic
990839169 5:60056369-60056391 ATGTGAATGATGAAGGAAGACGG + Intronic
992582632 5:78196920-78196942 TTGTGTATGATAAAACACAATGG + Intronic
993044880 5:82855678-82855700 AAGTGTAGTATTAAGGAAAATGG - Intergenic
993443487 5:87983346-87983368 TTGAAAATGATTAAGGAAAGAGG - Intergenic
993661849 5:90647291-90647313 TTTTGTAGGATTAAGGCAAGAGG + Intronic
993944843 5:94105951-94105973 TTGTGTATGGTAAAAGGAAAGGG - Intronic
994479407 5:100314650-100314672 TTGTATATGGTTAATAAAAAGGG - Intergenic
994994364 5:107041039-107041061 TTGTTTATGATTCAGGAAATGGG - Intergenic
995284946 5:110377510-110377532 TTGTGTGTGTTTGGGGAAAACGG - Intronic
997833808 5:137176221-137176243 ATTTGTGTGATTAAGGAACACGG - Intronic
998267676 5:140678291-140678313 TTCTGGATGAATAGGGAAAATGG - Intronic
1000419096 5:161016773-161016795 TTGTGTATGATATAAGATAAAGG + Intergenic
1001778655 5:174348543-174348565 TTGTGTATCATTGTGGGAAATGG - Intergenic
1002969814 6:2003613-2003635 TACTTTATGATTAAGGAAATTGG - Intronic
1003047288 6:2745180-2745202 TTGTGTTTCATTAAGCAAAGGGG + Intronic
1004841637 6:19592878-19592900 GTGTGTATGTTTAAGAAACATGG - Intergenic
1005148189 6:22716854-22716876 TTGAGTATGAGACAGGAAAATGG - Intergenic
1005365523 6:25072575-25072597 TTATGGATGAACAAGGAAAATGG - Intergenic
1005774331 6:29114223-29114245 TTGGGTAAGGTTAAGGACAAGGG - Intergenic
1005780226 6:29183833-29183855 TTGGGTAAGCTTAAGGACAAGGG - Intergenic
1007255808 6:40527655-40527677 ATGTGAGTGATTAAGGAGAAAGG + Intronic
1007289139 6:40771819-40771841 CTCTGTATCATGAAGGAAAAAGG - Intergenic
1008293496 6:49748542-49748564 ATGTCTCTGTTTAAGGAAAAGGG + Intergenic
1009673971 6:66792950-66792972 TTGTGTATGGTGAGGGATAAGGG - Intergenic
1009877436 6:69522306-69522328 TTGTATATGATAAAAGGAAAGGG - Intergenic
1010024463 6:71199675-71199697 TTTTGTTTGCTTCAGGAAAAAGG - Intergenic
1010029343 6:71256918-71256940 CTATGTATGAGTAAGGAAGAGGG + Intergenic
1010254020 6:73737754-73737776 TTGTGTGGGAGTAGGGAAAATGG + Intronic
1010859068 6:80882577-80882599 TTGTGTAAAATTAAATAAAATGG - Intergenic
1011145667 6:84213257-84213279 TTGTGTATATTTAAGAAATAGGG - Intronic
1011181079 6:84621769-84621791 TTGTATATGATGAGGGAGAAGGG - Intergenic
1011792506 6:90913992-90914014 TTGAGTATTAATAAGTAAAAGGG - Intergenic
1011818395 6:91220976-91220998 ATGTATGTGATTAGGGAAAATGG - Intergenic
1012059215 6:94456195-94456217 TTGTCTATCATTAAGAAACACGG - Intergenic
1012782946 6:103586259-103586281 TTGTGTATGGTTAGAGATAAGGG + Intergenic
1013601564 6:111709982-111710004 CTGTATGTGTTTAAGGAAAATGG + Intronic
1013914706 6:115321500-115321522 CTGTATATGATTCAGAAAAAGGG - Intergenic
1014052672 6:116974099-116974121 TTGTGTGCGCTTAAGCAAAATGG - Intergenic
1014072432 6:117198557-117198579 TTTTGTATGAGTAAGAAAATAGG - Intergenic
1014418202 6:121210027-121210049 TTGTGTATATTAAAGGAAAAGGG + Intronic
1014488103 6:122025913-122025935 TTGTATTTGTTTAAGGAAATTGG + Intergenic
1014606394 6:123478506-123478528 TTGCGTATAGGTAAGGAAAATGG + Intronic
1015158241 6:130122620-130122642 ATGTTTCTGATTATGGAAAAAGG + Intronic
1016246061 6:141982421-141982443 TTGTGTAGAATTAAGGAACTTGG - Intergenic
1016339136 6:143042323-143042345 TCCTGTATGATTAAGGGAGAAGG + Intergenic
1018518071 6:164610070-164610092 GTGTCTATGTTTCAGGAAAATGG - Intergenic
1019077842 6:169404501-169404523 TTGTTTATGAATAAATAAAAAGG - Intergenic
1020464920 7:8466616-8466638 TAGTATATCATTAAGGAAGATGG + Intronic
1020572423 7:9882546-9882568 TTGTGTAAGATTAATTATAAAGG + Intergenic
1021284042 7:18757348-18757370 TTGAAAATGATTAAAGAAAATGG + Intronic
1022335303 7:29416121-29416143 AAGTGTATGTTTAAGGAAAATGG - Intronic
1022647299 7:32243198-32243220 TGGTTTATTATTTAGGAAAATGG + Intronic
1023335311 7:39163069-39163091 TTGTCTTTGATTAAGAGAAAGGG - Intronic
1023776046 7:43608492-43608514 TTGTGTATTATTAGGTAACAAGG + Intronic
1024216176 7:47250599-47250621 TTGTGTATGATAAGAAAAAAGGG - Intergenic
1025061017 7:55808203-55808225 TTGTGTTTGTTTGAGAAAAATGG - Intronic
1027719058 7:81715233-81715255 TGGTGTAGGAAGAAGGAAAAAGG - Intronic
1027795181 7:82683843-82683865 TTAAGTATGCTTAAGGAGAAAGG - Intergenic
1027801979 7:82765744-82765766 TTGTTTATGATTATTTAAAATGG - Intronic
1027821146 7:83046301-83046323 TGGTGAAATATTAAGGAAAATGG - Intronic
1028177612 7:87675726-87675748 TTGTGTATGATATAAGAGAAAGG - Intronic
1028223345 7:88221370-88221392 TTGTGTTTGATTCAGGAAGCAGG + Intronic
1028364925 7:90017475-90017497 ATGCATATCATTAAGGAAAAAGG - Intergenic
1028730701 7:94145197-94145219 TTGATAAAGATTAAGGAAAAAGG - Intergenic
1031199765 7:118666270-118666292 GTGTGTATGCACAAGGAAAAAGG + Intergenic
1032927990 7:136630775-136630797 TTATGGATGATGAAGGAATATGG - Intergenic
1033073150 7:138223092-138223114 TTTTGTGAGATTTAGGAAAAAGG - Intergenic
1033198073 7:139344119-139344141 TTAAGTATGATGAAGAAAAAAGG + Intronic
1034505882 7:151490550-151490572 TTCTGTAAGAATAAGGAACAGGG + Intronic
1036394363 8:8355744-8355766 TTGTGTATGATATAAGATAAGGG - Intronic
1037386192 8:18344535-18344557 TTGTGTATGATGTAAGATAAAGG - Intergenic
1037665761 8:20968625-20968647 TAGTGTAAGATTCATGAAAACGG - Intergenic
1038235009 8:25744830-25744852 ATGTTTATGATCAAGGAAAAAGG + Intergenic
1039671582 8:39606375-39606397 TTTTTTTTCATTAAGGAAAAGGG + Intronic
1040750939 8:50706595-50706617 TTGTGAATGGGTAAGGAAATAGG - Intronic
1040791800 8:51239026-51239048 TTGAATATTATGAAGGAAAATGG + Intergenic
1041190580 8:55350082-55350104 TTGTATATTGTTAAGGCAAAAGG - Intronic
1041523244 8:58777389-58777411 TTGTATATGATGTAAGAAAAGGG - Intergenic
1041718978 8:60959306-60959328 TTTTGTCTCATTAAGGAACAAGG + Intergenic
1041878349 8:62716199-62716221 TTGTGTATCATTGACAAAAAAGG - Intronic
1042321695 8:67482315-67482337 GTGTTTATGAGTATGGAAAATGG + Intronic
1042808480 8:72798008-72798030 TTGTATATGAAGAAGGGAAATGG - Intronic
1043864496 8:85359899-85359921 TTGTGTATGATTTACCAATAAGG + Intronic
1043944670 8:86236082-86236104 TTGTGAATGAGCAAAGAAAATGG - Intronic
1043981052 8:86639997-86640019 CTGTGAGTGATTAAGAAAAATGG + Intronic
1044737246 8:95291666-95291688 TTGTGTATGATAGAGGATAATGG + Intergenic
1045329122 8:101140340-101140362 TTGTGTTTCATTATGGGAAAGGG + Intergenic
1045441689 8:102219730-102219752 TTATATATGTCTAAGGAAAAAGG + Intronic
1047425029 8:124737334-124737356 TTATGTAGGGTTAGGGAAAAGGG - Intergenic
1047690834 8:127352880-127352902 TTATGTATAATTAAGTTAAAAGG - Intergenic
1047792940 8:128223471-128223493 TTGTGGGTGATTAAGGATGATGG - Intergenic
1048045864 8:130772298-130772320 TTATGGATGATTAAAGAAAGTGG - Intergenic
1048063742 8:130947339-130947361 TGCTGTATTATCAAGGAAAATGG - Intronic
1048145504 8:131838083-131838105 TTGTGTATGGTAAAAGGAAAGGG + Intergenic
1048177872 8:132169420-132169442 TTTTCTATGGTTATGGAAAAGGG - Intronic
1048608498 8:135995789-135995811 TTCTGTAACATTAAAGAAAATGG - Intergenic
1048817847 8:138350745-138350767 TAATGTATGAATAAGGAAACAGG - Intronic
1050375392 9:4967209-4967231 CTGAGAATGGTTAAGGAAAAGGG + Intergenic
1050582573 9:7075963-7075985 TTTTCTATGACTGAGGAAAAGGG - Intronic
1052005673 9:23345584-23345606 TTGTGTATGGTGAAGGGTAAGGG - Intergenic
1052257501 9:26475604-26475626 TTGAGTAAGATTTAGGCAAATGG - Intergenic
1052539239 9:29786710-29786732 TTGTATATGATGAAAGACAAGGG - Intergenic
1054748637 9:68881745-68881767 TTGTCTAGGAATAAGGAAGAAGG - Intronic
1055231212 9:74067955-74067977 TTGTGTTTGAGTAAGTGAAATGG - Intergenic
1055296939 9:74843151-74843173 TTATGGATGAATAAAGAAAATGG - Intronic
1056288913 9:85121122-85121144 TTGTGAATGGTTAAACAAAATGG + Intergenic
1058823764 9:108756580-108756602 TTGTATATGATTATGAAAACAGG - Intergenic
1059095755 9:111412323-111412345 TTGTGTATCTTTGACGAAAATGG - Intronic
1059924274 9:119192070-119192092 TTGTGTATGATGTAAGATAAGGG - Intronic
1062089137 9:134665502-134665524 TTGTCTATGATTATTGAAAAGGG + Intronic
1062219418 9:135406527-135406549 TTGTGTATCATTAATAAAATGGG + Intergenic
1186188790 X:7048637-7048659 TTTTGTATGAATAAGACAAATGG - Intergenic
1186642879 X:11474530-11474552 TTCTGTATGACTAAGAAAAAGGG - Intronic
1187805808 X:23119199-23119221 TCCTGTTTCATTAAGGAAAAGGG - Intergenic
1188360280 X:29244810-29244832 TAGAGTATGATTAAAAAAAAAGG - Intronic
1188795800 X:34462908-34462930 TTGTGTATGGTCTAAGAAAAGGG + Intergenic
1191167753 X:57407822-57407844 TTGTGTATGGTTTAAGATAAGGG + Intronic
1191641346 X:63431917-63431939 TTGAGGCTGATGAAGGAAAATGG + Intergenic
1191661050 X:63651045-63651067 TTCTGTATGCTTCAGGAAAATGG - Intronic
1192600763 X:72461418-72461440 TCTTGTATGACTAAAGAAAATGG + Intronic
1193141055 X:78027346-78027368 TTGTGTGTGATTATTGTAAATGG - Intronic
1193456646 X:81739342-81739364 TTGTGTATTATGTAAGAAAAGGG + Intergenic
1193483090 X:82051729-82051751 TTGTGTATGATGTAAGGAAAGGG - Intergenic
1193506805 X:82354361-82354383 TTGTATATAATAAAAGAAAAGGG - Intergenic
1193616977 X:83700939-83700961 TTGTATATGATTAAGAAAGGAGG + Intergenic
1193680103 X:84508365-84508387 GTGTGTATGATTCTGGAGAAAGG - Intergenic
1193880322 X:86913071-86913093 TTGTGTATGATGAAAGGAAAAGG + Intergenic
1193985189 X:88232528-88232550 TTGTGTATGGTAAAAGATAAGGG - Intergenic
1194440788 X:93931273-93931295 ATGTGTATGATTTCAGAAAATGG - Intergenic
1194611249 X:96048778-96048800 TAGTTTTTGCTTAAGGAAAAGGG + Intergenic
1194787846 X:98108369-98108391 ATGTGTAAGTCTAAGGAAAAGGG + Intergenic
1195164482 X:102205476-102205498 TTGTGTATGATGTAAGAGAAGGG + Intergenic
1195194377 X:102481619-102481641 TTGTGTATGATGTAAGAGAAGGG - Intergenic
1196248902 X:113434743-113434765 TTGAATATGATTAGAGAAAAGGG - Intergenic
1196570411 X:117260351-117260373 TTGTTAAAGATTTAGGAAAAGGG - Intergenic
1197950143 X:131886060-131886082 TTGTGTATGATAAAAGGAAGGGG + Intergenic
1198109544 X:133490839-133490861 TTGTATATGATGAAAGATAAGGG + Intergenic
1198629867 X:138624392-138624414 TTGTGTATGGTATAGGATAAAGG - Intergenic
1199093408 X:143715619-143715641 TTGAGACTGATGAAGGAAAATGG - Intronic
1199214924 X:145252547-145252569 TTGAGACTGATGAAGGAAAATGG + Intronic
1199547713 X:149024465-149024487 TTGTGTATGGTTAGAGATAAGGG + Intergenic
1199840259 X:151639270-151639292 ATAAGTATGATTAAGGAAAAGGG - Intronic