ID: 1181922957

View in Genome Browser
Species Human (GRCh38)
Location 22:26334792-26334814
Sequence GAGAAGGGCCAGAGTGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 695
Summary {0: 1, 1: 0, 2: 8, 3: 53, 4: 633}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181922946_1181922957 26 Left 1181922946 22:26334743-26334765 CCAGGAGCTCACACTTTGTGCCT No data
Right 1181922957 22:26334792-26334814 GAGAAGGGCCAGAGTGGGCAGGG 0: 1
1: 0
2: 8
3: 53
4: 633
1181922950_1181922957 -5 Left 1181922950 22:26334774-26334796 CCTTTCACTCTGGCACCTGAGAA 0: 1
1: 0
2: 0
3: 18
4: 226
Right 1181922957 22:26334792-26334814 GAGAAGGGCCAGAGTGGGCAGGG 0: 1
1: 0
2: 8
3: 53
4: 633
1181922948_1181922957 6 Left 1181922948 22:26334763-26334785 CCTGTGGAAAGCCTTTCACTCTG 0: 1
1: 0
2: 3
3: 11
4: 159
Right 1181922957 22:26334792-26334814 GAGAAGGGCCAGAGTGGGCAGGG 0: 1
1: 0
2: 8
3: 53
4: 633

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181922957 Original CRISPR GAGAAGGGCCAGAGTGGGCA GGG Intronic
900398757 1:2464247-2464269 GAGTAAGGGCAGAGTGGGGAGGG - Intronic
900406591 1:2495615-2495637 GAGAAGGGCCCGGTTGGGCCAGG - Intronic
900586991 1:3437404-3437426 GGGACGGGACAGAGGGGGCAGGG - Exonic
900834150 1:4987054-4987076 GAGATGGCCCAGACTGGGTAAGG - Intergenic
901056144 1:6449368-6449390 GAGGAGGCCCAGAGAGGGGAGGG - Intronic
901195753 1:7438990-7439012 CACCAGGGCCAGAGTGAGCAGGG + Intronic
901201739 1:7471092-7471114 GAGAAGGGCCTGAGTTGACGTGG + Intronic
901209070 1:7514379-7514401 GGGAAGGGCATGAGTGGGGAAGG + Intronic
901529854 1:9846061-9846083 GAGCAGGGGCAGGGTGGGTAGGG + Intergenic
901708957 1:11099313-11099335 GAGAAGGGCCATACTGGCCGCGG + Intronic
901840357 1:11950309-11950331 GAGCAGGGCAAGGGTGAGCAGGG - Intronic
901871356 1:12140842-12140864 GAGAAGGCCCAGAGGGGGATGGG - Intronic
902111434 1:14082068-14082090 TAGAAGGAACAGAGTGGGCTGGG - Intergenic
902387396 1:16083638-16083660 GGGAAGGGCAGGAGTGGGCTGGG - Intergenic
902728707 1:18354221-18354243 CAGAAGGCCCAGTGTGTGCAGGG + Intronic
902811297 1:18889460-18889482 GAGAGGGACAAGAGTGGGTATGG + Intronic
903023966 1:20413790-20413812 GAGAAGTGCCTGAGAGGTCATGG + Intergenic
903117837 1:21192708-21192730 GGGCAGTGCCAGAGTGGGGAGGG - Intergenic
903118334 1:21196512-21196534 GAGGAGAGCCAGAGTGGAAATGG - Intergenic
903133170 1:21292261-21292283 ATGAGGGCCCAGAGTGGGCAGGG - Intronic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
903664115 1:24996221-24996243 GAGAAGGGCCAGCCTGGGCCAGG - Intergenic
903771468 1:25767035-25767057 ACCAAGGCCCAGAGTGGGCAGGG + Intronic
904321234 1:29698881-29698903 GAGCAGGGCCAGTGTGGGGGTGG - Intergenic
904615676 1:31748287-31748309 GAGCTGGGCCAGAGAGGGGAAGG + Intronic
904781853 1:32955800-32955822 GAGAAGGAACAAAGTGGACAGGG - Intronic
904985802 1:34547443-34547465 GGGAAGGGGCAGGGAGGGCAGGG + Intergenic
905178916 1:36155153-36155175 GGGCAGGGCCAGGGTGGGCAGGG + Intronic
905184724 1:36188091-36188113 CAGTAGGGCCAGACTAGGCAGGG + Intergenic
905867412 1:41383393-41383415 GAGAAGGGCCAGAACTGGCGCGG - Exonic
906551000 1:46666413-46666435 GTGAAGGGGTAGAGAGGGCAAGG + Intronic
906699991 1:47850740-47850762 GAGGAGGCGGAGAGTGGGCAGGG - Intronic
907126000 1:52051667-52051689 TAGAAGGCCCAGGCTGGGCACGG - Intronic
907373797 1:54019488-54019510 GAGAATGGCCAGAGGAGGCCAGG + Intergenic
907492234 1:54815549-54815571 GAGAAGGAAGAGAGTGGGAAAGG - Intronic
907848788 1:58234501-58234523 GAGAAGGACAAGGGTGGACAAGG + Intronic
908034503 1:60037494-60037516 CAGAAGGGCAAGAGGAGGCAAGG + Intronic
908055209 1:60278631-60278653 GAGAAGTGTCTGCGTGGGCAAGG - Intergenic
908708844 1:66992372-66992394 CAGAAGGCTCAGAGTGTGCAAGG - Intergenic
909931633 1:81504574-81504596 GGGAAGGGCCAGAGGGGCCGGGG - Intronic
911565001 1:99453852-99453874 GAGAAGGGACAGAGAAGGGAAGG + Intergenic
911611849 1:99967018-99967040 GAGAAGAGGCAGGCTGGGCACGG + Intergenic
911693550 1:100862442-100862464 TAGAAGGGCAAGAGTGGGACAGG - Intergenic
912505440 1:110152584-110152606 GAGCAGGGCCAGGCTGGGCTGGG + Intronic
912790954 1:112650150-112650172 GATAATGGCTAGAGTGGGTAGGG + Intronic
915287350 1:154861515-154861537 GAGAGGGGGCAGAGTGTGTAGGG - Intronic
915752477 1:158224510-158224532 GGGAGGGGCCAGAGTTGGAATGG + Intergenic
916081098 1:161232893-161232915 CACAGGGGCCAGGGTGGGCAAGG + Exonic
916095366 1:161345094-161345116 GGGAAGAGCCAGAGCTGGCAGGG - Intronic
917026220 1:170645361-170645383 GAGCAGGGCGAGAGTGAGAAAGG + Intergenic
917826198 1:178823756-178823778 GAGAAGGACCATTGTGGGCTGGG + Intronic
918407136 1:184222515-184222537 GTAAGGGGCCAGAGTGGGCATGG - Intergenic
919823012 1:201484670-201484692 GAAAAGCGCAGGAGTGGGCAGGG + Exonic
920117046 1:203628643-203628665 GAGAAGGGGCAGCTTGGGGAGGG - Intronic
920330513 1:205203992-205204014 GAGAAAGGCCAGAAAGGGAAAGG + Intronic
921297900 1:213722001-213722023 CAGAAGAGACGGAGTGGGCACGG - Intergenic
921540309 1:216406043-216406065 GGGAAGGGAGACAGTGGGCATGG + Intronic
922032194 1:221812338-221812360 AAGCGGGGCCAGAGTGGGCAGGG - Intergenic
922204815 1:223437028-223437050 GTGGAGCACCAGAGTGGGCATGG - Intergenic
922854211 1:228760314-228760336 GAGAAGTCCCACATTGGGCAGGG + Intergenic
924273723 1:242363013-242363035 TAGAAAGGCTAGAGTTGGCAGGG + Intronic
1063225680 10:4013167-4013189 GAGGAGGGGAAGAGAGGGCAAGG - Intergenic
1064435801 10:15310461-15310483 GAGAGGGGCCAGGTTGGTCACGG - Intronic
1065328498 10:24570625-24570647 GAAGAGGGCCAGAGTGGCCAGGG - Intergenic
1066710986 10:38233641-38233663 TAGAAAGGCTAGAGTTGGCAGGG - Intergenic
1067029862 10:42872751-42872773 GACAATGGCCAGGGTGGTCATGG + Intergenic
1067219691 10:44335091-44335113 CAGAGAGGCCAGAGTGGCCATGG + Intergenic
1067283792 10:44892867-44892889 GGGAAAGGCAAGAGTGGGCGAGG - Intergenic
1067419459 10:46133849-46133871 GAGGGGTGCCAGGGTGGGCATGG + Intergenic
1067504810 10:46840446-46840468 GAGGGGTGCCAGGGTGGGCATGG + Intergenic
1068930548 10:62584586-62584608 GAGAAGCACCAGACTGTGCAGGG - Intronic
1069061366 10:63897994-63898016 GAGAAGGGTCTGGGTAGGCAAGG + Intergenic
1069062985 10:63913590-63913612 GAGAAGGCTCTGGGTGGGCAAGG - Intergenic
1069222592 10:65903325-65903347 GTGATGGGCCAGAGTGGTCTTGG - Intergenic
1069576468 10:69533514-69533536 GGGAAGGGGGAGAGTGGGCAAGG + Intergenic
1070617340 10:77979096-77979118 AAGAAGGGTGAGAGCGGGCATGG - Intronic
1070656062 10:78272326-78272348 GTGAATGGCCAGGGTTGGCAGGG + Intergenic
1070741251 10:78904567-78904589 GAGCAGGGTCAGAGTGGGGCTGG - Intergenic
1070752504 10:78972567-78972589 GAGCAGGGCCAGAGCTGGGAAGG + Intergenic
1071820717 10:89277868-89277890 GAGAAAGGAAAGAGTGGGGAGGG - Intronic
1072220251 10:93321012-93321034 TAGCAGGGGCAGAGTGGGAATGG + Intronic
1073038268 10:100579580-100579602 AAGAAGTGCCAGTGTGGTCAAGG + Intergenic
1073148073 10:101293211-101293233 GAGGAGGGACAAAGAGGGCAAGG - Intergenic
1073218672 10:101851673-101851695 GAGAAGGGCTAGAGGGCACAGGG + Intronic
1074105932 10:110389688-110389710 GCAAAGGGCCTGAGTGGGGAAGG + Intergenic
1074932196 10:118139664-118139686 GAGATGGGCCTGGGTGGGGAGGG - Intergenic
1074945645 10:118278296-118278318 GAGCAGGGCCAGAATCAGCAGGG + Intergenic
1075139375 10:119818086-119818108 GAGAAGGGCCAGGACAGGCACGG - Intronic
1075361647 10:121841765-121841787 CGGAAGGGCAAGAGTGGGTAAGG + Intronic
1075531073 10:123230291-123230313 GAGGAGGGGGAGAGTGAGCAGGG - Intergenic
1075868139 10:125745332-125745354 GAGAAGGCCCTGTGTGGACACGG - Intronic
1076207560 10:128615267-128615289 GTGAGGGGCCTGGGTGGGCAGGG + Intergenic
1076883250 10:133249632-133249654 AACGAGGCCCAGAGTGGGCACGG + Intergenic
1077104086 11:834464-834486 CCCAAGGGCCAGAGTGGGCCGGG - Intronic
1077142749 11:1031577-1031599 GAGAAGGGCCAGGGTGGGCCTGG - Intronic
1077321739 11:1945977-1945999 GAAGTGGGCCAGAGTGGGCAGGG - Intergenic
1077499265 11:2901954-2901976 GAGGAGGGGCAGTGTGGGCAGGG - Intronic
1077610926 11:3642641-3642663 GAGAGGGCCCAGAGCAGGCAGGG - Intergenic
1077825318 11:5801931-5801953 GAGAAGCAGCAGAGTGGTCAAGG + Intronic
1078722362 11:13896887-13896909 CTGAAGAGCCAGAGAGGGCAGGG - Intergenic
1079336528 11:19575181-19575203 GAGAAGGGCCAGCTTTGGCAGGG - Intronic
1080001264 11:27352910-27352932 AAGAAGGGCCAGACTTGGAAGGG - Intronic
1080336865 11:31207693-31207715 TAGAAGGGGCTGAGTGGCCAGGG - Intronic
1080774394 11:35372132-35372154 GAGAAGGGATGGAGAGGGCAAGG + Intronic
1081715538 11:45247304-45247326 GAGAAGGGAGTGTGTGGGCAGGG + Intronic
1081770223 11:45645778-45645800 GAAAAGGCACAGAGTGGGGAAGG - Intergenic
1082875342 11:57982194-57982216 GAGAGGAGCAGGAGTGGGCAGGG + Intergenic
1082923434 11:58520746-58520768 CAGAAGGGAGAAAGTGGGCAAGG - Intergenic
1083260426 11:61519521-61519543 GTCAAGGGCCAGAGGGGACAGGG + Intronic
1083267445 11:61553353-61553375 GAGAAGGGCGAGGGGTGGCATGG - Intronic
1083608436 11:63992979-63993001 GAGAATGGCCAGGGTCGGCTTGG - Intronic
1083646586 11:64174963-64174985 GGGAAGGGCCTTAGTGGGCCAGG + Intergenic
1083741073 11:64712131-64712153 TGGAAAGGCCAGTGTGGGCAGGG - Intronic
1083761944 11:64823610-64823632 GGGAAGGGCCAGAGTGTGCCCGG + Exonic
1083886901 11:65577361-65577383 TAGCAGGCCCAGTGTGGGCAAGG - Intronic
1084082554 11:66838158-66838180 GTGAATGGCCAGAGTGGAGAAGG + Intronic
1084456993 11:69273637-69273659 GAGAAGGGTCTCAGTGTGCATGG + Intergenic
1085039257 11:73317381-73317403 AAGCAGGCTCAGAGTGGGCAGGG + Intronic
1085286342 11:75364110-75364132 TAGAACGTGCAGAGTGGGCAGGG - Intergenic
1085306995 11:75492163-75492185 GAGAGAGGGCAGAGTGGGGATGG - Intronic
1086897303 11:92328165-92328187 CAGGAGGGCAAGAGTGGGTAAGG - Intergenic
1087041043 11:93800259-93800281 GAGAAGAGCCAGTGGGGACAAGG - Intronic
1087702456 11:101450806-101450828 GAGATGGTGAAGAGTGGGCAGGG + Intergenic
1088864732 11:113836826-113836848 GAGGAGGGTCTGAGTGGACAGGG - Intronic
1089096928 11:115927201-115927223 GAGGACGGCCAGAGTGGGTGGGG - Intergenic
1089401391 11:118166569-118166591 GAGAAGGGAGTGGGTGGGCAGGG - Exonic
1090061706 11:123469332-123469354 GAGTGGGGCCAGAGTGGCAATGG + Intergenic
1090075614 11:123578512-123578534 TATAAGGGCCAGAATCGGCAGGG - Intronic
1090736597 11:129616655-129616677 GCCAAGAGCTAGAGTGGGCAGGG + Intergenic
1091307049 11:134542965-134542987 CAAAAGGGCCACAGTGGGCTTGG + Intergenic
1202804757 11_KI270721v1_random:1290-1312 GAAGTGGGCCAGAGTGGGCAGGG - Intergenic
1091419024 12:318868-318890 GAGAATGACCAGAGTGGGGAAGG + Intronic
1091448807 12:560122-560144 GAGAAGGGGCAGAGAGAGGATGG + Intronic
1091966096 12:4743139-4743161 GAAAAGTACCATAGTGGGCATGG - Intronic
1092006050 12:5071329-5071351 GAGCTGGGGCAGATTGGGCAGGG + Intergenic
1093143628 12:15538516-15538538 GAGAAGTGCTAAAGTGGGCCGGG - Intronic
1094447890 12:30552054-30552076 GAGATGGGCATGAGTGAGCAGGG + Intergenic
1094784585 12:33831897-33831919 CAGAAGGGGGAGAGAGGGCAGGG + Intergenic
1094797931 12:33998085-33998107 CTGAAGGGCCAGAGTCAGCAAGG + Intergenic
1095445197 12:42275740-42275762 GAGAAGGAAGAGAGAGGGCAAGG - Intronic
1097193270 12:57230386-57230408 GGGAAGAGGCAGAGTTGGCAAGG - Intronic
1097221619 12:57454670-57454692 GAGGAGGGCCAGAGCCGGCGGGG - Intronic
1097352424 12:58562906-58562928 GGGGAGGGCCAGAGTGGTCTTGG + Intronic
1097525188 12:60725197-60725219 GAGAATGGCCAGGTTGGGCTTGG - Intergenic
1099201777 12:79686540-79686562 GTGAAGGGACAAAGAGGGCACGG + Intronic
1100871883 12:98918177-98918199 GTGAAGGGCCTGAGGGGCCATGG - Intronic
1101598528 12:106188690-106188712 GAGAAGAGCCAGAGGGGGGAGGG + Intergenic
1103058011 12:117836698-117836720 GACACGGGCCACAGTTGGCAAGG - Intronic
1103155944 12:118684987-118685009 GGGAAGGGAGAGAGTGGGCTAGG + Intergenic
1103734340 12:123049594-123049616 TAGAAGGGACAGGGAGGGCATGG - Intronic
1104411310 12:128560345-128560367 GGTAAGGTCCAGAGTGGGCAGGG - Intronic
1107964729 13:45588469-45588491 GAGCAGGGCAAGAGTTGACATGG - Intronic
1108466148 13:50717379-50717401 GAAAGAGGCCAGAGAGGGCAAGG + Intronic
1108498152 13:51044972-51044994 CAGGTGGCCCAGAGTGGGCAGGG + Intergenic
1111486278 13:88904919-88904941 GAGAATGGTCAGACTGGGTAAGG - Intergenic
1112507644 13:99984833-99984855 GAGAAGGACCTGAGGGGGCTGGG - Intronic
1112705232 13:102060830-102060852 GTGATGGGCCAGAGTGGTCTTGG - Intronic
1113033262 13:106017713-106017735 GAGAAAGGGCAGATGGGGCAGGG - Intergenic
1113309213 13:109113724-109113746 TAGAAAGGCAAGAGTGGGTAGGG + Intronic
1113531581 13:111031532-111031554 GAGAAAGGCCAGAGCTGGCCTGG - Intergenic
1113578843 13:111414070-111414092 GAGTAAGGGCAGAGTGGGCTCGG - Intergenic
1113741826 13:112716519-112716541 GAGCCGGGACAGAGGGGGCAAGG + Intronic
1113843529 13:113373431-113373453 GAGAAGAGCCAGGGAGGGCCAGG - Intergenic
1114555766 14:23561436-23561458 CAGAAGGGACAGAAGGGGCAGGG + Intronic
1114559099 14:23578122-23578144 GGGAAAGGCCAGGGTGGGGACGG + Intronic
1115227938 14:31124623-31124645 AAGGAGTGCAAGAGTGGGCAAGG + Intronic
1117396641 14:55317150-55317172 GGGAAGGGGTAGAGTGGGCTCGG + Intronic
1117499929 14:56341502-56341524 GGGACTGGGCAGAGTGGGCAGGG + Intergenic
1119434739 14:74590839-74590861 CAGAAGGGAAAGAGTGGGAAGGG + Intronic
1119511558 14:75215545-75215567 GGGCAGGGGCAGGGTGGGCAGGG + Intergenic
1119775095 14:77243260-77243282 GACCAGGGCTAGAGTGGGAAGGG + Intronic
1119884484 14:78129070-78129092 GAGAAGGTCCAGGGTGGACCTGG + Intergenic
1119895343 14:78215190-78215212 GGAGAGGGCCAGAGTGGGCTCGG - Intergenic
1121096183 14:91219669-91219691 GCCAAGGGCCAGAGTGGGCAGGG - Intronic
1121248524 14:92482650-92482672 GTGAAGGGGCAGAGTGAGAAAGG - Intronic
1121275172 14:92662419-92662441 GAGAAGCGGCAGAGCCGGCAAGG - Intronic
1121607662 14:95253146-95253168 GTCAGGGGCCACAGTGGGCATGG - Intronic
1121648833 14:95540525-95540547 GGCACGGGGCAGAGTGGGCAAGG - Intronic
1121654029 14:95581894-95581916 GGGAGGACCCAGAGTGGGCACGG - Intergenic
1121708218 14:96017158-96017180 GAGGAGGAGCAGAGTGGGAAAGG - Intergenic
1121817068 14:96936665-96936687 GAGATGGGCCAGAGGGGTCATGG + Intergenic
1121817228 14:96938081-96938103 GAGATGGGCCAGAGGGGTCGTGG - Intergenic
1121846097 14:97173556-97173578 GAGAAAGGCCAGGTTGGGGAGGG - Intergenic
1121846377 14:97175792-97175814 CAGAAAGGTGAGAGTGGGCAGGG + Intergenic
1122053929 14:99079467-99079489 GGGAAGGGCCAGTGTGAGCCTGG - Intergenic
1122080252 14:99262216-99262238 GAGATGGGCCAGGGAGGGCGGGG - Intronic
1122227813 14:100290084-100290106 GAGAAGCCCCAGGGTGAGCAGGG + Intergenic
1122362217 14:101174247-101174269 GACGAGGCCCAGAGAGGGCAAGG + Intergenic
1122386422 14:101351293-101351315 GGGCAGGGCCAGTGAGGGCAAGG + Intergenic
1122414636 14:101543012-101543034 GAGGTGGACCAGAGAGGGCAGGG - Intergenic
1122762790 14:104042396-104042418 TTGAAGGGACAGCGTGGGCAGGG + Intronic
1122941729 14:104984581-104984603 GAGAAGGACCAGGGAGGGAAGGG + Intergenic
1123000449 14:105291191-105291213 GAGCAGGGCCAGAGGCCGCAGGG + Intronic
1202832684 14_GL000009v2_random:53883-53905 GGGGAGGGACAGAGTGGGCCAGG + Intergenic
1123934382 15:25187077-25187099 GAGGGGAGCCAGCGTGGGCAAGG + Intergenic
1124803061 15:32853819-32853841 GGCCAGGCCCAGAGTGGGCAGGG + Intronic
1125747695 15:42008339-42008361 AGGAAGGGCCCCAGTGGGCAAGG + Intronic
1125769348 15:42154538-42154560 GGGAAGGAGCAGAGTGGGGAGGG + Intronic
1127568763 15:60219953-60219975 AAGAGGGCCCAGATTGGGCAAGG - Intergenic
1128278018 15:66370483-66370505 GAGGAGGGCCAGCAGGGGCATGG + Intronic
1128742063 15:70090594-70090616 GAGAAGATCCAGAGCGGGGAGGG + Intronic
1129190610 15:73935484-73935506 GTGCAGGGCCTGAGAGGGCAAGG + Intronic
1129249846 15:74302810-74302832 GAGCTGGGCCAGACTGGGCAGGG - Intronic
1129253065 15:74319248-74319270 GAGCAGGCACGGAGTGGGCAAGG + Intronic
1130014097 15:80174128-80174150 GAAAATGACCAGGGTGGGCAGGG - Intronic
1130313219 15:82772344-82772366 GAGAAAGTCCAGAGTAGACAAGG + Intronic
1130532945 15:84761354-84761376 GGGAAAGACCAGAGAGGGCAAGG + Intronic
1131873879 15:96784618-96784640 AAGAAAGGCCAGAGTGAGCTTGG - Intronic
1132149855 15:99451767-99451789 GAGAAGGGACCGGGTGGCCAAGG - Intergenic
1132381471 15:101369435-101369457 AAGTGGGCCCAGAGTGGGCAAGG + Intronic
1132462859 16:63914-63936 GACCAGGGTCTGAGTGGGCAAGG + Intronic
1132532102 16:456967-456989 CACATGGGCCAGCGTGGGCAGGG - Intronic
1132615490 16:839470-839492 GGGCAGGGCCAGAGTGGGGCCGG - Intergenic
1132731537 16:1364850-1364872 GAGCAGGACCAGGGTGGTCACGG + Intronic
1132867747 16:2102320-2102342 GAGGAGGGCCTGGGTGGGCTCGG - Intronic
1132949165 16:2550940-2550962 GCCAAGGACCAGCGTGGGCAGGG + Intronic
1132965423 16:2651188-2651210 GCCAAGGACCAGCGTGGGCAGGG - Intergenic
1133042249 16:3066908-3066930 GAGCAGGGCCTGCGTGGGCCGGG - Intronic
1133233211 16:4376136-4376158 CAGAAGGGGCAGAGAGGGCTGGG - Intronic
1133262170 16:4558011-4558033 GAGAAGTACCAGAGTAGTCACGG + Intronic
1134416586 16:14048558-14048580 CACAGGGGCCAGAGTGTGCAGGG + Intergenic
1134524031 16:14930794-14930816 GAGGAGGGCCTGGGTGGGCTCGG + Intronic
1134548873 16:15130141-15130163 GAGGAGGGCCTGGGTGGGCTCGG - Intronic
1134610800 16:15606489-15606511 GAGAAGGTCCACAGTTGTCATGG - Intronic
1134711623 16:16329279-16329301 GAGGAGGGCCTGGGTGGGCTCGG + Intergenic
1134719474 16:16372578-16372600 GAGGAGGGCCTGGGTGGGCTCGG + Intergenic
1134752428 16:16636583-16636605 GTGCAGGAGCAGAGTGGGCAAGG - Intergenic
1134947952 16:18339307-18339329 GAGGAGGGCCTGGGTGGGCTCGG - Intergenic
1134955205 16:18379414-18379436 GAGGAGGGCCTGGGTGGGCTCGG - Intergenic
1137460311 16:48655397-48655419 GAGAGGGGACATAGTGGGAATGG + Intergenic
1137533843 16:49302234-49302256 GAGAAGAGCCAGGGTGAGCCAGG - Intergenic
1137879842 16:52034693-52034715 TAGATGGACCAGAGGGGGCATGG - Intronic
1138168766 16:54829700-54829722 GAGCAAGGCCAGAGTGGGCACGG - Intergenic
1138475921 16:57270564-57270586 GAGAAGGGCCAGAGCGGGGGTGG - Intronic
1138506519 16:57480898-57480920 GAGAAGGTCCAGGGTGGTGATGG + Intronic
1138590993 16:57999935-57999957 CAGGAGGGCCAGGGTGGGCAGGG - Intronic
1138622394 16:58222548-58222570 GAGGAGGGCCAGGGTTGGCAAGG + Intergenic
1139523524 16:67499159-67499181 GAGCAGGGCCAGGTTGGGGAGGG - Intergenic
1139596538 16:67961597-67961619 GAGGAGGCCGAGAGTGGGGAGGG - Exonic
1139604799 16:68010425-68010447 CAGAAAGGCCAGTGTGGCCAGGG - Intronic
1140766632 16:78165528-78165550 GAGAAGGGTCAGATGGGGTAGGG + Intronic
1140851039 16:78934807-78934829 GAGAAGAAGCAGACTGGGCATGG + Intronic
1141272326 16:82552682-82552704 GAAAAAGGCCAGCGTGGACAGGG + Intergenic
1141469062 16:84226190-84226212 GAGAAGGCCCAGGGTGTGAATGG + Intronic
1141534576 16:84670231-84670253 AAGCAGGGCCTGAGTGGCCATGG + Intergenic
1141569975 16:84928462-84928484 GCGATGGGCCAGGGTGGGGAGGG - Intergenic
1141703524 16:85652999-85653021 CAGAGGGGCCAGCGTGGCCATGG + Intronic
1141927092 16:87177096-87177118 GAGCAGGACCAGAGTGAGCAGGG - Intronic
1141978866 16:87536996-87537018 GAGAAGAGCAAGAGAGAGCAGGG - Intergenic
1142132965 16:88439128-88439150 GAGGAAGGACAGACTGGGCAAGG + Exonic
1142145203 16:88489986-88490008 GAGGAGGGACAGCGTGGGGAGGG + Intronic
1142202936 16:88769783-88769805 GGGAGGGGCCAGGGTGGGCGGGG + Intronic
1142382506 16:89741242-89741264 AAGTAGGGCCTGACTGGGCAGGG + Intronic
1142709618 17:1716006-1716028 GAGAAGGGGCGGCGGGGGCAGGG - Intergenic
1142859658 17:2753636-2753658 GGTAAGGGCCAAAGTGTGCAAGG + Intergenic
1144466170 17:15499370-15499392 CAGAAGGGCCAGAGTGAGCCTGG - Intronic
1144560249 17:16315412-16315434 CAGAAAGGCCAGAGTGAGGAGGG - Intronic
1145912456 17:28550531-28550553 AATAAGGGGCAGAGTGGCCAAGG + Intronic
1146066779 17:29642272-29642294 CACAAGGGCCAGAGGAGGCAGGG - Intronic
1146266729 17:31457860-31457882 GAGAAGAGACAGAGCGGGGAGGG - Intronic
1146430997 17:32794757-32794779 GAGGAGGGCCAGAGCGCGCAAGG + Intronic
1146482216 17:33213865-33213887 GAGAATGCCCAGAGGGGCCAGGG - Intronic
1146671288 17:34739839-34739861 GAGCAGGGCAAGATTGGGGAAGG - Intergenic
1147150774 17:38512418-38512440 GGAAAGGGCCAGAGTGGGGCTGG + Intergenic
1147465931 17:40610877-40610899 GAGAAGAGGCAGAGAGAGCAGGG + Intergenic
1147543040 17:41377171-41377193 AAGAAGACCCAGAGTGTGCAGGG + Intronic
1147627695 17:41910512-41910534 GAGGAGGCCAAGAGTGGGCAAGG - Intronic
1147637429 17:41972607-41972629 GAGAAGTGGGAGAGTGGGCTTGG - Intronic
1148112752 17:45155535-45155557 GTGAAAGGCTAGAGTGGGCTTGG - Intergenic
1148447327 17:47745456-47745478 GAGAAGGGCCAGAGGGAGCGGGG - Exonic
1148598073 17:48872767-48872789 GAACAGGGACAGACTGGGCATGG + Intergenic
1148615133 17:48996093-48996115 GGGAAGGACCCGACTGGGCAAGG - Intergenic
1148850788 17:50554119-50554141 GGGAAGGGGCAGGATGGGCAGGG + Intronic
1148851988 17:50560055-50560077 GAGAAAGGCTAGGGTAGGCATGG - Intergenic
1150005370 17:61465748-61465770 GAGATGGAACAGAGTGAGCAAGG - Intronic
1151351740 17:73535969-73535991 GAAAAGTGTCAGAGTGGGCGTGG - Intronic
1151509125 17:74547519-74547541 GACAAAGGCCCGAGTGGGGAGGG - Intergenic
1151657518 17:75502738-75502760 GAGAAGGCCCAGGGTGCGCCAGG + Exonic
1152076714 17:78164504-78164526 GGCAGGGGCCAGGGTGGGCATGG - Intronic
1152618000 17:81346519-81346541 GAGAAGCGCCTGAGTGGGGAGGG + Intergenic
1152750905 17:82062052-82062074 GAGTAGGGGCAGAGGGGGCGTGG - Intronic
1153689843 18:7581192-7581214 GAGAAGGCCAAAGGTGGGCACGG + Intronic
1153939949 18:9968868-9968890 GCGAGGGGCCAGAGTGTGAAGGG - Intergenic
1154021567 18:10668167-10668189 GAGAGGGCCCAGAGTGGGCGGGG + Intronic
1154200124 18:12293893-12293915 GAGAAGCTCCAGGATGGGCAGGG - Intergenic
1155168229 18:23248071-23248093 GACCCGGGCCAGAGTGGGCCTGG + Intronic
1155276460 18:24192654-24192676 GAGATGGGGCAGAGTGAGCCCGG + Intronic
1157556116 18:48613845-48613867 GGGGAGGGCCGGTGTGGGCACGG - Intronic
1157743018 18:50109970-50109992 GAGAGAGGCCAGACTGGGTAGGG - Intronic
1159011318 18:63061585-63061607 GAGAAGGGCCAGCCTGGGAAGGG - Intergenic
1159664390 18:71140271-71140293 GGGAAGGGACAGGGTGAGCAGGG - Intergenic
1160444751 18:78918765-78918787 CAGAAGGGCAAGACAGGGCAGGG + Intergenic
1160822078 19:1063433-1063455 GAGCAGGGGCATAATGGGCATGG - Intronic
1160822099 19:1063516-1063538 GGGTGGGGCCAGAGTAGGCATGG - Intronic
1160934286 19:1585789-1585811 CAGCAGGGCCAGACTGGGAAGGG + Intronic
1160992437 19:1865208-1865230 GAGAGGGGCAAGTGTGTGCAGGG - Intergenic
1161118377 19:2511958-2511980 GTGAAGGGCCACAGCGGGCCAGG - Exonic
1161137968 19:2631709-2631731 GTGGAGGGCCAGACTGGGCCTGG + Intronic
1161280178 19:3441667-3441689 GGGAAGGGCCAGAGGGGCCGGGG + Intronic
1161302975 19:3551824-3551846 GAGAAGGGGGAGAGAGGGAAGGG - Intronic
1161314488 19:3611505-3611527 GAGATGGGCCAGAGGGGCCTGGG - Exonic
1161608601 19:5228816-5228838 CAGCGGGGCCAGAGTGGGGAAGG - Intronic
1161853419 19:6750636-6750658 GAGAACGGCCAGAGTGGGCTTGG + Intronic
1161954998 19:7488868-7488890 GAAACGGGCCAGAGAGGGGACGG - Intronic
1162487847 19:10972655-10972677 GCAAAGGCCAAGAGTGGGCAGGG - Intronic
1162798980 19:13100863-13100885 GTGCAGGGCCAAAGTGGGCGGGG + Exonic
1162818384 19:13209180-13209202 GAGAGGGGACAGAGGGGGCCAGG - Intronic
1163125836 19:15243726-15243748 GTGAAGGGCCATTGTGAGCATGG - Intronic
1163194911 19:15710745-15710767 GAGAAAGAAAAGAGTGGGCAAGG + Intergenic
1163568086 19:18063668-18063690 GGGAAGGGCCTGCATGGGCAAGG + Intronic
1163626379 19:18392195-18392217 GAGAAAGTCCAGAGTGGGCCAGG + Intronic
1163764310 19:19154046-19154068 CAGAAGGCCCACAGTGGGCCAGG - Intronic
1163834261 19:19563545-19563567 GAGAGAGGCCAGAGTCCGCAGGG + Exonic
1163835978 19:19574406-19574428 GCCAAGGGCCACAGTGGCCACGG - Intronic
1164575016 19:29400845-29400867 AGAAAGGGCCACAGTGGGCATGG + Intergenic
1165304356 19:34994622-34994644 GAGAAAGGACAGAGTGGGCATGG - Intergenic
1165369732 19:35397401-35397423 GATAATGCCAAGAGTGGGCAGGG + Intergenic
1165432397 19:35780377-35780399 GAGAAGGGTCAGAAGGAGCAGGG - Intronic
1165449668 19:35874696-35874718 GAGAAGGGTCAGGGCGGGCTTGG + Intronic
1165706534 19:37980220-37980242 GAGAAGGAACAAGGTGGGCAGGG - Intronic
1165861387 19:38911325-38911347 CAGAGGGGCCAGATGGGGCAGGG - Intronic
1166071932 19:40393013-40393035 GGGTGGGGCCAGAGTGGACAGGG + Intergenic
1166104032 19:40588939-40588961 GGGCAGGGCCAGAGAGGGCTGGG - Intronic
1166213017 19:41319544-41319566 GAGGAGAGACAGGGTGGGCATGG - Intronic
1166687253 19:44802784-44802806 GTGATGACCCAGAGTGGGCATGG + Intergenic
1166785538 19:45364605-45364627 GTGACGGGCCAGTGTGGCCAGGG - Intronic
1166809997 19:45508883-45508905 GGGCGGGGCCAGTGTGGGCAGGG + Intronic
1167026009 19:46918754-46918776 GAAAAGGGCCAGTGTGGGATTGG + Exonic
1167093240 19:47359093-47359115 GAGTAGGATCAGAGTGGGCGAGG + Intronic
1167269710 19:48499925-48499947 GAGGTGGGGCAGAGTGAGCAGGG + Intronic
1167610705 19:50506564-50506586 GACAGGGGCCTGTGTGGGCAGGG + Exonic
1167703809 19:51066405-51066427 GAGCAGGGCCAGAGGGGGTGAGG + Intergenic
1168113376 19:54207525-54207547 AAGAAGGGCCAGGGTGGGGCTGG + Exonic
1168298550 19:55389907-55389929 GAGATGGGCCTGAGTGGGACTGG - Intronic
1168327393 19:55545239-55545261 GAGAGAGACCAGGGTGGGCAGGG - Intronic
1202639997 1_KI270706v1_random:73848-73870 GGGGAGGGACAGAGTGGGCCAGG - Intergenic
925874322 2:8298960-8298982 GAGCAGGGCCAGAGAGAACAAGG - Intergenic
926474842 2:13308769-13308791 AAGAGCGGCCAGAGTGGGCGCGG + Intergenic
926619223 2:15031987-15032009 GAGAAGGAACAGAGAGGGCAGGG + Intergenic
926692840 2:15748986-15749008 GACAAGAGCAAGAGTGGGCAGGG - Intergenic
926887846 2:17614101-17614123 GAGATGGGCCCTAGTGGGGAGGG + Intronic
926914638 2:17879678-17879700 GAGAAGGGACAGAGCGGGGTTGG - Intronic
927435654 2:23064070-23064092 GGGAAGGGCCAGAGAGGGAGGGG - Intergenic
927497280 2:23559415-23559437 GAGAAGGGCAAGACTGGGGGCGG + Intronic
927695089 2:25234427-25234449 GAGAAAAGGCAGAGAGGGCAGGG + Intronic
927710450 2:25322557-25322579 GAGAAGGGGCTGAGTGAGCGGGG - Intronic
927926695 2:27018651-27018673 CCGAAGGGGCAGAGTGGGTAGGG - Intronic
927928491 2:27028919-27028941 AGAAAGGGTCAGAGTGGGCAGGG + Intergenic
928038638 2:27851306-27851328 AACAAGGGCCAGAGTAGGGAAGG - Intronic
928328123 2:30336170-30336192 GAGAGGGGCCAGAGTGGGTGGGG - Intergenic
928360587 2:30659261-30659283 GAAAAGGGTCAATGTGGGCATGG + Intergenic
928658699 2:33479349-33479371 GGGAAAGGCCAGAAGGGGCATGG - Intronic
928960367 2:36919561-36919583 GAGAAGGGACAGAAAGGGCCTGG + Intronic
929266284 2:39922156-39922178 GAGAAGAGCATGAGGGGGCAGGG - Intergenic
930049701 2:47205524-47205546 TAGAAGGGCCATGGTGGGGAAGG + Intergenic
930086753 2:47503277-47503299 GAGAAGGGCCACAGCAGGCAGGG - Intronic
930212600 2:48657240-48657262 GAGAAGGGGAAGTGAGGGCAAGG - Intronic
930243088 2:48956094-48956116 GAGGAGGGCAAGAGAGAGCAGGG + Intergenic
930247926 2:49003872-49003894 GGGATGGGCCAGAGGAGGCAGGG - Intronic
931023411 2:58077678-58077700 GAGAACTGCCAGAGAGGGTATGG - Intronic
931300544 2:60974160-60974182 GAGAAGACCCACAGTGGGTAGGG - Intronic
932335725 2:70930416-70930438 GAGGAGGTAAAGAGTGGGCAGGG - Intronic
932448383 2:71794466-71794488 CTGCAGGGCCAGAGTGGGGAGGG + Intergenic
932569407 2:72930524-72930546 CAGAGAGGTCAGAGTGGGCAAGG + Intronic
932586898 2:73036153-73036175 GAGCAGGGCCAGCCTGGGCCAGG + Intronic
932886546 2:75554184-75554206 GACAAGGGCAGGAGGGGGCAAGG + Intronic
933779083 2:85788917-85788939 CAGACTGGACAGAGTGGGCATGG + Intergenic
934054220 2:88238597-88238619 GGGAAGGCCCAGAGAGGGTAAGG + Intergenic
934112696 2:88757390-88757412 GACAGGGGCCGGAGTGGCCAGGG + Intergenic
935124779 2:100213846-100213868 GAGAGGTGCCAGAGTGAGCCGGG - Intergenic
935729724 2:106055426-106055448 GAGCAGTGCCACAGTGGGGATGG + Intergenic
935765071 2:106359008-106359030 GAGAAGGGCCAGAGGCAGGAGGG - Intergenic
936163903 2:110103851-110103873 GACAGGGGCCGGAGTGGCCAGGG + Intronic
937229902 2:120392090-120392112 GAGAGGGGACAGAGTGGGCTGGG - Intergenic
938393166 2:130921032-130921054 GAGATGGGGCATAGTGGGTAGGG - Intronic
938735651 2:134184309-134184331 TAGAGAGGCCAAAGTGGGCAGGG - Intronic
939402928 2:141718007-141718029 GAGAATGGCCACTGTGGCCATGG + Intronic
939543353 2:143520437-143520459 AAGAAGGGGAAGAGTGGGTAGGG + Intronic
942042670 2:172081294-172081316 GAGAAGGGCCAGTCTGGGGAGGG - Exonic
942606109 2:177692965-177692987 GGAAAGGGCCAGGCTGGGCAGGG - Intronic
943396230 2:187338683-187338705 CAGAAGGGGCAGAGGTGGCAGGG + Intergenic
943778661 2:191796588-191796610 TATATGGGCCAGAGTGGGAAAGG + Intergenic
944180222 2:196883277-196883299 GAGAAGCACCAATGTGGGCAAGG + Intronic
944685258 2:202112320-202112342 CAGCAGGCCCAGAGAGGGCACGG + Intronic
944922425 2:204429318-204429340 GAGAAGCGGCACAGTGAGCAAGG + Intergenic
945194899 2:207228610-207228632 GAACAGGGCCAGAGTGGTCTTGG - Intergenic
945988982 2:216377646-216377668 GAGAAGAGCCAGAGAGAGCAAGG - Intergenic
946049550 2:216850446-216850468 GAGAAGGGTCAGGGTGGTCTGGG + Intergenic
946179541 2:217941372-217941394 GGCAAGGGGCAGAGTGGGCCAGG + Intronic
946235802 2:218323655-218323677 GAGGCGGGCCAGGGTGGCCACGG + Intronic
947818625 2:233055108-233055130 GAGAGGGGCCGATGTGGGCAGGG + Intergenic
947833165 2:233156225-233156247 GACAAGGCCAAGACTGGGCAGGG + Intronic
948237902 2:236404025-236404047 GAAGTGGGCCAGAGTGTGCAAGG - Intronic
948650495 2:239440522-239440544 AAGCTGGGCCAGGGTGGGCAAGG - Intergenic
948791921 2:240383600-240383622 GAGAGGGGCCAGCGTGGCCTGGG + Intergenic
948947673 2:241229399-241229421 GAGCAGGTCCTGAGCGGGCACGG + Exonic
1168754666 20:308091-308113 GAGGAGGCCCAGAGGAGGCAGGG - Intergenic
1169147010 20:3259339-3259361 GTGAAGGCCCAGGGTGGGGAAGG + Intronic
1169191926 20:3663299-3663321 GAGCAGGGACAGAGAGGCCAGGG + Intronic
1170510188 20:17068370-17068392 GAGAAGACCCAGAGGAGGCAGGG + Intergenic
1170614150 20:17935598-17935620 GAGAAGTGCCAGACTTGGCTGGG + Intergenic
1170644790 20:18188139-18188161 GAGAAGGGCCAGGATAGGCCAGG - Exonic
1171495615 20:25553037-25553059 GTGGAGGGCCACAGTGAGCAAGG - Intronic
1172055120 20:32149606-32149628 GCGAAGGGCCAGAGTGAGGCTGG - Intronic
1172481105 20:35271844-35271866 GGGCCGGGCCAGGGTGGGCATGG + Intronic
1172624093 20:36337502-36337524 GAGATGGGCCTGAGAGGGCTGGG + Intronic
1172765728 20:37349791-37349813 GAGAAGGCAAAGAGAGGGCAGGG - Intronic
1172791169 20:37506479-37506501 GCAAAGGGCGAGGGTGGGCAAGG - Intronic
1172941680 20:38658684-38658706 GGCAGGGGGCAGAGTGGGCAGGG + Intergenic
1173177750 20:40777339-40777361 GAGGAGGGGCAGGGAGGGCAGGG + Intergenic
1173583022 20:44160478-44160500 GGCAAGGGCGGGAGTGGGCAAGG + Intronic
1173811912 20:45960921-45960943 GAGAGGGTCTAGAGTGGGCTTGG - Intronic
1174280207 20:49433733-49433755 GAGAAGGGGCCGGGTGGGTAGGG + Intronic
1174570478 20:51497694-51497716 GAGGAGGGGCAGATTGGCCAGGG + Intronic
1174932015 20:54826513-54826535 GAGGAGGGCCTGAGTGCTCATGG + Intergenic
1175723813 20:61303433-61303455 GAGCAGGGCCAGACGGGGCAGGG - Intronic
1175777268 20:61661176-61661198 GGGAAGGGCCAGAAGGGCCATGG + Intronic
1175813203 20:61869893-61869915 GAGCTGGGCCCCAGTGGGCAGGG + Intronic
1175835205 20:61989307-61989329 GGGAAGCTGCAGAGTGGGCAGGG + Intronic
1176309678 21:5142944-5142966 GAGGAGGGCCAGAGCAGGAAGGG + Intronic
1177748533 21:25251420-25251442 GAGAGAGGCCACAGTAGGCAGGG + Intergenic
1177844090 21:26268337-26268359 GTGATGGGCCAGAGTGGTCTTGG + Intergenic
1178035719 21:28580385-28580407 GAGAAGGGCTAGCACGGGCAGGG + Intergenic
1178070182 21:28956115-28956137 GAGAAGGGTCAGGGAGAGCAGGG + Intronic
1178427582 21:32491391-32491413 TAGAAGGGGCACAGTGGGCCGGG + Intronic
1179053809 21:37913919-37913941 GAGAAGAGCGTGAGAGGGCAAGG + Intronic
1179164679 21:38926163-38926185 GAGAAGGTCCAGGATGGGCTGGG + Intergenic
1179478797 21:41665023-41665045 GAGAAGGAGCAGATTGGGCTGGG - Intergenic
1179517562 21:41919408-41919430 GAGAAGGGGCAGGAAGGGCAGGG - Intronic
1179847380 21:44119089-44119111 GAGGAGGGCCAGAGCAGGAAGGG - Intronic
1180177963 21:46099159-46099181 AAGAAAGGCCAGACCGGGCACGG + Intronic
1180742757 22:18065208-18065230 GAGAGAGGGCAGAGTGGGCCAGG + Intergenic
1181000403 22:19985390-19985412 GGGAGGGGCCAGAGTGACCAGGG + Intronic
1181077893 22:20393683-20393705 GAGAAGGGGGAGTGGGGGCAGGG + Intergenic
1181175529 22:21032664-21032686 GAGGTCGGGCAGAGTGGGCAGGG - Intronic
1181922957 22:26334792-26334814 GAGAAGGGCCAGAGTGGGCAGGG + Intronic
1183248369 22:36711055-36711077 GTCAAGGCCCTGAGTGGGCAAGG - Intergenic
1183346946 22:37313222-37313244 GGGCAGGGCCAGAGTGGGTGAGG - Intronic
1183458140 22:37933818-37933840 GTGGAGGGCCAGAGAGGTCAAGG + Intronic
1183479430 22:38055276-38055298 AAGAAGGGCCAGAGTGGGTAGGG + Intergenic
1183909008 22:41064586-41064608 AAGAAGGGCCAGGGTGGGGCTGG + Intergenic
1184080222 22:42214104-42214126 GAGAATCTCCAGTGTGGGCAAGG - Exonic
1184335962 22:43853426-43853448 GACGTGGCCCAGAGTGGGCAGGG - Intronic
1184534578 22:45077787-45077809 GAGAAGGCAGAGAGTGTGCAGGG + Intergenic
1184907375 22:47497892-47497914 GGGCAGGGCCTGAGTGGGGAGGG + Intergenic
1184931041 22:47681670-47681692 GAGAAGGGCCATAGAAGGCATGG + Intergenic
1185211579 22:49573541-49573563 AGCAAGGCCCAGAGTGGGCAGGG + Intronic
1185379662 22:50502626-50502648 CGGAAGGGCCAGAGTGGGCAAGG - Intergenic
949524471 3:4889507-4889529 GAGAGAGGCCTCAGTGGGCATGG - Intergenic
950074907 3:10180523-10180545 GAGAGGGGCCAGCATGTGCAAGG + Intronic
951246154 3:20343914-20343936 GAGAAGGGCAGAAGTGGTCAAGG + Intergenic
951344008 3:21523856-21523878 GAGGAGGGCAAGACTGGGGAAGG + Intronic
952818085 3:37462900-37462922 AGGAAGGGTCAGAGTGGCCAGGG + Intronic
952881060 3:37986628-37986650 GGGCAGGACCACAGTGGGCAAGG + Intergenic
953011479 3:39029519-39029541 GGGAAAGGACATAGTGGGCAGGG + Intergenic
953049742 3:39329855-39329877 AAGAAGGGCATGAGTAGGCAGGG + Intronic
953237339 3:41118171-41118193 GAGAAGGGTCAGAGTCAGCCAGG + Intergenic
953540898 3:43817219-43817241 GAGCAGGGCCAGGGTGGGGAAGG + Intergenic
953827005 3:46262048-46262070 GACATGGGGCAGAGTGGGAAGGG - Intronic
954116440 3:48469330-48469352 GGGCAGGGCTAGAGTTGGCAGGG + Intronic
954194753 3:48990051-48990073 GAGAAGCCCCAGCGTGGGCTGGG + Exonic
954685243 3:52366674-52366696 GAGCAGGGCTAGAGTGGGCTGGG - Intronic
954707198 3:52487377-52487399 GAGGAGGGCCAGGGTGAACAGGG + Exonic
956925194 3:73979554-73979576 GATAAAGGCCAGATTGGCCAAGG - Intergenic
956999000 3:74862714-74862736 GAGAAAGGCCAGAATGGGTGTGG - Intergenic
957255078 3:77825938-77825960 GAGATGGGCTTGAGTAGGCATGG - Intergenic
957529953 3:81428376-81428398 GAGAGGGGGCAGACTGGGAACGG - Intergenic
958124003 3:89332067-89332089 GGGAAGGGCCAGAGCGAGAATGG - Intronic
958484478 3:94686339-94686361 CAGAAGGGGGAGAGTGGGAAGGG + Intergenic
958699626 3:97571295-97571317 AATAAGGGCCAGAGGTGGCATGG + Intronic
959083560 3:101827822-101827844 GAGGAGGGCCAGAGGAGGCAGGG - Exonic
961179756 3:124867311-124867333 GAGAAGGACCAGGTTAGGCAAGG - Intronic
961481455 3:127183443-127183465 GAGAAGGGCCATAGCAGGGAAGG - Intergenic
961626053 3:128264560-128264582 GAGAGGAGCCAGATGGGGCAGGG - Intronic
962658165 3:137570780-137570802 CAAAAAGGCAAGAGTGGGCATGG - Intergenic
962854231 3:139329651-139329673 GAGCAGGGACAGCGTGGACAAGG - Intronic
963091985 3:141490890-141490912 GAGGAGGGGCAGAGTAGGGAGGG - Intronic
963258992 3:143175412-143175434 GAGAGGGGCAAGAATGGGCCTGG + Intergenic
964259002 3:154812077-154812099 GACACTGGCCAGAGTGGCCAAGG - Intergenic
964290679 3:155176955-155176977 GAGGATGGGCAGAATGGGCATGG + Intronic
966183099 3:177204376-177204398 GAGCGTGGCCAGAGTGGGCGCGG + Intergenic
966731827 3:183158095-183158117 GGGAAGGGCCAGAGGAGGGAAGG - Intronic
966735613 3:183184474-183184496 GAGAAGGACAAGAATGGGAAAGG + Intronic
966869967 3:184284003-184284025 GAGAGGGGCCAGCCTTGGCATGG + Intronic
967311801 3:188113242-188113264 GAGAAGGCCCAGAGCTGGAAAGG + Intergenic
1202738554 3_GL000221v1_random:33544-33566 GGGGAGGGACAGAGTGGGCCAGG + Intergenic
968709403 4:2102139-2102161 GTGAAGGGCTAGGGAGGGCATGG - Intronic
968737520 4:2305015-2305037 GAGAAAGGGCAGGGTGGGCCAGG - Exonic
968866044 4:3212585-3212607 GGCCCGGGCCAGAGTGGGCAGGG - Exonic
969265920 4:6064018-6064040 GGGAAGAGCAAGAGTGGGAAGGG - Intronic
969943006 4:10753709-10753731 GAGCAGGGACAGAGTTGGGATGG - Intergenic
972001629 4:34043309-34043331 AAGAAGAGCCAAAATGGGCAAGG + Intergenic
972782389 4:42297349-42297371 GAAATTGGCCAGACTGGGCATGG + Intergenic
972960640 4:44448396-44448418 GGGAAGGGCGAGGGTGCGCAGGG + Exonic
973370244 4:49240191-49240213 GGGGAGGGACAGAGTGGGCCAGG - Intergenic
973390785 4:49555229-49555251 GGGGAGGGACAGAGTGGGCCAGG + Intergenic
973614634 4:52666178-52666200 GAAAAGGGTCAGGCTGGGCATGG + Intergenic
973830819 4:54757018-54757040 GAGTAGGGACTGAGTGGGAAGGG + Intergenic
974000462 4:56506330-56506352 GATAAGGGCTAGGGTGGGCAGGG - Intronic
976113042 4:81697377-81697399 GAGAAGGGTGGGAGTGGGAAAGG - Intronic
976783279 4:88786137-88786159 GATAGGGGCCAGACAGGGCAGGG - Intronic
976818160 4:89174511-89174533 AAGAAGGGGCAGAGTGAGGATGG - Intergenic
976934497 4:90612863-90612885 AAGAAGGGTCAGAGTGGTGAGGG + Intronic
978631604 4:110753415-110753437 GAGCAGAGCCAGCATGGGCATGG + Intergenic
979183888 4:117763501-117763523 GAGGAGGCACAGAGTGTGCATGG - Intergenic
981415665 4:144490270-144490292 GAGAGTGGCCAGAGTAGGCTTGG - Intergenic
982354340 4:154450156-154450178 GAGAAAGGCGACAGTGGGAAAGG + Intronic
983867641 4:172788053-172788075 GAGAAGGAGCAGGCTGGGCATGG + Intronic
1202767357 4_GL000008v2_random:159707-159729 GGGGAGGGACAGAGTGGGCCAGG - Intergenic
985524003 5:392455-392477 AGGCAGGGCCAGAGTGTGCACGG + Intronic
985879639 5:2628570-2628592 GAGCAGGAGCTGAGTGGGCAGGG - Intergenic
985912137 5:2892830-2892852 GAGGTGGGCCAGTGGGGGCAGGG + Intergenic
987446167 5:18022085-18022107 GAGGGGGGCCGGAGTGGGTAAGG - Intergenic
988491362 5:31708188-31708210 GGGAAGGGCCAGAAAGGGCCAGG - Intronic
988514324 5:31891640-31891662 GAGAAGTGGCATTGTGGGCAGGG + Intronic
990512223 5:56499133-56499155 AAGCACGGCCAGAGTGGGCGCGG + Intergenic
993504243 5:88692051-88692073 GAGAAGTGCCCAAGTGGGCGCGG - Intergenic
994063535 5:95508628-95508650 GAAAAGGGCCAGAGAATGCAGGG - Intronic
994369787 5:98954917-98954939 AAGAAGGGCCAGGGTGGGGCTGG + Intergenic
995472077 5:112513226-112513248 GAGATGGGGAAGAGTGGGAAAGG - Intergenic
997533072 5:134594524-134594546 GAGAAGTGTCAGAGAGGGGAGGG + Intergenic
998485503 5:142498442-142498464 AAAAGGGGCCAGAGTGGGCTGGG + Intergenic
998522967 5:142817281-142817303 GAGCAGGAGCAGAGTTGGCAAGG + Intronic
999120936 5:149208952-149208974 CAGAATGGCCAGCCTGGGCAAGG + Intronic
999193080 5:149763148-149763170 CTGCAGGGCCAGAGTGGGGAGGG - Intronic
999203472 5:149832624-149832646 GAGAGAGGCCAGAGTGAGGAAGG - Intronic
999303822 5:150507407-150507429 GAAAAGGGCCAGGCTGGCCAGGG - Intronic
999319350 5:150603795-150603817 GAGGTGGGCCAGAGAGGGCAAGG - Intronic
1000121014 5:158197923-158197945 GAGAAGAGGCAGAGCGGACAGGG + Intergenic
1001752853 5:174144887-174144909 GAGAGGGGCCTGAGTGGCTAAGG + Intronic
1002102060 5:176862574-176862596 GCCAGGGGCCAGACTGGGCAGGG - Intronic
1002259929 5:177985828-177985850 GGGCAGGGCGAGTGTGGGCACGG + Intergenic
1002259937 5:177985858-177985880 GGGCAGGGCGAGTGTGGGCAGGG + Intergenic
1002259941 5:177985873-177985895 GGGCAGGGCGAGTGTGGGCAGGG + Intergenic
1002259945 5:177985888-177985910 GGGCAGGGCGAGTGTGGGCAGGG + Intergenic
1002259961 5:177985961-177985983 GGGCAGGGCGAGTGTGGGCACGG + Intergenic
1004166576 6:13262092-13262114 GAGGAGGACCAGAGTGGGATAGG + Intronic
1004291080 6:14368141-14368163 TAGAAAAGCCACAGTGGGCAGGG + Intergenic
1004477393 6:15986520-15986542 GAGAGGTCCCAGAGAGGGCATGG + Intergenic
1004505907 6:16246481-16246503 GAGGAGGGCCATGGTTGGCAAGG + Intronic
1004626166 6:17379309-17379331 GAGAGGGGCCACAAAGGGCATGG + Intergenic
1005262104 6:24072197-24072219 GAGCAGGGCCAGTGTGGGTGGGG - Intergenic
1005594466 6:27366100-27366122 TAGAAGGGCCAGAATAGACATGG + Intergenic
1005724241 6:28633493-28633515 GCGGAGGCTCAGAGTGGGCAAGG + Intergenic
1006296913 6:33173820-33173842 GAGCTGGGGCTGAGTGGGCAGGG + Intronic
1006389036 6:33747884-33747906 GAGAGGGGGCAGTGTGGGGAAGG + Intergenic
1006452360 6:34112550-34112572 GAGAAGGGCCTGAGTGTGGAAGG + Intronic
1006921873 6:37632829-37632851 GAGAAGGGTCAGGGAGGGAAGGG - Exonic
1007109580 6:39305137-39305159 GAGGAGTGCCACACTGGGCAGGG - Intronic
1007250168 6:40489955-40489977 CAGAAAGGCCAGAGAGGTCAAGG - Intronic
1007257187 6:40537566-40537588 GACAAGGGTCAGAGTGGTCAGGG - Intronic
1007765867 6:44159375-44159397 GAGATGGGGGAGAGTGGGCTGGG + Intronic
1007829050 6:44624455-44624477 GAGAAAGTCCAGAGTGGGGGTGG + Intergenic
1009195826 6:60683354-60683376 GAGATGGGCCAGAGAGTGAAGGG + Intergenic
1009404890 6:63300118-63300140 GGGCAGGGCCATAGTGGGCTTGG - Intronic
1010046233 6:71447313-71447335 GAGAAGGGGCAGGGAGGGCAAGG + Intergenic
1010766417 6:79781022-79781044 CAGAAGGGCCACAGTGTTCAGGG + Intergenic
1012250544 6:96975578-96975600 GAGAGGGGACAGAGTGGGAAGGG + Intronic
1014758363 6:125327052-125327074 CAGAAGGACCAGAGGGGGGAAGG - Intergenic
1015823059 6:137283338-137283360 GAGAGGGGACAGGGTGGGGAGGG - Intergenic
1016809681 6:148247839-148247861 GGGAGGGGCCAGAGTGGCCAGGG - Intergenic
1018128595 6:160706161-160706183 GAGAAGGGAGAGAGGGAGCAAGG - Intronic
1018343388 6:162876254-162876276 GAGGAGGTCAAGAGTGGGAAGGG + Intronic
1018876674 6:167827343-167827365 GAGAAGGGGCGGAGGGGGGAGGG - Intronic
1019481449 7:1268710-1268732 CGGAAGGGCCAGGGTGGCCAGGG - Intergenic
1019569814 7:1705656-1705678 GGGCAGGGCCAGAAAGGGCAAGG - Intronic
1019625244 7:2012599-2012621 GAGGATGGACAGAGGGGGCAGGG + Intronic
1019856743 7:3616376-3616398 GAGCAGGGCCAGGTTGTGCAGGG - Intronic
1020129708 7:5552881-5552903 GAGAAGGAGCAGAGTGTTCAAGG + Intronic
1020261998 7:6536058-6536080 GAGAGAGGTCAGAGGGGGCATGG - Intronic
1021874556 7:25036508-25036530 GAGAAGGGCCAGATTAAGAAAGG + Intergenic
1022019166 7:26382109-26382131 GACAAGAGCCAGTGTGGGCTGGG - Intergenic
1022737963 7:33093630-33093652 GAGAAGGGTCAGTCTGGGCCTGG + Intergenic
1023890855 7:44391018-44391040 GACAAGGGCCAGGGTGGACAGGG + Intronic
1024030226 7:45454421-45454443 GAGAAGACCCAGTGTGGACAGGG + Intergenic
1024920003 7:54545739-54545761 GGGAAGGGAAAGAGAGGGCAGGG + Intronic
1025014217 7:55425904-55425926 GAGAGGGGCCAAGGTGCGCAGGG - Intronic
1025254602 7:57375076-57375098 GAGAATGGCCACAGTTGGCTTGG - Intergenic
1026642414 7:72139353-72139375 TAGAAGACCCAGGGTGGGCATGG - Intronic
1026907408 7:74070548-74070570 AGGAAGGGCCAGAATGGGAATGG - Intergenic
1028737774 7:94236871-94236893 TAGAAGGCACAGAATGGGCAAGG + Intergenic
1028873971 7:95799899-95799921 GATGTGGGCAAGAGTGGGCAGGG + Intronic
1028954461 7:96673570-96673592 GTGAAGGTCCAGCCTGGGCAAGG - Intronic
1030161342 7:106511373-106511395 GGCAAGAGGCAGAGTGGGCAGGG - Intergenic
1031073433 7:117188580-117188602 CAGAAGGGCCAGGGTGGGTGTGG - Intronic
1031865996 7:127039645-127039667 GGGAAGGGCAAGAGAGGGGAAGG + Intronic
1031866004 7:127039667-127039689 GGGAAGGGCAAGAGAGGGGAAGG + Intronic
1031866012 7:127039689-127039711 GGGAAGGGCAAGAGAGGGGAAGG + Intronic
1031866031 7:127039755-127039777 GAGAAGGGTAAGAGAGGGGAAGG + Intronic
1032074310 7:128829409-128829431 GACCAGGGGCAGAGTGGTCAGGG - Intergenic
1032263887 7:130357021-130357043 GTGAAGGGCCAGAGAGGACCGGG + Intronic
1032388157 7:131538683-131538705 GAGAGGAACCAGAGCGGGCAGGG - Intronic
1032826373 7:135572843-135572865 GAAAAGTGCCAGACTGGGCGTGG - Intronic
1033270637 7:139930034-139930056 GAGGCAGGCCAGAGAGGGCATGG - Intronic
1033394905 7:140964388-140964410 GAAAAAGGCCAGAGTGGGAGAGG - Intergenic
1033457066 7:141512123-141512145 GGGAAGGGCAGGAGTGGGCGAGG - Intergenic
1034191325 7:149215624-149215646 TAGAAGAGCCAGTGTGGGCCTGG + Intronic
1034313572 7:150110728-150110750 TAGAAGGGCCAGAGCCAGCAGGG + Intergenic
1034451168 7:151138112-151138134 GGGAAGGGTCAGACTGGGAAGGG - Intronic
1034793324 7:153990068-153990090 TAGAAGGGCCAGAGCCAGCAGGG - Intronic
1035334169 7:158114900-158114922 GAGAAGGGGCAGGGGAGGCACGG + Intronic
1036448887 8:8847696-8847718 CTGAAGGTCCAGAGTGTGCAGGG - Intronic
1036924418 8:12891013-12891035 CAGAAGGGACAGTGTGAGCAAGG - Intergenic
1037337865 8:17809205-17809227 CAGAAGAGACAGAGAGGGCAGGG + Intergenic
1037802015 8:22041045-22041067 GATGAGAGCCAGAGAGGGCAAGG - Intergenic
1038781253 8:30569921-30569943 GAGAAGGTCCAGGGTGTCCAGGG + Intronic
1040462181 8:47659632-47659654 GAGAAGGGCCAGAGCGAGGGCGG - Intronic
1040986129 8:53296208-53296230 GAGGGTGGCCAGAGAGGGCATGG - Intergenic
1041431060 8:57781045-57781067 GACAAGGGCCAGTGAGGACATGG + Intergenic
1041933650 8:63313433-63313455 GAGCAGTGCCAGGGTGGGCTGGG + Intergenic
1042271754 8:66962387-66962409 GAGCAGGGCCTGTGTGGCCAGGG + Exonic
1042893651 8:73642163-73642185 GAGAAAGGCAAGAGTGGTTATGG - Intronic
1044694172 8:94906210-94906232 GAGAAGAACCAAAGAGGGCAGGG - Intronic
1047158338 8:122347794-122347816 GAGAAGGAACAAAGTGAGCAAGG + Intergenic
1047222711 8:122931288-122931310 GAGAAGGGCCAGAGTTTGTGCGG + Intronic
1047225974 8:122955758-122955780 GAGAATGGCCAGAGGTGGCCAGG - Intronic
1047291165 8:123531676-123531698 GAGATTGGCCAGGATGGGCAGGG - Intronic
1047385821 8:124408249-124408271 GACAGGGGCCAGAGAGGCCATGG - Intergenic
1048791539 8:138108782-138108804 AAGAAGGGCCAGAATGGGGGTGG - Intergenic
1048927972 8:139287754-139287776 GCCAAGGGCAGGAGTGGGCAGGG - Intergenic
1048975124 8:139667147-139667169 CAGAAGCGCCCGAGTGGGCTGGG + Intronic
1049080392 8:140438505-140438527 GAAAAGGGAAAGTGTGGGCAGGG + Intronic
1049377945 8:142297988-142298010 TAGAAGGGCCAGGCTGGCCATGG + Intronic
1049641227 8:143716838-143716860 GAGAAGGGCCTGAGCGGTTATGG + Intronic
1049653571 8:143788046-143788068 GAGAAGGGCCGGGTGGGGCAGGG - Intergenic
1049782164 8:144434056-144434078 AAGGAGGGCCAGGCTGGGCATGG + Exonic
1051789364 9:20783083-20783105 GGGCAGGGCAAGAGTTGGCAGGG + Intronic
1051842546 9:21414614-21414636 GAGAAGGGCCACAGGGAGCATGG + Intronic
1052376972 9:27728529-27728551 GGGTAGGGCCAGTGAGGGCAAGG + Intergenic
1052704935 9:31983279-31983301 GAGAAGAGCTAGAGAGGACAGGG + Intergenic
1052857157 9:33414665-33414687 GAGAATGGACTGAGTGGGCAGGG + Intergenic
1052876447 9:33570298-33570320 GGGGAGGGACAGAGTGGGCCAGG + Intronic
1053151718 9:35748073-35748095 GAGAAGAGCCTGAATGGGAAAGG + Intronic
1053499560 9:38574046-38574068 GGGGAGGGACAGAGTGGGCCAGG - Intronic
1055487211 9:76767857-76767879 GAGAATAGCCATAGTGGGCATGG - Intronic
1055747029 9:79459431-79459453 GAGAAGGGCCAGTTTGTGAATGG - Intergenic
1055781857 9:79829241-79829263 GAGAAGGAGCAGAGTGGCCCTGG - Intergenic
1056587159 9:87936173-87936195 GGGGAGGGACAGAGTGGGCCAGG - Intergenic
1057141033 9:92726932-92726954 GAGAAGGGGCAGAATGTGCTGGG + Intronic
1057214846 9:93222151-93222173 GGGAAGGGGCAGAGGGAGCAGGG - Intronic
1057302826 9:93896463-93896485 GGGAAGGAACAGAATGGGCAGGG - Intergenic
1057700735 9:97361691-97361713 GAGAAGGGCCTGAGGGTGTAAGG - Intronic
1058138323 9:101332228-101332250 AAGAAAGGCTAGAGTGGGCTGGG - Intergenic
1059664602 9:116434662-116434684 GAGAAGCCCAAGAGTGGTCAAGG + Intronic
1060005785 9:119998214-119998236 GAGTAGGCCCAGAATGAGCAAGG + Intergenic
1060658289 9:125387883-125387905 GTGAAGGCCCAGAGGGGACACGG + Intergenic
1060662530 9:125412894-125412916 GGGAAGGCCCAGAGCAGGCAAGG - Intergenic
1060783777 9:126433249-126433271 GAGAAGGGGCTGGGAGGGCAGGG - Intronic
1060891229 9:127189800-127189822 GCGAGGGGCCAGAGCGGGCCAGG + Intronic
1061616749 9:131785318-131785340 GACAGGGGGCAGAGGGGGCAGGG + Intergenic
1061670800 9:132187140-132187162 CAGGGGGGCCACAGTGGGCATGG - Intronic
1061756966 9:132821268-132821290 GGGAAGGGACAGAGTGAGCGTGG - Intronic
1061869622 9:133513774-133513796 GGGTGGGGCCAGAGTGGGCTGGG + Intergenic
1062004644 9:134233120-134233142 GAGCAGGGCCAGAGTCGGCATGG - Intergenic
1062184366 9:135209653-135209675 GATAAGGGCAGGAGTGGGAATGG - Intergenic
1062499761 9:136847392-136847414 GGGCGGGGCCTGAGTGGGCAGGG - Exonic
1062518180 9:136946367-136946389 GAGAGGGCCCCGAGGGGGCAGGG + Intronic
1203707286 Un_KI270742v1:63991-64013 GGGGAGGGACAGAGTGGGCCAGG + Intergenic
1203548111 Un_KI270743v1:144579-144601 GGGGAGGGACAGAGTGGGCCAGG - Intergenic
1185650678 X:1645843-1645865 GAGGAGGACCAGAGCAGGCAGGG + Intergenic
1186388112 X:9130579-9130601 GAGCAGGGCCACAGTGAGCTGGG + Intronic
1187492090 X:19761350-19761372 GAGAAGGGAGAGAGTGGGGAGGG + Intronic
1187600558 X:20824565-20824587 GAAAAATGCCAGGGTGGGCATGG + Intergenic
1187982592 X:24774193-24774215 CAGAGAGGGCAGAGTGGGCAAGG - Intronic
1188042025 X:25379291-25379313 GAGATGGCCTAGAGTGGGAAAGG + Intergenic
1188694928 X:33178356-33178378 GAGCAGGGCCATGGTGGTCAAGG - Intronic
1189206213 X:39241412-39241434 GAGAATGGCCAGGGTCGGGAGGG - Intergenic
1189322032 X:40092541-40092563 GAGCAGGGCCTCAGTGGGCTGGG - Intronic
1189487962 X:41447170-41447192 CAGGAGGGCCAGGGTGGTCAAGG + Intergenic
1190326930 X:49212285-49212307 GAGAAGAGCCACATAGGGCAAGG + Exonic
1190427317 X:50345542-50345564 AGGAAGGGAGAGAGTGGGCAAGG - Intronic
1190714190 X:53090368-53090390 GAGGAGGCCCAGAGAGGGAAGGG - Intergenic
1191053978 X:56223030-56223052 AAGTGCGGCCAGAGTGGGCACGG + Intergenic
1191692704 X:63957385-63957407 GAGAAGGGAGAGAGTGGTCTTGG + Intergenic
1192331553 X:70179453-70179475 GAGATGGGGCAGAGAGAGCAGGG + Intronic
1192480481 X:71480981-71481003 GAGAAGGGACAGGATGGGCTGGG + Intronic
1195177071 X:102322079-102322101 GTGATGGGGAAGAGTGGGCAAGG + Intronic
1195181793 X:102365014-102365036 GTGATGGGGAAGAGTGGGCAAGG - Intronic
1195259587 X:103118827-103118849 CAGAAGGGGGAGAGTGGGAAGGG - Intergenic
1195321202 X:103723448-103723470 TAAAAATGCCAGAGTGGGCAGGG - Intronic
1196056683 X:111363472-111363494 GAGAAAGGCCAGATTGGGTATGG + Intronic
1196445849 X:115845664-115845686 GAAAAGGGCCAGAGGGTTCATGG + Intergenic
1196446520 X:115848645-115848667 GAAAAGGGCCAGAGGGTTCATGG + Intergenic
1196449199 X:115860579-115860601 GAAAAGGGCCAGAGGGTTCATGG + Intergenic
1196451209 X:115869530-115869552 GAAAAGGGCCAGAGGGTTCATGG + Intergenic
1196451880 X:115872513-115872535 GAAAAGGGCCAGAGGGTTCATGG + Intergenic
1196740811 X:119024267-119024289 CAAAAGAGCCAGAGTGGGCCAGG - Intergenic
1197151456 X:123224400-123224422 GAGAAGGAGCAGACTGGGAATGG - Intronic
1197294315 X:124698933-124698955 TAGAACAGCCAGAGTGGGGAGGG - Intronic
1197607840 X:128606487-128606509 AAGCGCGGCCAGAGTGGGCACGG - Intergenic
1199881310 X:151975572-151975594 GAGAAGGCACAGAGGGGGAAGGG + Intergenic
1200059786 X:153479116-153479138 GGGAAGGGCTGGGGTGGGCAGGG + Intronic
1200164281 X:154025426-154025448 GAGCAGAGCAGGAGTGGGCAAGG + Intronic
1200254067 X:154569969-154569991 GGGAAAGGGCAGAGTTGGCAGGG - Intergenic
1200263702 X:154634439-154634461 GGGAAAGGGCAGAGTTGGCAGGG + Intergenic