ID: 1181928243

View in Genome Browser
Species Human (GRCh38)
Location 22:26377687-26377709
Sequence CATCAGAGGCAGGCGGAGGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 341}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1181928243_1181928251 8 Left 1181928243 22:26377687-26377709 CCAACCTCCGCCTGCCTCTGATG 0: 1
1: 0
2: 1
3: 19
4: 341
Right 1181928251 22:26377718-26377740 CCCCTACAGCCAGATCACCGTGG 0: 1
1: 0
2: 0
3: 14
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1181928243 Original CRISPR CATCAGAGGCAGGCGGAGGT TGG (reversed) Exonic
900395391 1:2451233-2451255 CAGCCAAGGCAGGCGGTGGTGGG + Intronic
900505356 1:3027613-3027635 CACCAGGGGCAGGCGGGGGGGGG + Intergenic
900749162 1:4383365-4383387 CATCAGGGACAGTGGGAGGTGGG + Intergenic
900829982 1:4959055-4959077 CACCAGAGGCCGGAGGAGGCCGG - Intergenic
900875128 1:5337045-5337067 CAACAGACGGAGGCGGAGGCAGG + Intergenic
900950854 1:5857677-5857699 CAACAGGGGCAGGAGGAGGGAGG + Intergenic
901749512 1:11397307-11397329 CATCTGAGGCAGTGGAAGGTGGG - Intergenic
901961318 1:12828583-12828605 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901967910 1:12883188-12883210 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901975714 1:12942318-12942340 CCTCAGAGGGAGGCGGCGGAAGG + Exonic
901983308 1:13053453-13053475 CCTCAGAGGGAGGCGGCGGAAGG + Intronic
901985702 1:13073878-13073900 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
901996107 1:13152889-13152911 CCTCAGAGGGAGGCGGCGGAAGG + Intergenic
901998780 1:13175465-13175487 CCTCAGAGGGAGGCGGCGGAAGG - Intergenic
902009460 1:13259447-13259469 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902017266 1:13318592-13318614 CCTCAGAGGGAGGCGGCGGAAGG - Exonic
902392441 1:16114524-16114546 AATCAGGGACAGGCGTAGGTGGG + Intergenic
904360565 1:29968714-29968736 AAGCAGAGGCAGCAGGAGGTGGG + Intergenic
904422030 1:30400363-30400385 CATTAGAGGCAGCCGGATCTGGG - Intergenic
906519416 1:46458446-46458468 CCTCTGAGGCAGGCAGAGGCTGG - Intergenic
906557194 1:46723157-46723179 CATCTCAGGGAGGAGGAGGTGGG + Intergenic
909558073 1:76977479-76977501 TATCAGAGGCTGGGGAAGGTAGG - Intronic
910258129 1:85269723-85269745 GAACAGAGGCAGGAGGGGGTTGG + Intronic
910602185 1:89043701-89043723 CACCAGAGGGAGGCTGAGGCCGG - Intergenic
910720437 1:90280397-90280419 CACAAGAGCCAGGCAGAGGTTGG + Intergenic
911090489 1:94013414-94013436 GCCCAGAGGCAGGTGGAGGTGGG + Intronic
911352564 1:96772576-96772598 CACCAGAGGCTGGGGGAGGGAGG - Intronic
912927096 1:113922826-113922848 CTTGAGAGGGAGGCTGAGGTTGG - Intergenic
913347545 1:117823558-117823580 CTTCAGAGCCAGGCAGAGTTGGG + Intergenic
913411957 1:118561961-118561983 CACCAGAGGCTGGAGGAGGCAGG + Intergenic
914747452 1:150510643-150510665 CTTGAGAAGCAGGAGGAGGTGGG + Intronic
914762984 1:150614092-150614114 CAGCAATGGCAGGCTGAGGTGGG - Intronic
914901801 1:151715097-151715119 CACCATAGGCAGGTGGAGGACGG + Intronic
915261020 1:154676899-154676921 CATAAGTGGCTGGCAGAGGTAGG + Intergenic
915565735 1:156711591-156711613 AATCACAGGCAGGGAGAGGTTGG - Intergenic
916674481 1:167054303-167054325 CAGCAGAGGGCGGCGGAGGAAGG - Exonic
917445601 1:175103797-175103819 CATAAGCGGCTGGCAGAGGTAGG - Intronic
921498506 1:215870539-215870561 CAGCAGTGGGAGGCCGAGGTGGG - Intronic
921706023 1:218323710-218323732 CATGAGAGGGAGGCCGAGGTGGG - Intronic
922669106 1:227495238-227495260 AATCTGAGGCTGGGGGAGGTGGG - Intergenic
922670491 1:227506064-227506086 AATCTGAGGCTGGGGGAGGTGGG + Intergenic
923479744 1:234373104-234373126 CCTGGGAGGCAGGCTGAGGTGGG + Intergenic
924242793 1:242056960-242056982 AATCCGAGGCTGGGGGAGGTGGG + Intergenic
1063281684 10:4636580-4636602 CATTAGGGGCAGGCGGTGATGGG - Intergenic
1063495322 10:6502230-6502252 CAGCTAAGGCAGGTGGAGGTAGG + Intronic
1064839364 10:19573349-19573371 CACCAGAGGCTGGCTGAGCTGGG - Intronic
1065320452 10:24504062-24504084 CATCAGTGGCTGGCGTAGTTTGG + Intronic
1068176908 10:53472590-53472612 CATCATAGGCATGATGAGGTAGG + Intergenic
1069114890 10:64492632-64492654 GGTCAGAGGCAGGCAGAGGAAGG - Intergenic
1069169595 10:65209772-65209794 CAACAGAGTCTGGAGGAGGTGGG - Intergenic
1069742250 10:70692254-70692276 CAGAAGAGCCAGGCGGAGGAGGG + Intronic
1070530869 10:77336040-77336062 CAGCAGATGCAGGGGGAAGTTGG + Intronic
1070791010 10:79189360-79189382 CATCAGAGGCAGAAGGAAGCTGG - Intronic
1070794772 10:79210153-79210175 CAGCAGAGGATGGAGGAGGTGGG + Intronic
1071959466 10:90796118-90796140 CATGATAGGAAGGGGGAGGTTGG - Intronic
1072606881 10:96991803-96991825 AAGCAGAGGCAGGAGGAGGGAGG - Intergenic
1072894942 10:99358761-99358783 CAAGAGTGGCAGGCAGAGGTGGG - Intronic
1073229543 10:101957060-101957082 CATCAGAGTCATGCAGAGTTGGG - Intronic
1074494699 10:113969520-113969542 CATAAGAGGCAGGCGCACCTGGG + Intergenic
1076167448 10:128293906-128293928 CCTCACAGGGAGGCGGAAGTGGG - Intergenic
1077236390 11:1483955-1483977 CTTCACAGGCAGGGGGAGCTGGG + Intronic
1077466458 11:2735928-2735950 AGTCAGAGGCAGGAGGAGGTGGG + Intronic
1077558054 11:3236079-3236101 CAAGAGAGGGAGGCTGAGGTGGG + Intergenic
1079250591 11:18784476-18784498 CACCAGAGGCTGGGGGAGATGGG + Intronic
1079871970 11:25808982-25809004 CACCAGAGGAAGGGGGAGATGGG + Intergenic
1080331698 11:31146917-31146939 TATCAAAGGCAGGCGGAAGGAGG - Intronic
1081767439 11:45621411-45621433 CATGGGAGGGAGGCTGAGGTGGG - Intergenic
1083336231 11:61923447-61923469 CACCACAGGCAGGCGGATGGTGG - Intergenic
1084794839 11:71498148-71498170 CATCAGAGGCAGGGGGACCCCGG + Intronic
1085584962 11:77693549-77693571 CATCAGAGGAGGGCGAAGGCAGG + Exonic
1086098157 11:83071369-83071391 AATCTGAGGAAGGCAGAGGTGGG - Intronic
1086399382 11:86448135-86448157 CATCATAGGTAGGAGGAGGGAGG - Exonic
1087124114 11:94606486-94606508 GATGAGAAGGAGGCGGAGGTAGG + Intronic
1087142067 11:94774370-94774392 CACAGGAGGCAGGAGGAGGTGGG + Intronic
1087211109 11:95447063-95447085 CATCAGAGGGAGGCCGAGGTGGG - Intergenic
1087828546 11:102793913-102793935 CATCACAGCCAGGCAGAGGAAGG - Intronic
1088371143 11:109089811-109089833 CATCATAGGCAGCTGGAGGGAGG - Intergenic
1088665934 11:112093723-112093745 GATCAGAGGAAGGCAGGGGTCGG - Intronic
1088799611 11:113293519-113293541 CAACAGAGGAAGGCGGGGGAGGG - Intergenic
1089709970 11:120307578-120307600 CTCCAGAGTCAGGCGGATGTTGG - Exonic
1089855988 11:121545193-121545215 CATTAGAGGCAGGCCCATGTAGG - Intronic
1090607002 11:128432040-128432062 CAGCAGAGGCTGGTGAAGGTTGG - Intergenic
1091427508 12:404068-404090 CAACACTGGCAGGCAGAGGTGGG + Intronic
1092132783 12:6124244-6124266 CCTCAGAGGCAAGTGGAGGAGGG + Intronic
1092149419 12:6236829-6236851 GGGCAGAGGCAGGCGGGGGTGGG - Intronic
1093527292 12:20116729-20116751 CATAAGCGGCTGGCAGAGGTAGG - Intergenic
1096993312 12:55822368-55822390 CACCAGAGGGCGGCAGAGGTAGG - Exonic
1097961183 12:65533395-65533417 CAGCAGAGACAGGAGGAGGGAGG - Intergenic
1098205081 12:68100465-68100487 AATCAGAGGCAGGAGAGGGTAGG + Intergenic
1098790528 12:74816740-74816762 CATGGGAGGGAGGCTGAGGTGGG + Intergenic
1099910952 12:88832770-88832792 CATGAGAGAGAGGTGGAGGTGGG + Intergenic
1101998969 12:109544910-109544932 CTTCACAGGCAGGAGGAAGTGGG - Intergenic
1102110450 12:110361541-110361563 CAGCACTGGCAGGCTGAGGTGGG + Intergenic
1102907618 12:116688844-116688866 CCACAGAAGCAGGCGGTGGTGGG + Intergenic
1102922618 12:116803618-116803640 CATCAGAGTCCAGTGGAGGTTGG + Intronic
1103244582 12:119445577-119445599 CATCTGAGGCAGACAGAGTTTGG + Intronic
1103477259 12:121227837-121227859 CAGCACAGGGAGGCGGAGGTAGG + Intronic
1103637141 12:122316454-122316476 CATCACTGGGAGGCTGAGGTGGG - Intronic
1103825115 12:123731836-123731858 TAGCACAGGCAGGCGGTGGTGGG - Intronic
1104643984 12:130484257-130484279 CATGAGAGGCAGGCAGATGGTGG - Intronic
1104648558 12:130514451-130514473 CAGCAAGGGCCGGCGGAGGTGGG - Intronic
1106300798 13:28462902-28462924 TCTCAGTGGCAGGAGGAGGTCGG - Intronic
1108262130 13:48668763-48668785 CATCAGAGCCTGTCGGGGGTTGG - Intronic
1108326856 13:49341569-49341591 TATCAGAGGCTGGGGAAGGTAGG + Intronic
1108531471 13:51331002-51331024 GATCAGAGGTGGGAGGAGGTGGG - Intergenic
1108849044 13:54705647-54705669 CATAAGTGGCTGGCAGAGGTAGG + Intergenic
1112054391 13:95677110-95677132 CAGCAGAGGAAGGCAGCGGTGGG - Intergenic
1112279846 13:98053347-98053369 CTTGGGAGGCAGGCTGAGGTGGG - Intergenic
1112323743 13:98429665-98429687 CAGCTGAGGCAGGAGGAAGTGGG + Intronic
1112519593 13:100083685-100083707 CATAAGCGGCTGGCAGAGGTAGG + Intergenic
1113545489 13:111145772-111145794 CCTCAGAGGCTGGTGCAGGTTGG + Intronic
1113652992 13:112050435-112050457 CATCAGAGAAAGGCGGAGAGGGG + Intergenic
1113803810 13:113101807-113101829 GAGCAGAGGCAGGAGGAGGAGGG + Intergenic
1114308163 14:21442218-21442240 CATCACTGGGAGGCGGAGGCAGG + Intronic
1114534891 14:23416596-23416618 AAACAGAGGGAGGCAGAGGTGGG + Intronic
1114658018 14:24327703-24327725 AATCAGAGACAGGAGGAAGTGGG + Intronic
1118309592 14:64682587-64682609 CAGCAAAGGCAGGCGAAGGAAGG + Intergenic
1118713195 14:68539415-68539437 ACTGAGAGGCAGGCGGAGGAGGG - Intronic
1119700671 14:76752488-76752510 CATCACAGGCAGGCTGGGTTAGG - Intergenic
1120769668 14:88365315-88365337 CATCACAGGAAGGGGAAGGTAGG - Intergenic
1121466321 14:94117724-94117746 CATCAAAGAAAGGGGGAGGTGGG - Intergenic
1121599868 14:95195404-95195426 AAACAGAGGCAGGGGGAGGAGGG - Intronic
1121734010 14:96205472-96205494 AATCAGAAGCAGGCGGGGGTGGG + Intronic
1121796597 14:96741305-96741327 AATGAGAGACAGGCGGAGGCAGG - Intergenic
1121871065 14:97407950-97407972 AATCAGAGGGAGGCAGAGGTGGG - Intergenic
1122310648 14:100792139-100792161 CATAAGAGGCTGGCGAGGGTGGG - Intergenic
1122762124 14:104036924-104036946 ACTCAGAGGCAGGCAGAGTTTGG - Intronic
1122836037 14:104431597-104431619 CAGCAGACGCAGCCTGAGGTGGG - Intergenic
1124051284 15:26199343-26199365 CAGCAGAGGAAGGGGGAGGCAGG - Intergenic
1124613109 15:31222579-31222601 CATCAGAGGGTGGGGGAGATAGG + Intergenic
1126990891 15:54374386-54374408 CATGAGAGGGAGGCCGGGGTGGG - Intronic
1127078102 15:55348098-55348120 CAGCTGAGGCAGGCTGAGGCAGG - Intronic
1127568528 15:60216883-60216905 CATTAGAGGCAGGAAGAGGCAGG - Intergenic
1128600430 15:68991184-68991206 CAGCAGAGCAGGGCGGAGGTTGG - Intronic
1129291169 15:74568995-74569017 CAGCAGAGGCAGATGGAGGGTGG - Intronic
1129321657 15:74778339-74778361 CATCTCAGCCAGGCTGAGGTGGG - Intergenic
1129669279 15:77598186-77598208 TATCAGAGACAGGCAGAGGTCGG - Intergenic
1130463056 15:84172853-84172875 CATCAGGGAGAGGCGGAGCTGGG + Intronic
1130489619 15:84421935-84421957 CATCAGGGAGAGGCGGAGCTGGG - Intergenic
1130501209 15:84500697-84500719 CATCAGGGAGAGGCGGAGCTGGG - Intergenic
1131067407 15:89443035-89443057 TCTCAGAGGCAGGCGGAGCCGGG + Intergenic
1131315384 15:91331818-91331840 CATCACAGGCATGCGTAGGCTGG - Intergenic
1132548995 16:546665-546687 CATTTGAGGCAGGCGGCGGTGGG - Intronic
1132700244 16:1219152-1219174 CAGCAGAGGCTGGCGGGGATGGG + Intronic
1132794855 16:1714825-1714847 AACCAGAGGGAGTCGGAGGTTGG + Intronic
1132864907 16:2088468-2088490 CACCAGAGGTAGGCTGGGGTTGG - Exonic
1133335317 16:5003363-5003385 CAGCAGAGCCAGGTGGAGCTGGG + Intronic
1133490670 16:6264986-6265008 CATGGGAGGCAGGACGAGGTTGG - Intronic
1134490829 16:14694227-14694249 CATCGGAGGGTGGCAGAGGTGGG + Exonic
1134496210 16:14733345-14733367 CATCGGAGGGTGGCAGAGGTGGG + Intronic
1134694621 16:16214393-16214415 CACCAGAGACAGGCATAGGTAGG + Exonic
1134977215 16:18580244-18580266 CACCAGAGACAGGCATAGGTAGG - Intergenic
1136154591 16:28374485-28374507 CATCGGAGGGTGGCAGAGGTGGG - Intergenic
1136208500 16:28740779-28740801 CATCGGAGGGTGGCAGAGGTGGG + Intergenic
1136264584 16:29107443-29107465 CATCGGAGGGTGGCAGAGGTGGG + Intergenic
1136687520 16:32003914-32003936 CACCAGAGGCAGGCTCAGGAGGG + Intergenic
1136788133 16:32947465-32947487 CACCAGAGGCAGGCTCAGGAGGG + Intergenic
1136881652 16:33906324-33906346 CACCAGAGGCAGGCTCAGGAGGG - Intergenic
1138412230 16:56849728-56849750 CAGCAGAGGCAAGCCCAGGTAGG - Intronic
1138412654 16:56852213-56852235 CAACAGCGGGAGGCGGAGGATGG + Intergenic
1141099340 16:81185592-81185614 CAGCAGAGTCAGGCGGCGGCAGG + Intergenic
1141894109 16:86947496-86947518 CATAAGTGGCAGGCAGAGGACGG - Intergenic
1142301335 16:89260154-89260176 CAACAGTGGCAGGCCGAGGCGGG + Intergenic
1142414383 16:89933616-89933638 CATCACAGGCAAGCCCAGGTCGG + Intronic
1203090358 16_KI270728v1_random:1209122-1209144 CACCAGAGGCAGGCTCAGGAGGG + Intergenic
1142493447 17:293243-293265 CATGAGTGGCAGGCGGAGGGAGG - Intronic
1143024126 17:3930892-3930914 CATCCCAGGGAGGCGGAGGCGGG + Intronic
1143167786 17:4906604-4906626 CATCACTGGGAGGCTGAGGTAGG + Intergenic
1143805724 17:9424519-9424541 AACCAGAGGCAGGGGGAGGAAGG - Intronic
1144718056 17:17447954-17447976 CACCAGAAGCTGGAGGAGGTAGG + Intergenic
1144770990 17:17759471-17759493 CATCAGAGGGTGGGGGTGGTGGG - Intronic
1145732112 17:27198661-27198683 CATCAGAGGTAGCAGGAGCTGGG - Intergenic
1146196997 17:30821970-30821992 CATCACCGGAAGGCAGAGGTGGG + Intronic
1146227555 17:31079908-31079930 CATCAGAGGTAGCAGGAGCTGGG + Intergenic
1146589950 17:34120316-34120338 CACCAGAGAGAGGCAGAGGTGGG - Intronic
1147148501 17:38499583-38499605 CACCAGAGGCAGGCTCAGGAGGG + Intronic
1147319831 17:39639492-39639514 TATCAGAGGGAGGCAGAGGCTGG + Intronic
1147452708 17:40515837-40515859 CATCAGAGGGTGGGGGAGGGTGG - Intergenic
1147572793 17:41581741-41581763 CACCAGAGGCAAGAGCAGGTGGG + Intergenic
1148051239 17:44770866-44770888 CATCACTGGGAGGCTGAGGTGGG + Intronic
1148449108 17:47763054-47763076 CAGCTGAGGCAGGAGAAGGTGGG - Intergenic
1151527429 17:74680631-74680653 CAGCTGAGGGAGGCAGAGGTGGG - Intronic
1152237058 17:79144165-79144187 GCTCAGAGGCAGGGGGAGGCAGG - Intronic
1153608132 18:6855021-6855043 CATGGGAGGGAGGCCGAGGTGGG + Intronic
1154357577 18:13633511-13633533 CATCAGTGGGAGGCTGAGGCAGG - Intronic
1155279122 18:24220133-24220155 CATCAGAGGCCAGTGGAGATTGG - Intronic
1156469378 18:37367947-37367969 CAGCAGAGTCAGGGGGAGGGTGG + Intronic
1158868211 18:61658536-61658558 CACCAAATGCAGGCGGTGGTGGG + Intergenic
1161041941 19:2115004-2115026 CTTCAGAGGCAGATGCAGGTTGG - Intronic
1161071927 19:2266729-2266751 CATCAGAGGCAGGCAGGAGGAGG + Intronic
1161241268 19:3225099-3225121 CGGCAGAGGCAGGCAGAGGAGGG - Intronic
1161437621 19:4273162-4273184 CATCAGAGGGATGGGGAGGAGGG + Intergenic
1161847576 19:6720524-6720546 CCCCAGAGCCAGGGGGAGGTGGG + Exonic
1161996098 19:7712499-7712521 TACCAGAGGCAGGTGGTGGTGGG + Intergenic
1163054188 19:14706080-14706102 CAGGAGAGGCAGCTGGAGGTGGG - Intronic
1163768672 19:19177813-19177835 CATCAGAGGCAGGCAGGGCTGGG + Intronic
1165377006 19:35449875-35449897 CAGCAGCAGCAGGAGGAGGTCGG - Exonic
1165848825 19:38837099-38837121 CATCAGAGACTGGCTTAGGTAGG - Intronic
1166861606 19:45814861-45814883 CATCAGAGTAAGGCTGAGGCTGG + Exonic
1166863134 19:45821133-45821155 CATCAGAGGCAGAAAAAGGTGGG + Intronic
1167011703 19:46813107-46813129 CATCAGAGGCAGCTGGAGCCGGG + Intergenic
1168646173 19:58060353-58060375 TTTCAGAGGCAGGCTGTGGTTGG - Intronic
925042024 2:739862-739884 CGTCAGAGGGAGGCAGAGATCGG + Intergenic
925249238 2:2417071-2417093 CATCAGTGGCAGGCTAAGGCTGG + Intergenic
925289426 2:2737243-2737265 CATCAGGGGCAGGAGCAGCTGGG + Intergenic
925741241 2:7007667-7007689 CATCAGAGGCAGGAACAGGCAGG - Intronic
928762867 2:34605219-34605241 CTTAAGAGGCAGGAGGAGATGGG + Intergenic
930038979 2:47106003-47106025 CATAAGCGGCTGGCAGAGGTAGG + Intronic
931274255 2:60730382-60730404 CAACACAGGCAGGCTGAGGTGGG + Intergenic
932623036 2:73277341-73277363 CAATAAAGGCAGGGGGAGGTAGG + Intronic
934949160 2:98564542-98564564 CAGCAGAGGAAGGGGGCGGTGGG + Intronic
937836677 2:126478105-126478127 GCTCAGAGGAAGGCAGAGGTGGG - Intergenic
943396212 2:187338641-187338663 CATGGGAGGGAGGCAGAGGTGGG - Intergenic
945259481 2:207830749-207830771 CCTCTGAGGCATGCGGAGTTGGG - Intronic
946164728 2:217857134-217857156 CAGCAGAGGCAGCCGTGGGTGGG - Intronic
948275996 2:236709246-236709268 CCTCAGCGGCAGGCGGAGTGTGG + Intergenic
948667217 2:239544106-239544128 CACAAGAGGCAGGGAGAGGTGGG + Intergenic
1169246719 20:4031872-4031894 CATCAGAGGGGGGCGGGGGAGGG - Intergenic
1169405930 20:5321254-5321276 CCTCAGAGAGAGGCGGTGGTGGG + Intergenic
1169715969 20:8618414-8618436 CACCTTAGGCAGGCAGAGGTGGG + Intronic
1169908944 20:10631307-10631329 CCTCTGAGGAAGCCGGAGGTGGG + Intronic
1170458323 20:16553982-16554004 CATGGGAGGGAGGCTGAGGTGGG + Intronic
1171169909 20:23006830-23006852 AATCAGAGGCTGTGGGAGGTAGG - Intergenic
1171197887 20:23215529-23215551 AATCAGTGGCAAGAGGAGGTGGG - Intergenic
1171393384 20:24815655-24815677 CAACAGAGGCAGGTGGAGAAGGG - Intergenic
1171461256 20:25299287-25299309 CTTGGGAGGCAGGCTGAGGTGGG + Intronic
1173656809 20:44705075-44705097 CATGAGAGCCAGTTGGAGGTGGG - Intergenic
1174458788 20:50668329-50668351 CATCAGGGGCAGGAGGAGGAAGG - Intronic
1175625579 20:60486063-60486085 CAGCAGAGGCAGCTGGGGGTGGG + Intergenic
1175968769 20:62673394-62673416 CATCAGAGGTGGGTGGAGCTAGG + Intronic
1176085937 20:63295527-63295549 CACCAGTGGGAGGCGGCGGTGGG - Intronic
1177344681 21:19854079-19854101 CATGGGAGGGAGGCCGAGGTGGG - Intergenic
1177622982 21:23620767-23620789 CATCAGAGTCAGTCAGAGGCAGG + Intergenic
1178242169 21:30915494-30915516 CATCTTTGGGAGGCGGAGGTGGG + Intergenic
1178506948 21:33170207-33170229 CAGCAGAGGGAGGAGGAGGCAGG - Exonic
1179164319 21:38924087-38924109 CATGGAAGGCAGGCGAAGGTTGG + Intergenic
1179174804 21:39000666-39000688 CAGCAGAGCCAGGGGGCGGTGGG - Intergenic
1179598825 21:42461906-42461928 CATCAGAGGCAGGGTGAGGAGGG + Intergenic
1179798254 21:43798282-43798304 CATCAGAGGCTGGGGGATGAGGG - Intronic
1180665851 22:17511424-17511446 CATCAGGAGCAGCCGGAGGTGGG - Intronic
1181414665 22:22750715-22750737 AATGAGAGGCAGGCCGAGGTGGG - Intronic
1181423035 22:22815007-22815029 AATGAGAGGCAGGCTGAAGTGGG - Intronic
1181928243 22:26377687-26377709 CATCAGAGGCAGGCGGAGGTTGG - Exonic
1183260342 22:36790762-36790784 CATCAGAGCCAGGAGGTGGCAGG + Intergenic
1184109911 22:42388619-42388641 GCTCAGAGGCAGGAGGAGGGCGG + Intronic
1184523951 22:45010366-45010388 TATCAGAGGGAGGCGGAGGAGGG - Intergenic
1184775390 22:46620548-46620570 TATCTGAGACAGACGGAGGTAGG + Exonic
1184837944 22:47035205-47035227 CCCCGGAGGCAGGCGGGGGTGGG - Intronic
950910980 3:16591539-16591561 CTTCAGAGGGAGGCTGAGGTAGG - Intronic
953350015 3:42208469-42208491 GAACACAGGCAGGCCGAGGTGGG - Intronic
953704400 3:45220284-45220306 CATCAGGGGCATGAAGAGGTGGG - Intergenic
954441646 3:50525445-50525467 CAGCAGAGGCGGGGGGAGGGAGG + Intergenic
955231381 3:57102012-57102034 CATGAGAGGGAGGCTGAGGCAGG + Intronic
955373853 3:58377530-58377552 CTCGAGAGGCAGGCTGAGGTGGG + Intronic
956142152 3:66156753-66156775 AATCAGAGGCAGGTGGATCTCGG - Intronic
957680631 3:83428580-83428602 CAGCTGAGGCAGGCTGAGGCAGG + Intergenic
958601535 3:96301197-96301219 CATAAGTGGCTGGCGGAGGCAGG + Intergenic
959623976 3:108428757-108428779 AATGAGAGGCTGGAGGAGGTAGG - Exonic
960950574 3:122996217-122996239 CAACAGAGGCTGCCGAAGGTGGG + Intronic
961203179 3:125060468-125060490 CACCTGAGGCAGGAGGAAGTGGG + Intergenic
961669211 3:128516869-128516891 CATAAGAGGGAGGCAGAAGTGGG + Intergenic
962379496 3:134886136-134886158 CAGCAGAAGCAGGAGGATGTGGG + Intronic
962889918 3:139662596-139662618 CATCAGAGGAAGCAGGAGCTAGG - Intronic
963021554 3:140876820-140876842 CATAAGAGGCTGGCAGAGGCAGG + Intergenic
963899781 3:150723126-150723148 CACCAGAGTCAGGAGGAGATAGG + Intergenic
964918208 3:161861516-161861538 TATCGGGGGCAGGCGGAGGGTGG + Intergenic
967577582 3:191112986-191113008 CTTCAGTGGCGGGCTGAGGTGGG + Intergenic
968005906 3:195242633-195242655 CATGGGAGGCTGGAGGAGGTGGG + Intronic
969038251 4:4273494-4273516 CTTCAGAGGCAGGGGCAGGAGGG - Intronic
969543900 4:7811463-7811485 CAGCAGAGAGAGGCGGAGATTGG - Intronic
969669095 4:8579969-8579991 CCACAGAGGATGGCGGAGGTGGG + Intronic
971315751 4:25566485-25566507 TGTCAGAGGCTGGCGGAAGTCGG - Intergenic
971550351 4:27947423-27947445 CATCAGAGGGAGGCTGAATTGGG + Intergenic
974085572 4:57257039-57257061 TATCAGAGGTAGACGGTGGTAGG - Intergenic
975595387 4:76044779-76044801 CATAAGCGGCTGGCAGAGGTAGG - Intronic
976790287 4:88870651-88870673 CTGCAGAGGCAGGCTGCGGTAGG - Intronic
977093943 4:92714848-92714870 CATCACAGGCAGGGAGAGCTAGG - Intronic
977726449 4:100302228-100302250 CATCAGGGGCAGGTTGTGGTTGG + Intergenic
978310234 4:107379270-107379292 CATCAGAGGCAGGTGGTGTAGGG + Intergenic
982545162 4:156724472-156724494 CATGGGAGGGAGGTGGAGGTGGG + Intergenic
983045349 4:162980256-162980278 CCTCAGAGGTAGGCAGGGGTAGG + Intergenic
985511095 5:314271-314293 CAGCACAGGGAGGCGCAGGTGGG - Intronic
986131859 5:4939480-4939502 CATAAGAGGCAGGTGGAGAATGG - Intergenic
986719294 5:10549633-10549655 CACCAGAGGCTGGAGGAGGCAGG - Intergenic
988454317 5:31373651-31373673 CAACAGAAGCAGGAGGAGGCAGG - Intergenic
988525922 5:31987476-31987498 CATCAGAGGCAGCCTGAGGATGG + Intronic
989101270 5:37825627-37825649 TATCAGAGGCAGGTGGTTGTGGG + Intronic
990678303 5:58213349-58213371 CATCAGAGGAGGGAGGAAGTTGG - Intergenic
991041635 5:62182421-62182443 CTTCAGAGGCATGCAGAGGCTGG - Intergenic
991145776 5:63301950-63301972 AAACAGAGGCAGGTGGAGGGTGG - Intergenic
991956258 5:71998398-71998420 CAGCAGAGGCTGGTGGAGGAAGG + Intergenic
993635505 5:90338099-90338121 CATCAGTGGCCGGGGGATGTGGG + Intergenic
997255215 5:132423204-132423226 CAGCATAGGCAGGAGGAGTTGGG + Intronic
998072437 5:139208636-139208658 CTTTAGAGGGAGGCCGAGGTGGG - Intronic
998134388 5:139667081-139667103 CATCATGGGCAGGCTGAGCTGGG + Intronic
998146711 5:139733414-139733436 CATCAGAGGAAGGGGTAAGTGGG - Intergenic
1000637340 5:163659363-163659385 CCTCAGAGACTGGAGGAGGTTGG + Intergenic
1001437577 5:171712203-171712225 AATGAGAGGCAGGCTGAGGGTGG - Intergenic
1001563650 5:172686129-172686151 CATCAGGGGCAGTGGAAGGTTGG - Intronic
1002027850 5:176407548-176407570 CAGCAGTGGGAGGCTGAGGTGGG - Intronic
1002711105 5:181195491-181195513 CATCACTGGGAGGTGGAGGTGGG - Exonic
1003187861 6:3848964-3848986 CATCAGAGGCGGGAGGAGGAGGG + Intergenic
1006104249 6:31707076-31707098 TGTCAGAGGCAGGAGGAGGTTGG - Intronic
1006197619 6:32255423-32255445 TTTAAGAGGCAGGCGGAGGAAGG - Intergenic
1006378980 6:33687019-33687041 CATCAGAGCCAGGAGCAGCTTGG - Exonic
1006793477 6:36718101-36718123 CAGCAGCTGCAGGCTGAGGTGGG + Exonic
1006797434 6:36740889-36740911 AAGCAGAGGCAGGCGGAAGACGG + Exonic
1007751202 6:44073031-44073053 CAGCAGAGGCAGGCGGGTGAGGG + Intergenic
1009407292 6:63327835-63327857 CATAAGCGGCTGGCAGAGGTAGG - Intergenic
1011559432 6:88599787-88599809 CACCAGAGGCACTGGGAGGTGGG + Intergenic
1011732099 6:90275350-90275372 CATCCCAGGTAGGGGGAGGTAGG - Intronic
1012142057 6:95636618-95636640 CATGGGAGGGAGGCTGAGGTAGG - Intergenic
1015400238 6:132780343-132780365 CATAAGTGGGAGGCTGAGGTGGG - Intronic
1015839116 6:137457204-137457226 CAAGAGAGCCAGGCAGAGGTGGG + Intergenic
1017369182 6:153684465-153684487 CATCAGAGCCAATCTGAGGTGGG + Intergenic
1017474895 6:154780528-154780550 CATCAGGGCCAGTCGGGGGTGGG - Intronic
1019335646 7:481309-481331 CTCCAGAGGAAGGCCGAGGTGGG + Intergenic
1019497440 7:1347039-1347061 GCTGAGAGGCAGGCTGAGGTCGG - Intergenic
1022652410 7:32289296-32289318 ACTCAGAGGCAGGCTGAGGCAGG + Intronic
1023628404 7:42139084-42139106 CAGCAGGGCCAGGCTGAGGTTGG - Intronic
1024008098 7:45242000-45242022 CATCATAGGGAGGCAGTGGTGGG - Intergenic
1028026270 7:85844354-85844376 TATCAGAGGCTGGAGGGGGTGGG + Intergenic
1028231807 7:88314633-88314655 CTTTAGAAGCAGGGGGAGGTAGG + Intergenic
1028762331 7:94509896-94509918 GAGGAGGGGCAGGCGGAGGTCGG + Exonic
1029103373 7:98153051-98153073 CAGGAGAGGCAGGAGGAAGTCGG + Intronic
1029872021 7:103704553-103704575 CTTCAGAAGCAAGGGGAGGTGGG - Intronic
1030359414 7:108579618-108579640 CATGGGAGGGAGGCTGAGGTGGG + Intergenic
1035143105 7:156784317-156784339 CATCAGAGGCAGGAGATGATAGG - Intronic
1035321267 7:158030693-158030715 CACCAGAGGCTGGAGGAGGCAGG + Intronic
1035426503 7:158779693-158779715 CATCAGAGACAGGAGCAGATTGG - Intronic
1036156937 8:6350875-6350897 AAGCAGAGGCCGGAGGAGGTGGG + Intergenic
1038014224 8:23499609-23499631 AGTCAGGGGCAGGTGGAGGTGGG + Intergenic
1039856178 8:41416276-41416298 AGTCAGAGGCTGGCAGAGGTGGG + Intergenic
1040817701 8:51526566-51526588 ATACAGAGGCAGGAGGAGGTTGG - Intronic
1042906800 8:73780209-73780231 CATCAGAGGCTGGAAGAGGCAGG - Intronic
1043551421 8:81377103-81377125 CCTCAGAGGCAAGAGGAGATTGG + Intergenic
1044939095 8:97322214-97322236 CTCCAGAGGCAGACAGAGGTAGG + Intergenic
1045337755 8:101224015-101224037 CGTCAGAGGCATGGGGTGGTGGG - Intergenic
1045376345 8:101578232-101578254 AATCAAAGGGAGGAGGAGGTGGG + Intronic
1047261260 8:123262591-123262613 CAACACAGGGAGGCAGAGGTGGG - Intronic
1049010127 8:139881920-139881942 CATCAGAGGGAGGCCCAGGCAGG - Intronic
1049018379 8:139937508-139937530 CTTCAGGAGCAGGCGGAGGCTGG + Intronic
1049091449 8:140517651-140517673 CATCACTGGGAGGCCGAGGTGGG - Intergenic
1049710897 8:144062890-144062912 CCCAGGAGGCAGGCGGAGGTGGG - Intronic
1050150006 9:2609772-2609794 GACCAGAGGCTGGGGGAGGTGGG + Intergenic
1052326108 9:27218167-27218189 CATCAGAGGCTGGCGGTGAAAGG + Intronic
1053399109 9:37801434-37801456 CAGCAGAGCCGGGCGGAGGCGGG - Intronic
1053565298 9:39243175-39243197 TGTCAGAGGCAGGGGGAGGAGGG - Intronic
1053831067 9:42081024-42081046 TGTCAGAGGCAGGGGGAGGAGGG - Intronic
1054131853 9:61375864-61375886 TGTCAGAGGCAGGGGGAGGAGGG + Intergenic
1054599482 9:67106414-67106436 TGTCAGAGGCAGGGGGAGGAGGG + Intergenic
1059343638 9:113613598-113613620 CATCAGGGGCAGGGGCTGGTGGG + Intergenic
1061189030 9:129071112-129071134 CACCAAAGACGGGCGGAGGTGGG + Exonic
1061655934 9:132090105-132090127 CATCATAGGCAGGAAGAAGTAGG + Intergenic
1062060299 9:134491913-134491935 CCTGAGAGGCAGGTGGAGGCAGG - Intergenic
1062248430 9:135582213-135582235 CAGCAGAGGCTGGCAGTGGTCGG + Intergenic
1062289103 9:135786662-135786684 CAGTAGAGGCAGGCAGAGGGTGG - Intronic
1062329086 9:136028956-136028978 CACAAGAGGGAGGCCGAGGTGGG + Intronic
1062437884 9:136554691-136554713 CAACAGAAGCTGGAGGAGGTGGG + Intergenic
1062569318 9:137177714-137177736 CATCAGAGGCACCGGGAGTTAGG - Intronic
1191719746 X:64219578-64219600 CATCAGAGGCTGGGGGACTTTGG - Intergenic
1195630162 X:107047503-107047525 CACCTGTGGGAGGCGGAGGTGGG - Intergenic