ID: 1181917332

View in Genome Browser
Species Human (GRCh38)
Location 22:26291863-26291885
Sequence ATATGTACTGGGAAGGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 292}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181917332_1181917340 -6 Left 1181917332 22:26291863-26291885 CCATCCCCCTTCCCAGTACATAT 0: 1
1: 0
2: 4
3: 24
4: 292
Right 1181917340 22:26291880-26291902 ACATATACAACCAGGCAGTGAGG 0: 1
1: 0
2: 1
3: 14
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181917332 Original CRISPR ATATGTACTGGGAAGGGGGA TGG (reversed) Intronic
900785098 1:4644396-4644418 ATGTGTCCTGAGAAGGGGGGTGG + Intergenic
900785126 1:4644474-4644496 ACGTGTCCTGGGAAGGGGGGTGG + Intergenic
901612994 1:10513801-10513823 ATATTGACTGGGAAAGGGAAAGG + Intronic
901875276 1:12163930-12163952 AAATGTGCTGGGGAGGGAGAGGG + Intergenic
902257149 1:15197282-15197304 ATATGGACTGAGAATGGGGAGGG + Intronic
905826650 1:41030664-41030686 ATATGTACTGTGTGGGGGTAGGG - Intronic
908199364 1:61778532-61778554 ATATATAGTTGGAAAGGGGAGGG - Intronic
909452833 1:75817831-75817853 ATATCAACTGGCTAGGGGGAGGG - Intronic
909750449 1:79153681-79153703 AGATGATCTGTGAAGGGGGAGGG + Intergenic
912058935 1:105640432-105640454 AGATATACTAGGAAGGAGGATGG - Intergenic
912061546 1:105677895-105677917 AAATGTATTGGGAGGAGGGAAGG - Intergenic
912330456 1:108815640-108815662 ATATGTACAGGGAAGGGCACTGG - Intergenic
912658039 1:111505208-111505230 CTATGTACTGGGGTAGGGGAGGG - Intronic
915360468 1:155283554-155283576 ATATATAATGGGTGGGGGGAGGG - Intronic
919315137 1:195962848-195962870 ACATGGACTGGGAAGGGGTTGGG + Intergenic
919466608 1:197927829-197927851 ATTTTTACTGGGAAGGGGAAGGG - Intronic
919989689 1:202700804-202700826 ATATGTAACTGGAAAGGGGAGGG + Intronic
920315078 1:205071114-205071136 ACAGGTTCTGGGAAGGGGCATGG + Intronic
921474202 1:215586352-215586374 ATTTGTAATAGGAAGGTGGATGG + Intronic
921838213 1:219800033-219800055 ATATGTAGAGGGAAAGTGGAAGG - Intronic
922307166 1:224354080-224354102 ATAAGTACTTGGAAGGGGATGGG - Intergenic
923939809 1:238809376-238809398 TTATGGACTGGGAATGGGGAGGG + Intergenic
923963345 1:239107641-239107663 AGATGTTCAGGGAAGGGGCAAGG + Intergenic
924188618 1:241523666-241523688 ATATGTCCTGGAAATGAGGAGGG - Intergenic
924244486 1:242070411-242070433 CCATGGACTGGGCAGGGGGATGG + Intergenic
924821753 1:247498744-247498766 CCATGGACTGGGCAGGGGGACGG + Intergenic
1065493178 10:26303265-26303287 AGGAGTACTGGGAAGGGGTAGGG - Exonic
1067267494 10:44758124-44758146 AAAAGGACTGGGCAGGGGGACGG - Intergenic
1068345398 10:55771451-55771473 ACAGGTACTGGGATGGGAGACGG - Intergenic
1068432642 10:56952352-56952374 AGATGTTCTGGGAAGGAGCATGG + Intergenic
1071191627 10:83108329-83108351 AGTTGAACTGGTAAGGGGGAGGG + Intergenic
1071913157 10:90258516-90258538 ATATGGAATGGGAAGGAGAAGGG + Intergenic
1072337617 10:94412887-94412909 AAAATTACTTGGAAGGGGGAGGG + Intronic
1072828440 10:98632366-98632388 ATAACAACTGGGAAGGGAGAGGG - Intronic
1072893375 10:99344849-99344871 CTTTGAACTGGGAAGGGGAAAGG - Intronic
1073747997 10:106492313-106492335 ACAGGTACTAGGAAGGGGTATGG + Intergenic
1075428439 10:122361039-122361061 ACAGGCACTGGGAAGAGGGAGGG + Intergenic
1076002530 10:126923729-126923751 GTATGAAGTGGGGAGGGGGAGGG - Intronic
1083784181 11:64934336-64934358 TTATTTATTGGGCAGGGGGAGGG + Exonic
1084751066 11:71204790-71204812 ACAAGTCCTGGGAAGGGGGCAGG + Intronic
1085199179 11:74691409-74691431 AGACTTACTGGGAATGGGGAGGG + Intergenic
1085204000 11:74719365-74719387 GTGTGTACAGGGGAGGGGGATGG - Intronic
1085778063 11:79383693-79383715 ATATATAGTGGGGAGTGGGAGGG - Intronic
1086144849 11:83540433-83540455 ATAGGCACTGGCATGGGGGAGGG + Intronic
1086796130 11:91104968-91104990 ATATTTATTGGGAAAGGGAAGGG + Intergenic
1086937453 11:92760461-92760483 ATATGTACTTGGAGGCTGGAAGG - Intronic
1087701810 11:101443613-101443635 GTATGTATTTGGAAGGGGGTGGG - Intergenic
1087828169 11:102789731-102789753 ATATAAACTGGGGTGGGGGAGGG - Intergenic
1088344545 11:108807902-108807924 ATAGTTACTGGCAAGGTGGAAGG + Intronic
1089548141 11:119246395-119246417 ATATGTAGTTGGAAAGGGGGAGG + Intronic
1091113419 11:132992788-132992810 GAATGTACTGGGGAAGGGGAGGG - Intronic
1091906492 12:4193717-4193739 TTCTCTCCTGGGAAGGGGGAGGG - Intergenic
1092613072 12:10191823-10191845 ATATGTTCTGGGTAGAGGTAAGG + Intergenic
1092884636 12:12914354-12914376 CTTTGTACTGAAAAGGGGGAAGG + Exonic
1094418454 12:30243082-30243104 ATATGTAGTTGGAAATGGGAGGG - Intergenic
1098695378 12:73547010-73547032 ATATGTACTTGGAATGTGCATGG - Intergenic
1098751894 12:74303732-74303754 ATTTGTACAGTGAAAGGGGAGGG - Intergenic
1099983447 12:89634164-89634186 ATATGTTCTGGGATTGGAGAAGG - Intronic
1100449337 12:94690453-94690475 ATATTTACAGGGGAGGGTGAGGG - Intergenic
1104597931 12:130132653-130132675 CCATGTTCTGGGAAGGAGGAAGG - Intergenic
1104856709 12:131905559-131905581 ATGTGTACAGGGCAGAGGGAGGG + Intronic
1106265620 13:28107025-28107047 ATATGAAATGGGAAGGTTGAGGG + Intergenic
1107127542 13:36861272-36861294 ATATCTACTGGGTAGGGGAATGG + Intronic
1112568664 13:100573302-100573324 ATATTTCATGGGATGGGGGAAGG - Intronic
1112912995 13:104511751-104511773 ATAGGTCAGGGGAAGGGGGAGGG - Intergenic
1114045650 14:18873300-18873322 ATATGTACTGGGAGGGGCCAAGG - Intergenic
1114118561 14:19646168-19646190 ATATGTACTGGGAGGGGCCAAGG + Intergenic
1114755248 14:25252574-25252596 ACATGTACCAGGAAGGTGGATGG + Intergenic
1119222598 14:72921081-72921103 ATCTGTATTGGGTAGGGGGTGGG + Intergenic
1119692403 14:76685848-76685870 ATATGTGGGGGGAGGGGGGAAGG + Intergenic
1120097534 14:80404946-80404968 ATATATACTGGGTGGGGGAATGG - Intergenic
1121210669 14:92206159-92206181 AGATGGACTGGGAGGGGAGAGGG - Intergenic
1121587284 14:95070883-95070905 TAATGTCCGGGGAAGGGGGAGGG + Intergenic
1124597032 15:31099993-31100015 ATAGGAACTGAGAATGGGGAAGG - Intronic
1125327335 15:38549225-38549247 TCATGAACTGGGAAGGAGGAAGG + Intronic
1126573812 15:50178859-50178881 AAATATACTGTGATGGGGGAGGG + Intronic
1127155257 15:56117629-56117651 CTAGGTGCTGGGAAAGGGGATGG - Intronic
1127625757 15:60778690-60778712 CTTTGAACTGGGAAGGGGTAAGG - Intronic
1127678708 15:61271573-61271595 GTATGTGCTGGGAATGGGGCAGG + Intergenic
1127903450 15:63358560-63358582 ATGAGTGCTGGGAAGGCGGATGG - Intronic
1128165071 15:65457015-65457037 AGATTTGCTGGGAAAGGGGATGG - Intronic
1128930177 15:71697268-71697290 TGATGTAATGGAAAGGGGGATGG + Intronic
1129158749 15:73735149-73735171 AGATGTCCTGGGAAGGGTGGGGG - Intergenic
1130546865 15:84863164-84863186 TTATGTATGGGGCAGGGGGAAGG - Intronic
1132789790 16:1678967-1678989 CTATCTCCTGGGAAGGTGGATGG + Intronic
1134165996 16:11929979-11930001 GGATGTACTGAGAATGGGGAAGG - Intronic
1134599803 16:15524421-15524443 AAATGTACTGGGAGGTGGGGAGG + Intronic
1135177422 16:20242893-20242915 ATTTGGACTGGGAATTGGGATGG + Intergenic
1135311386 16:21407400-21407422 GGATGTACTGAGAATGGGGAAGG - Intronic
1135364338 16:21839851-21839873 GGATGTACTGAGAATGGGGAAGG - Intronic
1135447505 16:22531497-22531519 GGATGTACTGAGAATGGGGAAGG + Intronic
1135698455 16:24610702-24610724 AGATGGGCTGGGAAGGGAGAGGG - Intergenic
1135793538 16:25420651-25420673 ACATCTACTGGGAATGGGGCAGG + Intergenic
1135793952 16:25423757-25423779 ACATCTACTGGGAATGGGGTAGG + Intergenic
1136073804 16:27804832-27804854 GCATGTACTGGGATTGGGGACGG + Intronic
1136308091 16:29386396-29386418 GGATGTACTGAGAATGGGGAAGG - Intronic
1136321507 16:29487934-29487956 GGATGTACTGAGAATGGGGAAGG - Intronic
1136436187 16:30227904-30227926 GGATGTACTGAGAATGGGGAAGG - Intronic
1137535044 16:49314413-49314435 ATTGTTACTGGGAAGGTGGAGGG - Intergenic
1138545201 16:57714814-57714836 GTATATACTGGGAAGGAAGAAGG - Intronic
1138653408 16:58474795-58474817 ACATGTACTGAGAATGGGGAAGG + Intronic
1141600016 16:85119988-85120010 AGATGTTCTGGGATGTGGGATGG - Intergenic
1143843091 17:9750322-9750344 ATATGTACTGGGCAGTGGAATGG + Intergenic
1144533706 17:16065886-16065908 AGATGTAATGGAAAAGGGGAAGG + Intronic
1145128277 17:20319735-20319757 ACATGAACTAGGAAGGGGTAAGG - Intergenic
1145408282 17:22630542-22630564 ACAGGTACTGGGAGGGGAGAGGG - Intergenic
1145408516 17:22633240-22633262 ACAAGTACTGGGATGGGAGAGGG - Intergenic
1146395086 17:32458648-32458670 AACTGTACTGGGAATGAGGAAGG - Intronic
1147436718 17:40421027-40421049 ATAGGCTCTGGGAAGAGGGAGGG - Intergenic
1148619609 17:49024457-49024479 ATAGTTACTGGGAGAGGGGAAGG + Intronic
1150727240 17:67661351-67661373 AGAGATTCTGGGAAGGGGGAAGG - Intronic
1151438680 17:74114456-74114478 ATCTGAACTGGGGAGGGGGTGGG + Intergenic
1151851620 17:76694065-76694087 ATAAGTAGATGGAAGGGGGAGGG - Intronic
1151882931 17:76905682-76905704 ATATCTACTGGGTGGAGGGAGGG - Intronic
1155552630 18:26981963-26981985 GGATTTACTGGGAAGTGGGAAGG - Intronic
1155661062 18:28248795-28248817 ATAGGTAATTGGAAGGAGGAGGG + Intergenic
1156906901 18:42363613-42363635 ATCTGAACTGAGAGGGGGGAGGG + Intergenic
1157384518 18:47249804-47249826 ATATCTAATGGCAAGGGTGAGGG - Intergenic
1160658649 19:287979-288001 AGAGGGACTGGGTAGGGGGATGG - Intronic
1160902647 19:1436448-1436470 ATATGAACTGGGGCGGGGGGGGG - Intergenic
1161141207 19:2649054-2649076 TTATGTTCTGGGAAGGGGGAAGG + Intronic
1162760892 19:12887559-12887581 CTGTTTACTGGGGAGGGGGAGGG - Intergenic
1162943940 19:14031307-14031329 GTTTGGACTGGGAAGGGGGCAGG - Intergenic
1164143105 19:22492152-22492174 AGCTGTAGTGGGAAGGTGGAGGG - Intronic
1164229567 19:23275538-23275560 ATGAGTGCTGGAAAGGGGGAGGG + Intergenic
1164299879 19:23952493-23952515 ATTTGTACAGGGAATTGGGAGGG - Intergenic
1164622832 19:29707492-29707514 ATATGTGCTGAGAAGGTGCATGG + Intronic
1165407511 19:35639790-35639812 CTGTGCAGTGGGAAGGGGGACGG + Intergenic
1165637575 19:37355109-37355131 ATATGTACTGAGAAAGGGGAAGG - Intronic
1167551984 19:50167682-50167704 ATGTGTACTAGGGAGGGGGCTGG - Intergenic
1167651417 19:50731812-50731834 GTAGGTACTGGCGAGGGGGATGG - Intergenic
1167823005 19:51946947-51946969 ATTTGGAGTGGGAAGGGGAAAGG + Intronic
925228266 2:2205785-2205807 ATATGTGAAGAGAAGGGGGATGG - Intronic
927333739 2:21896336-21896358 AGATGACCTGGGGAGGGGGAAGG + Intergenic
927373115 2:22380697-22380719 ATATGGAGTGGGAGAGGGGAAGG - Intergenic
927925467 2:27010369-27010391 ATATGGAGTCTGAAGGGGGATGG + Intronic
928312434 2:30221941-30221963 AAATGTGCTGGAAAGAGGGAGGG + Intergenic
929920702 2:46169232-46169254 GTTTGTGCTGGGGAGGGGGATGG + Intronic
931120966 2:59219327-59219349 AGATATACTGGAAAGGGGCAAGG + Intergenic
932572155 2:72943758-72943780 CTCTGGACTGGGAAGGGGGCAGG - Exonic
934113240 2:88761683-88761705 ATATGGAGTGGGGAGGGGGAGGG - Intergenic
934300958 2:91775803-91775825 ACGTGTTCTGGGAAGCGGGAAGG + Intergenic
934679782 2:96275210-96275232 ATTTGTTCTGGCATGGGGGAAGG - Intronic
934733251 2:96672760-96672782 ATCTCTACTTGGAATGGGGATGG + Intergenic
936168612 2:110147298-110147320 ATATGTATTGTGGAGGGGGTAGG - Intronic
938096892 2:128470158-128470180 ACAGTTACTGGGAAGTGGGATGG + Intergenic
938269574 2:129957757-129957779 ATACGTACTGGGAGGGGCCAAGG + Intergenic
938390276 2:130899462-130899484 AGCAGGACTGGGAAGGGGGATGG + Intronic
938735259 2:134180105-134180127 ATATTTTCTGGGAAAGGGGTGGG - Intronic
940664280 2:156588416-156588438 AAATGAACTGGGAATGGGGGTGG - Intronic
941164440 2:162070560-162070582 AAATGTAAAGGGAAGGGGAAGGG - Intronic
942800104 2:179864813-179864835 ATATGTATTTGGAAGGTGAAAGG + Intergenic
944503116 2:200382187-200382209 CCAGGTACTGGGGAGGGGGATGG - Intronic
946370801 2:219280182-219280204 AAATCTAGGGGGAAGGGGGAGGG - Intronic
946496215 2:220198341-220198363 ATGTTTACTGGGGAGGGAGATGG + Intergenic
946624289 2:221594240-221594262 ATGTGTGCTGGGATGGGGGTGGG + Intergenic
947388103 2:229612407-229612429 AGATTTACTGTAAAGGGGGAAGG + Intronic
947618403 2:231573600-231573622 AGCAGTGCTGGGAAGGGGGAAGG - Intergenic
947650692 2:231784111-231784133 GTTTGGACTGAGAAGGGGGAGGG + Intronic
948024889 2:234769015-234769037 ATTTGTCCTGGGAAAGGTGACGG - Intergenic
1168806883 20:676760-676782 ACGTGGACTGGGAAGGGAGAGGG + Intergenic
1168876157 20:1173692-1173714 TTAAGTCCTGGGCAGGGGGAAGG + Intronic
1170614929 20:17940780-17940802 GTATGTACTGTGAAGGTAGAAGG + Intergenic
1170792918 20:19522401-19522423 AGATGTTCTGGTAAGGAGGAAGG + Intronic
1171086001 20:22239017-22239039 TGATGTACTGGGAATGTGGATGG - Intergenic
1172593788 20:36135625-36135647 ATATGTAGAGGGAAGCAGGAAGG - Intronic
1173734132 20:45347882-45347904 GCGTGTACTCGGAAGGGGGAGGG - Intronic
1174089010 20:48031728-48031750 ATAAATACAGGGAAGGGGGCAGG + Intergenic
1174444803 20:50583291-50583313 ACCAGTACTGGGAAGGAGGACGG + Exonic
1175614703 20:60387407-60387429 CTAGAGACTGGGAAGGGGGAAGG + Intergenic
1175677058 20:60955602-60955624 ATATGCAGTTGGAAGGGAGACGG + Intergenic
1177836850 21:26193990-26194012 ATTTGTGCAGGGATGGGGGACGG + Intergenic
1178456255 21:32754793-32754815 ACATGTTGTGGGTAGGGGGAGGG - Intronic
1179370793 21:40804519-40804541 AGGTGTGCTGGGAACGGGGAGGG - Intronic
1180464181 22:15595917-15595939 ATATGTACTGGGAGGGGCCAAGG - Intergenic
1181917332 22:26291863-26291885 ATATGTACTGGGAAGGGGGATGG - Intronic
1182082450 22:27538899-27538921 ATGTGGACAGGGAAGGAGGAAGG - Intergenic
1182983618 22:34696212-34696234 ATATTTACTGGAGAGGGAGAAGG + Intergenic
1183467869 22:37988920-37988942 CTATGCACTGGGAAGGTGGAGGG + Intronic
1185091184 22:48774855-48774877 ATTTGTACTGGGGACGGGGTGGG - Intronic
949348059 3:3095828-3095850 ATACCTACTGGGAAGAGGCAAGG - Intronic
951459960 3:22940808-22940830 CCATGGACTGGGGAGGGGGATGG - Intergenic
952107200 3:30084455-30084477 ATAGGTCCTGGGAAGAGGGAGGG + Intergenic
952435971 3:33272864-33272886 CCATGAACTGGGATGGGGGATGG - Intergenic
952586261 3:34896359-34896381 ATATGTCCTGGCAAAGGTGAAGG + Intergenic
952744026 3:36761421-36761443 ATCTGTACTGGGAATTGGGGAGG - Intergenic
954200958 3:49022765-49022787 ATAGGTACTGGGGAAGGGGAGGG + Exonic
955180737 3:56666863-56666885 ATGGGTAATGGGAAGAGGGAAGG - Intronic
955673000 3:61421455-61421477 ATGTGTACAGGGAATGGGGGTGG - Intergenic
956161026 3:66352773-66352795 AGAGGTATGGGGAAGGGGGATGG - Intronic
958744208 3:98113471-98113493 ATGTGTCTTGGGAAGGTGGAGGG - Intergenic
958829676 3:99072325-99072347 GTATGTAGTGGGGAGAGGGATGG - Intergenic
958900578 3:99881441-99881463 ATCTGTACTGGCAAGGGACAGGG - Intronic
960397237 3:117152445-117152467 ATATGTGCTGAAAAGGGGAAGGG - Intergenic
961264630 3:125631869-125631891 ATGTGTCCTGGGCACGGGGAGGG + Intergenic
961345286 3:126260116-126260138 ATGTGGAGAGGGAAGGGGGAGGG - Intergenic
961693641 3:128688716-128688738 ATATATACTCTGAAGGAGGAAGG + Intergenic
962336783 3:134540006-134540028 ATATGCACTGTGAATGGGAAAGG + Intronic
962811342 3:138961595-138961617 ATAAATACTGTGATGGGGGAAGG + Intergenic
963667868 3:148212512-148212534 CTCTGCACTGGGAAGAGGGAAGG + Intergenic
963701894 3:148637087-148637109 AAATGTAGTGGGAAGGTGGGCGG + Intergenic
966069900 3:175863058-175863080 ATATGTTAGGGGAAAGGGGAGGG - Intergenic
966245781 3:177806310-177806332 ATATTGCCTGGGAAGGGGCATGG - Intergenic
966446062 3:180001794-180001816 AAATGTACTGGGAAGCAGGAAGG - Intronic
968669241 4:1839865-1839887 GTATGTACGGGGAAGGGGCATGG - Intronic
970652431 4:18193493-18193515 GTGTGTATTGGGTAGGGGGAAGG - Intergenic
970708109 4:18829782-18829804 ATAGTTCCTTGGAAGGGGGAAGG - Intergenic
974635462 4:64558777-64558799 ATATTTACAGGGAGGGAGGAAGG - Intergenic
976687757 4:87834588-87834610 ATATGAACTGCCAAGGGGAAGGG + Intronic
978454458 4:108872551-108872573 ATATGTAATTGGACAGGGGAAGG - Intronic
978777730 4:112519982-112520004 AAATGTTCTGTGAAGGGGGAGGG + Intergenic
980092846 4:128460224-128460246 ATATGTACTGGTAAGGCAAAGGG + Intergenic
982269572 4:153572674-153572696 ATATATATAGGGAAAGGGGAAGG - Intronic
982522031 4:156430008-156430030 ATAGATGCAGGGAAGGGGGAAGG + Intergenic
984059393 4:174973494-174973516 ATATGTTCTGGGGAGTAGGACGG + Intronic
988853388 5:35201223-35201245 AGATTTATTGTGAAGGGGGAGGG - Intronic
988868858 5:35366223-35366245 ATATGAATTGGGAGGGGGTAGGG - Intergenic
989204593 5:38798130-38798152 AAATGATCTGGAAAGGGGGAGGG - Intergenic
990108009 5:52288431-52288453 ATAGGTACTGGGGTGGGGGGTGG - Intergenic
990138045 5:52670837-52670859 ATTTTTACTGGGAAAGGGCAAGG + Intergenic
991218050 5:64178781-64178803 ATATGTAGTTGGAATGGTGAAGG - Intronic
991596444 5:68311531-68311553 ATCTATACTGGGAAGTGGGCAGG + Intergenic
991602831 5:68370659-68370681 TTATGCCCTGGGAAGGAGGAAGG + Intergenic
993511190 5:88773375-88773397 TTATGTACGAGGATGGGGGATGG - Intronic
994030463 5:95136076-95136098 AAATGTTCTGGGAAGGTAGAAGG - Intronic
994632022 5:102297644-102297666 ATTTGAACTCGGAAGGTGGAGGG + Intergenic
996392555 5:122977333-122977355 GTATGTATTGGGAAGGGGTGGGG - Intronic
997877322 5:137560832-137560854 ATATGAACTGGGGTGGGGGGCGG + Intronic
998173994 5:139889643-139889665 GTTTGTAATGGGAAGGGGGAGGG - Intronic
998879374 5:146631133-146631155 ATAGGTACTGGGATGAGGCAAGG - Intronic
999037853 5:148373609-148373631 ATAGGGACTGAGAATGGGGAGGG - Intergenic
999939417 5:156525078-156525100 ATATGTACCCAGAAGTGGGATGG + Intronic
1000422212 5:161051273-161051295 ATATGAGCTGGGAAGAGTGAAGG + Intergenic
1000474322 5:161686433-161686455 CTAGGTAGTGGGAAGGGGCAGGG + Intronic
1000857152 5:166412785-166412807 ATATTTTCTGAGAAGAGGGAAGG + Intergenic
1001275466 5:170347723-170347745 ATCTGGTCTGGGAAGGGAGACGG - Intergenic
1001461636 5:171920364-171920386 ATATGTTCGGTGAAGGAGGATGG + Intronic
1002000793 5:176195307-176195329 ATATGGGCAGGGAAGGGGGCAGG + Intergenic
1002055075 5:176594101-176594123 CTGTGGACTGGGAAGGGGCAGGG + Intronic
1002253543 5:177943663-177943685 ATATGGGCAGGGAAGGGGGCAGG - Intergenic
1002355186 5:178622275-178622297 TTATATAAGGGGAAGGGGGAAGG - Intronic
1002439007 5:179254372-179254394 CTATGAGCTGGGAAGGGGAATGG + Intronic
1003427394 6:6006864-6006886 TTATGCACTGGGAAGGCAGAGGG + Exonic
1003504144 6:6725796-6725818 AAATGCAATGAGAAGGGGGATGG - Intergenic
1004808681 6:19234165-19234187 ATCTGCAGAGGGAAGGGGGAAGG + Intergenic
1006039158 6:31239468-31239490 AGATTTACTGGGATGGGGGATGG - Intergenic
1007496245 6:42261868-42261890 TTATGGACTGGGGAGGGGCAAGG - Intronic
1010568315 6:77445829-77445851 ATACTTTGTGGGAAGGGGGAAGG + Intergenic
1011371428 6:86640986-86641008 ATGTGTGCTGGGAAGGTGGAGGG + Intergenic
1011782967 6:90811066-90811088 ATATGTAGTGGGGAGGAGGGGGG - Intergenic
1011833016 6:91396110-91396132 ATATGGGCAAGGAAGGGGGAAGG + Intergenic
1011964069 6:93130603-93130625 ATATATATAGGGAGGGGGGAGGG + Intergenic
1013976971 6:116090393-116090415 GTATGTACTATGATGGGGGAAGG - Intergenic
1014988005 6:128035806-128035828 ATATTTAGTGGGAAAGGGCAGGG + Intronic
1015889195 6:137952373-137952395 ATATGTACTCCGAAGGGGGAGGG + Intergenic
1016387851 6:143545691-143545713 ATATGTACTAGGGTGGGGTAGGG - Intronic
1018372557 6:163181505-163181527 ACTTGTCCTTGGAAGGGGGAGGG - Intronic
1020414878 7:7934236-7934258 ACTGGTACTGGGGAGGGGGATGG + Intronic
1020846317 7:13288857-13288879 ATTTGTACTGGGAAAGTGTAAGG - Intergenic
1022200788 7:28114980-28115002 GTATGTGCAGGGAAGGGGAATGG + Intronic
1023094541 7:36646955-36646977 ATATGAACTTGGAGGGTGGAGGG + Intronic
1023256971 7:38322259-38322281 ATCTGTAGTGGGACCGGGGAAGG + Intergenic
1024297727 7:47859285-47859307 ATAGGTAATGGGGAGGGAGAAGG - Intronic
1024609576 7:51053048-51053070 ATATGTGCTGGGAAGGGAGAGGG - Intronic
1024760556 7:52591687-52591709 ATATGGACTGGGATGGGGGCAGG - Intergenic
1024919175 7:54539558-54539580 AGCTGAACTGGCAAGGGGGAGGG - Intergenic
1026097906 7:67361336-67361358 ATATGGTCTAGAAAGGGGGAGGG + Intergenic
1027242428 7:76340726-76340748 ATCTGAACTGGCAAGGGGTAGGG - Intronic
1027845459 7:83368094-83368116 ATAGGTAGTGGAAAGGGTGATGG - Intronic
1028414607 7:90566599-90566621 ATATGTACAGGGAAATGGAAAGG - Intronic
1029284140 7:99454542-99454564 TTATGTACTGGGGGAGGGGATGG - Intronic
1029490983 7:100869794-100869816 CCATGGACTGGGGAGGGGGATGG + Intronic
1032819144 7:135509156-135509178 ATCTGTACAGGAAAGAGGGAAGG + Intronic
1034315229 7:150124703-150124725 ACATGGACTGGGAAGGGTGAAGG - Intergenic
1034425675 7:151012911-151012933 ATATGAAGTGGGAGCGGGGAAGG + Exonic
1034791662 7:153976096-153976118 ACATGAACTGGGAAGGGTGAAGG + Intronic
1034853994 7:154523166-154523188 ATATTTTCTTGAAAGGGGGAAGG + Intronic
1035088719 7:156286122-156286144 ATATGAATTTGGCAGGGGGAAGG - Intergenic
1035389924 7:158497167-158497189 AGGGGTACAGGGAAGGGGGAGGG - Intronic
1036776300 8:11615106-11615128 GTTTGTTCTGGGAAGGGAGAGGG + Intergenic
1038724302 8:30066634-30066656 AGATTCTCTGGGAAGGGGGAAGG - Intronic
1039749172 8:40461108-40461130 ATATTTTTTGGGTAGGGGGAAGG + Intergenic
1042040965 8:64587873-64587895 ATATGTAGTGGGGTTGGGGATGG - Intronic
1042140748 8:65676142-65676164 GTGTGTGTTGGGAAGGGGGAAGG - Intronic
1042413663 8:68494001-68494023 ATATATACTTAGAAGTGGGATGG - Intronic
1044048625 8:87470897-87470919 GTATGTACTTGGAGTGGGGAGGG + Intronic
1045316623 8:101049066-101049088 ACATGGACTGGAAAGGGGCAAGG - Intergenic
1046871642 8:119210403-119210425 AGATATAATGGGGAGGGGGAGGG - Intronic
1048407604 8:134139105-134139127 ATATGTACATGCAAGGGGAAGGG + Intergenic
1049725522 8:144143889-144143911 CTCTGGACTGGGCAGGGGGAGGG + Intergenic
1052485948 9:29100276-29100298 ATTTTAACTGGGTAGGGGGATGG + Intergenic
1052486057 9:29101506-29101528 ATTTTAACTGGGTAGGGGGATGG - Intergenic
1052820831 9:33136988-33137010 ATGTGTACTGGGGAAGGGGGTGG - Intronic
1053372491 9:37574736-37574758 AAATGTACTGAGAACGGGCAGGG + Intronic
1055355301 9:75431554-75431576 ATTTGTGTTGGGAAGTGGGAAGG - Intergenic
1055463256 9:76539164-76539186 ACATCCTCTGGGAAGGGGGAGGG - Intergenic
1056182983 9:84103435-84103457 ATAGACACTGGGGAGGGGGAGGG + Intergenic
1057320813 9:94010824-94010846 ATATGGATTGGGTAGGGAGAGGG + Intergenic
1057789867 9:98117805-98117827 GTAGGTAGTGGGTAGGGGGATGG + Intronic
1057920886 9:99095656-99095678 CTGTGTAATGGGGAGGGGGAAGG - Intergenic
1058987388 9:110220836-110220858 AGAAGTAGTGGGAGGGGGGAAGG + Intergenic
1059528236 9:115013026-115013048 ATGAGTACTGGGAATGGGGAGGG + Intergenic
1059752272 9:117259082-117259104 AGAGGTACTGGGAGGGTGGAAGG - Intronic
1060404106 9:123364614-123364636 CAATGAACTGAGAAGGGGGAGGG + Intronic
1187361160 X:18628757-18628779 ATTTGTGCTGGTAGGGGGGAGGG + Intronic
1187557918 X:20369671-20369693 ATAAGCACTGGCAAGGAGGATGG + Intergenic
1188402709 X:29766630-29766652 ATATATAATGAGAAAGGGGATGG - Intronic
1189323517 X:40099434-40099456 TTTTATACTGGGAAGGGGGTGGG + Intronic
1189560943 X:42191044-42191066 ATTGGTACAGGGCAGGGGGAAGG + Intergenic
1190180806 X:48190722-48190744 ATGTATACAGGGAAGGGAGAGGG + Intronic
1190196473 X:48323593-48323615 ATGTATACAGGGAAGGGAGAGGG - Intergenic
1190212430 X:48459198-48459220 ATGGGTCCTGGGAAGGTGGAAGG - Intronic
1190947981 X:55114461-55114483 ATATGTAATGGCAAGGGGAAGGG + Intronic
1192337572 X:70234973-70234995 ATATGTAGTGGGAGGGGGCGGGG + Intronic
1193336815 X:80299351-80299373 ATATTTAATGGGATTGGGGATGG - Intergenic
1195706935 X:107743894-107743916 ATCTGGACTGGGAAGGAGCAAGG - Intronic
1197325184 X:125084132-125084154 ATAAGTATGGGGAAAGGGGAGGG - Intergenic
1197411116 X:126117585-126117607 GTATGTACTCAGAAGAGGGATGG + Intergenic
1198074658 X:133182863-133182885 ATCTGTGCTGGGTAGGGGTAGGG + Intergenic
1199519392 X:148718382-148718404 ATGTGAACTGGGAAGGGCAATGG + Intronic
1202137382 Y:21680567-21680589 TTATGTCCTGTGAAGGGGCATGG - Intergenic